MIME-Version: 1.0 Content-Type: multipart/related; boundary="----=_NextPart_01CB4F61.67D0A4A0" This document is a Single File Web Page, also known as a Web Archive file. If you are seeing this message, your browser or editor doesn't support Web Archive files. Please download a browser that supports Web Archive, such as Windows® Internet Explorer®. ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases

This presentation contains content that your browser may not be able to = show properly.

If you would like to proceed anyway, click here.

------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"
Click to edit Master title style
Click to edit Master text styles
Second level
Third level
Fourth level
Fifth level
‹#›
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/preview.wmf Content-Transfer-Encoding: base64 Content-Type: image/x-wmf AQAJAAADvHAAAAAAoXAAAAAABQAAAAsCAAAAAAUAAAAMAtACwAMFAAAABwEDAAAAoXAAAEELIADM AHgAoAAAAAAA0ALAAwAAAAAoAAAAoAAAAHgAAAABABgAAAAAAADhAAAAAAAAAAAAAAAAAAAAAAAA //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// //////////////////////////////////////////////////////////////////////////// ////////////////////////////////////////AwAAAAAA ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image001.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgAAZABkAAD/7AARRHVja3kAAQAEAAAAQQAA/+4ADkFkb2JlAGTAAAAAAf/b AIQABQQEBAQEBQQEBQcFBAUHCQYFBQYJCggICQgICg0KCwsLCwoNDAwMDQwMDA8PEREPDxcWFhYX GRkZGRkZGRkZGQEGBgYKCQoTDQ0TFhEOERYZGRkZGRkZGRkZGRkZGRkZGRkZGRkZGRkZGRkZGRkZ GRkZGRkZGRkZGRkZGRkZGRkZ/8AAEQgEsAZAAwERAAIRAQMRAf/EALkAAQEBAQEBAQEBAQAAAAAA AAABAwIEBQYHCAkBAQEBAQEBAQEAAAAAAAAAAAABAgMEBQYHEAABAgQACQULCAcGBQMEAgMAAQIR AwQFEtITk9MUlFUGITFSVBZBUWHR4ZJTZBWVVpGhsqOEpNQHcbEiMjRFF0KiI4MkNYFigrMlwTND cnNEdMJj8LRGEQEAAgEBBwQDAAMBAQADAAAAARECEjFRYZEDExTw0QQVIUGhgTIF8SLhUmL/2gAM AwEAAhEDEQA/AP7Xgr0l+bxHynYwV6S/N4gNpbFh+8vzeIzKw4mNVHfvL83iLCNZTHIkVcvL+jxE mVaQ/wCZfm8RkXl76/N4gEF76/N4gKiL31+bxAWC99fm8QFgvfX5vEAg7vr83iAsF76/MAiqd1fm ARXvr8wodI7wr8wodRTpL8xBf+r9QFRPD+oKsPD+oIf8f1ASKJ3f1BUw0Tur8xaRys1O+ooMqnfU UGWTvqKDLJ31FDpJze+vzChcq3pCgyre+KDKt7/6hRbpJjekKFR7V/tEoWKdL9QVYp0v1BF/4gIe EKQ8ICHhAQ8ICHhAQ8ICHhAQ8ICHhAQ8IQh4QEPCAh4QMJkpy8qKvzFiR53McndX5vEaGTmO6S/N 4ioxVrk/tL83iKEF6S/N4ghBekvzeIBBekvzeIBy9Jfm8QUgvSX5vEBIL0l+bxAIL0l+bxAIL0l+ bxAIL0l+bxAIL0l+bxAIL0l+bxAIL0l+bxAIL0l+bxAIL0l+bxAIL0l+bxAIL0l+bxAIL0l+bxAI L0l+bxAIL0l+bxAIL0l+bxAOXpL83iCEF6S/N4gqQXpL83iCEF6S/N4gEF6S/N4gLy9Jfm8QU5ek vzeICcvSX5vEAgvSX5vEA5ekvzeIC8vSX5vEA5ekvzeIBy9Jfm8QFivSX5vEBUX/AJl+bxAXC/5l +bxAEd/zL83iA7R3/MvzeIg6R3/MvzeIDqP/ADL83iAsf+ZfmAf9S/N4gL/1L83iIL/1L83iAnL0 l+bxAP8AqX5vEUP+pfmAf9S/N4gL/wBS/N4iCp/9S/MBYf8AMvzAFRekvzAEavSX5vEBYL31+YBB e+vzFUgvfX5iBBe+vzAMFe+vzAMFe+vzAMFe+vzFQwV76/MAwV76/MAwV76/MAwV76/MBcFekvzA MFekvzAMHwr8wDB8K/MAh4V+YBDwr8wCC99fmAQXvr8wCC99fmKEF76/MAgvfX5gEF76/MAgvfX5 gEF76/MBYL31+YBBe+vzAIeFfmAsF76/MAgvfX5gEF76/MAgvfX5gEF76/MBYL31+YBDwr8wCHhX 5ghy99fm8QEivfX5vEVSK99fm8RESK99fm8RVIr31+bxATCXvr83iAYS99fm8QRMNe+vzeIBhr31 +bxATKO76/N4gJlHd9fm8QDKu76/N4gJlX9Jfm8RaEWc/vr83iFCZZ/SX5vEKDLP6S/N4gJl5nSX 5vEKEy8zpL83iFCaxM6S/N4hQmszekvzeIUJrM3pL83iFCa1O6X6vEWhytVO6X6vEKE1ud0vmTxC hNbndL5k8QocrWT+l8yeIUJrs/pfMniFDla6o6XzJ4hQmvVHS+ZPEWhNfqOl8yeImkcLcKnpfMni LUCLcarpfMniGmBytyqul8yeIaYHK3Or6fzJ4hphHK3Sr6fzJ4hphXK3Ws6afI3xF0wjhbtWdNPk b4hpgcrd63pp8jfENMKi3itT+2nyJ4hphHC3mu6afIniGmC3C3uu6aeaniGmC3K3yv6aea3xDTBb hb7cOmnmt8Q0wOVv9w6bfNb4hpgtwvEFxT+23zW+IumC3C8RXLpt81viGiC3K8R3Lpt81viGiC3C 8SXPpt81viGiC3C8TXTpt81viGiC3C8T3Xps81PENEFuF4puyf22eaniGiC3C8V3ZP7bPMTxDRBb heLbv02eYhdEFuF4uvCf22eYg0QW4XjC8p/al+Yg0QW4XjK9dOX5iDRBbheNL0n9qX5iDRBbNeNr 30pfmINEFv6ccGnTUipJHoRIJAwrhW4T4rzIav8AA1MioBQLygOXvgXlARUCxUCosQOiBBAGCneK LgoAwUIEEKOVA5VSjhXFHMVCJFQJFShEgRKLEBEgRKESBECxAYQFwl74VcNe+KHWUd3yUKk1/fFD pJzxQ6Se7vChUn99CUW6Sc0UW6SY1RSusJF7pBQAAAAAgRFY1edCjhZLVFjJ1MilsYPplTmLaUxd Kc3uGrHKoqBEAAAIFAAAAAAAAAAAAAAAAAIAAAAABABVAAAAAAAAAAgRUC4SgXDUDrKAVJgFwyC4 YFwgGEAwgLhAXCA6RwFwgOkUgsQKVQgoQAACgAAAAAAAAAAAAAABQACACBQgAgBQAAAAAoAIBVAg ADkohEAIVUAgQAgEUCFVAiARQIURSCKURQOVAgEA5UI5UqoByoHKoByqfrA5VCo5VAOVA4Xugcqg HKgcKhRwpByqFHCoBwoHCgcKhRmoHCoBmoHCgZuKM1A4VAM1AyUDhQM3IVGTkAzVAM3IBm5CjNwG TgMlA/uZ5W28tsEj3TEyrsgJ8wHSAUCoBSAUUgFAAB2hBQqhAChXKqVGSqUcKpRyEAAACFUILAIA AAABAAAAACixILEBECxCrEDpFIKir3wOkeqChokwlDtHopFdAAAAAAAkIgcOlopbR55kjvIaiR5n S1QtozVIFECAAKgAAAAAAAAAAAAAAAAEAAAAAAAQqgAAAAAAAAABCAAAAWKgMIDrCAuEBYgWIFiB YkFwgKjgOkcB0jgOkcBYgWJBQBQAAAAFAQAQAQAQAQAQAoAAAAAAAAAUAAFABAKoAAAAgEKIAAig QCKEQABFCoUQIgEUCFEIIpRFA5AgEA5UDlSiAcqgHKoByoHKoUcqBFCOF7oHCgcqBypRwpBwqFHC gcKgHCgcKhRmqAcKgGaoBwqAZqUcKgGaoBmoRmoVwoRk5CjNwGaoBm4DJxRm4DJyAZOA/uzG91Tx zLbZDKpz8gHSAVAKBUIKUUgAUoEUUqK0DoiqEAAVw9SwjBVNCBAAAAAAAAAAApVAAAIBQIAQABSK oQAsQqxCLEKsSDpFA7R6oB2kzvkodo5FIOgoAAQAgBUiBk+SjuYto8syQqGolHncxUNWOAgAAgUA AAAAAAAAAAAAAABAAAAAAAEAFUAAAAAAAAAAIQAAAAEALFQLhBVwgLECxAsQLEC4QHSOIKjgOkcB 0jgOkcBYgUABQqhAAAAAAAAAAAAALABABAoQAAAAFAAAAFCIFAOSiEQKAECoEQABFCoUQIgEAhRC CQKIByoEAgHKgRUKOQIoHKgcqBypRyoHKgcL3QjlQOVA4Uo4VCDhUKOFQDlUA4VAM1Qo4VAOFQDN yAcKgGalGaoBwoGagZOQDhUAzchUZOAzUDNwGTgM1KMnAZKB/eTwuixAqIB0AQgpRSClFIBRSKoQ UA0o6QiqEAooGD1NQjMqAAAAAAAAAKoAAEUAAAAAAAAAAgFAAAqhFARCukUg6RwHSOA7R6kHSTBQ 6RyKQdAAAACK1FAwmSEXmLEjxzJKobiUYqioUQIAAqAAAAAAAAAAAAAAAAgAAAAAACACqAAAAAAA AAAACEAAAABAAAAsQqo4DrCAsQLECxAsQKjgOkcQdI4DpHAdI4C4QFRQLECgAAAABYAAAACgAAAA AAFAAAAoQCgACAQohACIVUABEAgEUKhQCIBFAhRFIIpRF7oEVAOQIBFA5Uo5gBFA5UDlQjlSq5VA jlUCuV7oRwoHKoBwpRypBwpRwoHAHCoBmpRwoHCgZqBwqAZqBmqFHCgZqgGTgOFAzcVGTgM1QDNy AZOQDNxRm4DJQP7ueF0VPnA6QCgVCAUdEAopBSqpEABQaB2hFAgBy50EKPOqxU0IEAAAAAAAAKVQ goQAAAAAAFAAAAACAAAACqACKFALEIuEFdI4g6RwHaP8JB2j++B3GJAAAAOXMR3OUeeZTovMWJHj mSXNNRKMioAAqAAAAAAAAAAAAAAAAAQAAAAAABCqAAAAAAAAAAAABCAAABAAAAAALEC4QVUcBcIC xAsQOogXCAqOA6RxB0jwOkcB0jgLhAWIFAsQAACgAAABABACwAQKAAAAAAAKBAAHJQAgBQiBUCAE AihUKIEAIoEAgEKIByBAIBFA5UoigcqByqAcqEcqVXKoEcqgHK90DhUA5VAOVQDhQOFKOFA4UDhQ OFKM1A5UDJQOFAzcgGalHCgZqEZuAzUKzcEZOKM1AzUDJxRmoGbgMnAf3aB4XR0BUAoFIBR0QEKK QUqqRAAUVEgRXQAI4c9ELQxc6JqhyEAAEiAKoQUIAAKFAKEAAAAFAAAAAAsAEAEAEAEAIAAoAIoU iBQgACqigdo8g7R4GiPIOkVFIKAAAcuY13OhbHjm03dQ1EjyOY5q8qGrRyEAIFAAAAAAAAAAAAAA AAQAAAAAABABVAAAAAAAAAAAAAhAAAAgAAAAAAABYqBUcFVHAdYQFiBYgWIHSOAqOA6R4HSOIOkc B1hAVFA6iAAoACgAAAAAAACgAAAUAAA5KIRAAVXIAIgACKBCqhECjlQAEAgEUo5UCAQCKBypRAOQ OQOV/wDUDlUKOVAihHC90K4VAjlQOVQo4Ug4Uo4UDhQOFA4UozUDlQM1AzUDhxRmoGaoBmoGbkAz UIzcUZOAzVAM3AZOA4cBk4oycB/dkPC6KBUAoFIKhRSAhRSClVSInKpR0iQIKFRXIgRm6YaoZK6J RIhEAvKAAQAQAQKEFAcpA5QLEBECxARAAUAFAAAChAAAAAAAAAAAAAAACxCqEAoBYgdI5UIO0eBo jyDtFRSCgAAGT5LX/pLY8c2mVvKhqJSnmVFTkU0iAQKAAAAAAAAAAAAAAAAgAAAAAACACqAAAEig CKd8CYTe+Awm98Bht76AMNnSQCZRnSQBlJfSQBlZfSQCZWV00+UBlpXTT5SCZeT00+UoZeT02/KE MvJ9I35QJrEj0jflFBrMj0jflFBrNP6VvyihNap/St+UUGtU3pW/KKE1um9K35RQa5S+mZ8ooNdp fTM+UULr1L6ZnyihUr6T07PlFK6SvpPTs+UULr1J6ZnyihdepPTs+UULr1J6dnykoda9SenZ8ooX X6T07PlFDpLhSenZ8oodJX0np2fKKHSV9J6Znyih2ldS+mZ8oodJW0vpmfKKF1yl9Mz5RQ61um9K 35RQutU3pW/KSg1qm9K35S0GtU/pW/KKDWqf0rflFBrVP6VvyihdapvSt+UUGtU3pW/KKDWqb0rf lFBrVN6VvyikNapvSt+UVIutU3pW/KKkTWqf0rflLSmtU3pW/KKkTWaf0rflFCazT+lb8oqUNZp/ St+UVIazT+mZ8oqRNZp/Ss+UtSqazT+lb8oqUNZp/St+UVImsU/pW/KKkFqKf0rflFSJrFP6Vvyi pE1in9K35RQmsU/pW/KWpE1in9K35RUhrFP6VvyipE1in9K35RUiaxT+lb8oqRFqKf0rflFSOdYp /St+UtSJrNP6VnyipE1mm9K35RUjlamn9K35RUoi1NP6ZnyipVytTTemZ8oqRFqab0zPlLUjlaqm 9Mz5RUo5WqpvTM+UVI4WqpvTM+UVIi1VL6ZnylqRytVS+mZ8pKkcLV0vL/jM+UtSOFq6X07PlFSO Vq6T07PlFSOFq6T07PlFSOFrKT07PlFSOFrKT07PlLUjhayj6wz5RUjhayj6xL+UVI4Wto+sS/lF SM1raPrEv5RUjha2i6xL+UtSM1rqLrEv5RUjN1dQ9Zl/KKkcLXUPWZfyipRmtfQ9Zl/KKlWa19D1 mX8oqUZrcKDrUv5S1IzW4UHWpfyipGS3Cg61K+UVIzW42/rUr5RUjN1xt/WpXnFqRk642/rcrzhU jNblbutyvOFSMnXK3dblecKkZuuVu63K84VIydc7b1yV5wqRk6523rkrzi1Iydc7b1yT5wqR/oFD wOigVAKBSCoVVIioUCB+gosCChRXohaRmszvFocK5VKJBy9wDpJT17hLHSSHCx0khe+LFyHhJYuQ 8IsXIJ3xZRkPCLKMh4RZSauvfLZSZBwsc5F/eFiLLcncLY5wV7yhEgAgAgA5QEQEQLEKAUIAAAAA AAAAAAAAAAAAFiFWIACgAKiqhB2jwNWzCUNEVFIoACCoi84Hnm0zX8qGokeGZJcxeY1EoyKiBQAA AAAAAAAAAAAAAEAAAAAAAAIVQDlVAikHCqUcBEUDlVCuFKiKBwoHIHKgcqFcqEcrADhSjkCLADhY AcgcrADlSjlYAcrDvAcLADlUTvAReQCYcALlAOkmoBUmIB1hoBcNAKj0A6SYB2k0Dts4g0SegGrZ 6AatnIB2k1qgdo9qgVFRQLyAOTvFF5O8BYJ3gEPABYJ3gEE7wCCFEgBIIAggQghQggCCASCAIIBI FCCAIASAE5AJAogEgAggHKogEgByqJ3io5VAOVRAIqIBwqJ3ijlUQDlUQDhUQDhUTvAcKid4o4VE A4VEA4VE7wGaogGaoneKM1RAM3IneAzVE7wGbkTvFRkqJ3gM1RO8Bk5E7wGTkTvAZORO8Bk5E7xR k5E7wGTkTvAYuRO8Bk5E7xRi5E7wGTkTvAYuRO8Bi5E7xRi5E7yBGLkTvIBk5E7yAYORO8gGLkTv IUYuRO8gH+yEPlOygUCgUgqFFIESi/pIEUQqiuCOf2lAuTVedYCxUlN7vKLHaMancIOgKFUIBVQA EUKAUIBQCgAhBO8FRWNXuCxyshi9wto4WmTuKLHC07k5uUtjhZT050FjnBgUSACAQARCrEIAAAFC gAAAAAAAECAAABQpECgALECopB214GzZhKHaKi8wVYEEKjlzGuSCoB5J1L3Wmokp43MVqwVDSOAA AAAAAAAAAAAAAAAAEAAAAAAARQOFKqKBwoHIRFCuFA5KOVCOVAigcKFcqEcqByoHClEA4UDlQOVA 5UDko5Ug5Uo4AigcKUcqByoHIRMJUCrlFQIuWCukmgdpMIKjwOkeB0kwCpNUDVJygdtn+EDVtR4Q NW1HhA1SegGiTUUDtHoB0jgOkUCxAoAogCAECBQAAQBABAogBQJACQAFEAkAIoHMAiQCpAqOVQDm AHKoByqFHKoBwoHCoByqAcKhRmoHCoBwoGaoUZqBwoGSoEcOCsnFGbkCMnAZOAyUDJxRk4DJQMnA YuAycUZOAxcBi5AMXAYuKMnBGDwMXgZOKMHAf7HQ+U7KBQKBSClUIixRChygVEAsEIKgVQihVCAF CqEAqgAihQChAihRQgBSKFFABAigBWNXnQo4WQxe4LRmtP3lLY4WQ9O5EtjNWKnOhRMECQCAAABQ oAAAAAAAAAAQIAAAFiBYhQCgVHKgHbZioQbNmIvOShpFFIECqkAM5klj05uUWjwTqZzFinMbiUp5 1SBRAAAAAAAAAAAAAAAAAIAAAAABFCuFKIoHCgchEUK4UI5UK5UqOVAi8wHChXKhHKgcqBwpRAOF A5UDlecDlQIByoHMCjmAHKoBwrQOVRfnCOFQquVCOQrlQjhShFSBhqgFSaoHaTQrpJoHSTAjtHgd I8KqTANEmr3wO0nqBq2o8IGzajwgbNqPCQbNnoBqk1FA7RyKB1EoRARABAqgRAAAoARUAAAJACKh RAIBFAgRIFVyoRyoVyoRyqAcqUcqBwqAcqBwoHClHCoBwqAZqgGalHCoBm4DNwGbkAycgGbioycg GbkAyVAMnIBi4ozVAMXIBk5AMXFGTgMXAYuAycUYOAycEYO5gMXAZOAwcUf7GQ+U7KBQKBSB+kov KvgAqAUgqBVCAVQihVCAFCqEAqgAihQChAihRQgFUgFFCBFAKAKgBSKASCLzoByspi9wtjNafvKW 0ZukvTuRLYzVioBMEokAgFAAAAAAAAAAABAgAAAALECxCgFRyoBq2YqEobNmIvOShoQQKitRUgqF HlnUqO5WliUp4XynMXlQ1aMygAAAAAAAAAAALACQAAAAAAEAIoVwpRFA4UDkIihXCgcgcqVHKgRe YDhQrlQjlQOVA4UogHCgcqBF5wOVAgHKgcrzlHIEUDlUAioEcqiBXCtKOVYBy5gRmrAOFaoHKopR ysQJFUQBhKBUmAdpNA7SYB0kwiu0eEdYYHSPKrtJhBo2aoGrZy98DZtR4QNm1HhA2bUeEDRJ6Adp NaoHWURe6BUchRcIIYQDCARKEQEQEQAEAFEAigQCAQo5AkAjmAHKgcqhRwqAcqBwqAcqBwqFHCgc KBmoGaoUcOCMnIFZqnOBw5AMnBGSlVm4IycBk5AM3AYuQoycBk4DFwGTijFwGLwMnAYvKMHBGTgM XAYOAycBg8o/2Kh8p2UCgUB+jlUConygdEFQABQqhAKoRQqhAChVCAVUABFCgFCBFCihFIoUUAEC KoAIFFIoAAQKKACBFRWtXnQo4WQ1ebkFjJ0he5yltGay1TnSBbHCtUokAJAAAAQAAAAAAAAgQAAA AAKsQixCukcqAasmqhKGzXo79JB2QAM3y2vTlQtjwzqVW8reY1Eo8itVvOaEAAAAAAAAAAOgEAEA EAJABABACQAKgHEAOVKOVQI5CuVCOVCuVA5UqOFAigcKFcqEcqUcqByoHKgcqByoHKgcqBCjlSDl So5CooEUDkAByUIEEVAOVaBwrEKjlWBWaywjhZZVcKxQjhWqgEgoCKoBcNUA6SYB2k0DpJoGiTAO 0eFaI8DtHgaJMA7SavfCO0nr3wO0qArtKjwhHaVHhA7Sp8IHSVPhA6SoQo6SoQCpPb3wOss3vgXK t74DKJ3wGUTvgMNO+UTDAYQDCARARKJEIgEA4CooRypRwoHKgcKBwpRwqAcKBmoGalHDgM3AZuCM 3BWTgM1KjJwGTgMlAzcBi4oydzAZOAxcBk4oxcBi8DJwGLgMHFGTgjFwGDgMn84GDyj/AGIh8p2U C/qAc/NzAdcxBUKqkRUAAUKoQCqEUKoQAqBQIoVUABFCiAUIEVSgBSAUUIEUAoAqKRQABSgEAoQU AAAASCLzlHCymL4BYzdIXucpbRk6WqFscK1U7gHMChBQIAAQAAAAAABAgAAAAoAiEWIV0j4Absnd xeUlDdFRUihkUCKiLzgeedTNfypzmokeCZJcxeY1aMSgAAAAAAAB0gHcCBABAokAJABACQAKgHCo ByqFHCoBzAIioFcKgHKoByqBHKoByqFHCoFcqERUA4VAOVQo5gByoHCoBFA5UDko5Ug5KOQIoEUD kAoEKIQFAigQokCCQKOcEDlWAZrLCOVllHCywM1YBMFQOVRShFQO8NUIO0mAaJNA0SYFaJMA6wwi 4YFwwLlACTFKOsqvfAqTlAqT174HST1KKlQBdY8IHWseEC6z4QKlT4QLrHhAax4QjpKle+UdJUeE K1bPiRHaTUKrpHooQwgqRCIqgRVAiqUcqBwoHKlHCgcKBwoGagcKBm4ozcBm4IzcFZOAzcEZOKMn AZqBk4DFxRkoGTgMXAYuAyd3SjFwGTgjFwVg7mKMnBGLgMHBWTwjB5R/sND5Tsv6QCJHn+QDoCkF QqqRBAKBQqhAKoRQqgAioFAihQChFCgFCAVQKQCigAgRVAFRSKAAKAKgRVAAAAAoAAKEAJBF5wrh 0pq+AWjJ0he5ylsZLLVCjhWlHMAAQAgUAAAAECAAAAAhVAhEg6RwGjJiovIopXoZNR3IvIpmhqQA OHy2vSCoWx4p1KqcqGokeNzFappHIAAAAAAKgGiKB1AgQAQAkAJABACKhRyqAcqgHCoBzAo5VCDh yFHKoByqBHKoByqAcKhVcqgRFQDhUA5VAOVQDlUKOFQgioUcKgHMAOVQDmBRyBAOQIoEAilEICgQ CFAgilDuAcgSABUA5VqAcKwDhZZUcLLA4VigFaARAOkaBUaoHSRQC4SoUMNQOsooFygFSYBcMBhg MMoYYDDAK8IuUCmUCLlCi5QKZRQjpJigdpMUK7SaoRok9QO0ngaJPA7ScigdZRALhoUMICRA5VQO VUDlSjhQOVAzUDNQOFAzcUZuAzcBk4DNwRk4oycBmoGLgMnFGSgZOAxcBi4DJ3dKMXAZOCMXBWDu YoycEYOAxcFZPCMHlH+zNQn9On2iRjnze3PDnDra+z5/Or6faJGONE8OcFukoJ/TkbRIxx254c4W zUJ/TkbRIxx254c4S11Cf05G0SMcnbnhzgtdQn9ORtEjHL254c4W11Cf05G0SccnbnhzhLEoZ/Tk bRJxy9ueHOC11Gf05G0Sccnbnhzgs1Gf05Gfk45e3PDnC2uozunIz8nHJ254c4S11Gd05Gfk447c 8OcLa6jO6cjPyccdueHOCzUZ3TkZ+Tjjtzw5wWupTunIz8nHHbnhzgs1Kd05Gfk447c8OcJa6lO6 cnPyccdueHOFs1Kd0pOfk447c8OcFrqU7pSc/Jxx254c4LNSndKTn5OOO3PDnBa6lO6UnPyccdue HOCzUp3Sk5+Tjjtzw5wWupTulJz8nHHbnhzgs1Kd0pOfk447c8OcFrqU7pSc/Jxx254c4LXU53Sk 56Vjjtzw5wWanO6UnPSscdueHOCzU53Sk56VjDtzw5wWupzulJz0rGHbnhzgs1Ob0pOelYw7c8Oc Frqc7pSc9Kxh254c4LNTm9KTnpWMO3PDnBZqc3pSc9Kxh254c4LXU5vSk56VjDtzw5wWanN6UnPS sYdueHOCzU5vSk56VjDtzw5wWuqTelJz0rGHbnhzgs1Ob0pOelYw7c8OcFmqTelJz0rGHbnhzgs1 Sb0pOelYw7c8OcFmqTelJz0rGHbnhzgs1Ob0pWelYw7c8OcFrqk3pSs9Kxh254c4LNUm9KVnpWMO 3PDnBZqk3pSs9Kxh254c4LNUm9KVnpWMO3PDnBZqk3pSs9Kxh254c4LNUm9KVnpWMO3PDnBZqk3p Ss9Kxh254c4LNUm9KVnpWMO3PDnBZqk3pSs9Kxh254c4LRaOYvO6TnpWMO3PDnBbh1umLzOlZ6Vj F0Tw5wlsXW2f3HSc9Kxi6J4c4LZrb5/Sk5+TjjRPDnBblbfP6cjPyccuieHOCzUJ/TkbRJxxonhz gtNQn9ORtEjHGieHOCzUJ/TkbRIxxonhzgs1Cf05G0SMcaJ4c4LNQn9ORtEjHGieHOCzUJ/TkbRI xxonhzgtNQn9ORtEjHGieHOEs1Cf05G0SMcaJ4c4LNQn9ORtEjHGieHOCzUJ/TkbRIxxonhzgs1C f05G0SMcaJ4c4WzUJ/TkbRIxxonhzgtNQn9ORtEjHGieHOCzUJ/TkbRIxxonhzhLNRn9ORtEjHGi eHOFt0lFPT+3I2iRjjtzw5wW3ZT1DeRXyFT/APYk45O3PDnBbdKWYvM+Tn5OOTtzw5wWupzelJz0 rGHbnhzgtNTm9KTnpWMO3PDnBbGZa5j+VHSY/wD3pWMWMJ4c4LeJ9qqEX96Rn5Kf/wAzWmeHOEtm tsqOnT7RIxy6J4c4LT2bUdOn2mRjjRPDnBaezajp0+0yMcaJ4c4LPZtR06faZGONE8OcFns6o6dP tNPpBonhzgs9nVHTp9pp9INE8OcFum2+oT+3T7TT6QaJ4c4LaJQT+nT7RIxyaJ4c4LX2fP6dPtEj HGieHOCz2fP6cjaJGONE8OcFns+f06faJGONE8OcFp7Pn9On2iRjjRPDnBZ7Pn9On2iRjjRPDnBY tvn9On2iRjjRPDnBblbdUdOn2iRjjRPDnBblbdUdOn2mRjl0Tw5wW49m1HTp9pp8caJ4c4LT2ZUd On2mn0g0Tw5wW5W2VHTp9pp9INE8OcFuVtlR06baqfSDRPDnBblbXU9Om2qn0g0Tw5wW5W11PTpt qp9INE8OcFuFtVT6Sm2qm0g0Tw5wWi2qp9JS7VTaQaJ4c4Lcraqn0lLtdNpC6J4c4LcLaar0lLtd NpBonhzgtFtNV6Sl2um0g0Tw5wW5W01XpKXa6XSDRPDnBblbRVekpNspdKNE+pgtz7IqvSUm2Uul GifUwW5Wz1XpKTbKXSl0T6mC3K2er9JSbZS6UaJ9TCWi2ar9JSbZS6UaJ9TC25WzVfpKPbKTSjRP qYLc+xqv0tHttJpRpn1MFuVstX6Wj22k0o0T6mEtytlrPS0e20mlLon1MFufYtZ6Wj22k0o0T6mC 0WyVnpaPbaTSjRPqYLcrZKz0tFt1HpRon1MFp7ErPS0W3UelGmfUwWi2Ss9LRbdR6UaJ9TBaexKz 0tFt1Hphpn1JaexKz0tFt1Hphpn1MFotjrfS0W3UemGmfUwWnsOt9LRbdR6YaJ9SWew630tFt1Hp i6Z9SWnsOt9LRbdR6YmmfUlnsOt9LRbfR6YumfUlp7DrfS0O30emGmfUlnsOt9LQ7fR6YaZ9SWns Ot9LQ7fRaYaZ9SWew630tDt9Fphpn1JaLYq30tDt9Fphpn1Jaewq30tDt9Fphpks9hVvpaHb6LTD TJblbDW+lodvotMXTJaLYK30tDt9FphpktF4frfS0O30WmGmS3PZ6t9LQ7fRaYaZLTs/Xelodvot MNMlr7BrvS0PvCi0w0yW69hV3paHb6LTDTJaewa301D7wotMNMlnsGt9LQ+8KLTDTKWewK30tDt9 Fpi6ZWz2BW+lodvotMTTKWdn6301Dt9Fpi6ZD2BXemodvotMNMiewK701Dt9FphpkPYFf6ah2+i0 w0yWewK/01Dt9Fpi6Q9g1/pqHb6LTDTInsGv9NQ+8KLTDSHsGv8ATUHvCi0w0i+wq/01B7wotMNM lnsKv9NQ+8KLTDSL7CrvTUPvCi0xdJYljrvTUPvCi0w0jtLJW+modvotMTSW69iVvpqHb6LTF0lq lkrfS0O30WmGkVLLW+modvotMNIvsWt9NQ7fRaYaRUs1b6ah2+i0w0luks9d6ah2+j0w0jpLTW+m otvo9MNI7S1VvpaLb6PTDSO0tdZ6Wi26j0w0ipaqv0tFt1HpRpLX2TV+lotupNKXSHsir9LRbdSa UaRPY9Z6Wi26k0o0jn2NWelotuo9KNJblbLWelotuo9KNKOVstZ6Wi26j0wocLZKz0tFt1Hpi0OF sdb6Wh2+j0wocOsVb6Wh2+i0woZusVb6ah2+i0wocLYa701B7wotMKGbrBXemoPeFDpi0M14fr/T UHvGh04oZrw9X+mt/vGh04oZu4dr/TW/3lQacUM14cuHprd7yoNOKGTuHLh6e3e8rfpxQzXhu4+n tvvO36ctDJeGrj6e2+87d+IFDJ3DNx9PbPelu/EChk7hi5entnvW3fiBQzdwvco/xFr96238QKGT uFrny/6i1+9rb+IFDJ3Clz6xave1s/EloZLwndOsWr3vbPxIpGTuErr1i0+97X+JFDF3CN16zaff Fr/EilZLwhdes2j3xavxRaRk7g+7dZtHvm1fihQxdwdd+s2f31afxQoZP4Nu/WbP76tP4oUMXcGX frVm992j8WKH+n0PlOygVAKBSAVXREEAoAK6CAVUAoBAKEAqhFCgFCKFAKQVCgBSClAIEVQBUUig AClQIqgAAAChAoACKAAAAAAAAAAHKsapbGLpHeLaMXS1TnQozVpRyAAAAIEAAAAAABUKgBAKigaN eqLFFgSlemXPR3I7kUlDYgAcuYjudAPO+nTuFsed0hULaOMkpbDJKLHDpSixkqKnOUQDpHQA0RxB 1ECxAAAAHKoByqFHMAOYAcqgHCoByqAcqgHKoByqFHCoByqAcqgRwqAcqhVcqgHCoEcqgHKoByqB UgVHKoBwqAcwA5VAOVQDlUKIqAcwAkAIqARUAkAIBAHcKIBAgFRQIA7gEKgFAEAEAGCBMADlWhEV qlDlARAqKBYgALyAIIUIIAwUAYIDACJgFBWAcq0DmCpEBFUAuEoHSPKKjgLhAVFAYQDCAI8C5RQO kmqUdJOUDrLAXKoAw0UCK4DlVKOFUDhVA4cBm4DN3dKjNSKzUqMnAZKBk4DJxRioGTgMXAZOAycU YOAycBi4DFxRi4DFwRg4DJ4GDij/AGCh8p2UCoBQKRQDoIAUAFVAKBUAoAChAKoFAAUCgUAQUopA ApUCKAUIoUAAUoEFAAAAFKgAIoAAAAAAAAAACgAAARWovOBk+Qi8xbR53S1TnQtjNWlHIAABAgAA AAAAKhQCJAAB0jiDaXOVvIvKhJhXra5HJFCCgAOVaigcLLQWJgIUcKxAPPNkopYlHjc1WrBTQgAD pHKgFR4HSPQg6RwFiAA5UDmAEgBFQDlUKOVQDlUA4VoEVAOFaBwqAcqhRyrQjhWhXOCByrSjhUCO VQDlUCuVQI5VAOVQo5gByqAcqgHKoBFQDlUKJACKgHKoBzABADmACHIBCjkCwA5AgACFEApAAqAU AUFCOVQCKgEgBzAoAOUBEC4RQwgLhAXCAuEAiVFiA5AJgpygcqwDlWgTBKJBUAkVQCo5QLhAMIBE oRAmEAwgGGAyigXKqBcsAypRcoigcq4DlXAcKoHCqBmqhGalGbgMlAzcBi4oyUDJwGLgMXAZOKMX AYuAycBg4oycBg4IxcBk8DBxR+xb+ZXGq/zZcxT6M+Hrl6tMNE/MjjRf5quYp9GNcmmGrfzG4z3q uZp9GNcmmGjfzE4yX+aLmZGjGuV0w0T8w+MN6LmZGjJrk0w0T8weL1/ma5mRoxrk0w1bx/xdvNcz I0ZNcmmHace8W7yXMyNGNcmmGqcecV7yXNSMQa8jTDtOOuKt4rmpOITuZGmGicc8U7xXNScQdzI0 w7TjfijeC5qTiDuZGmGicbcT7wXNScQdzJdMO0414m6+uak4hO5kaYaJxnxL19c1JxB3MjTDtOMu JOvrmpWIO5kaYdpxjxH15c3KxB3MjTDROL+IuvLm5WITuZbzTDROLeIeurm5WIO5kaYdpxXxAv8A +aublYg7mW80w0Tiq/8AXFzcrFHcy3mmGicUX7ri5uXiju5bzTDtOJ771xc3LxSd3LeaYdpxNfOt /wByXiju5bzTDROJL31v+5LxR3ct5ph2nEd661/cl4o7uW9dMOk4ivPWl8yXiju5bzTDtOIbx1pf Ml4o7uW80w7TiC79Z/uS8Ud3LeaYdJf7v1n+4zFHdy3mmHaX67dZ/uMxSd3LeaYdJfbr1n+4zFHd y3mmHSXy69Y/uMxR3ct5ph0l7unWP7jMUd3LeaYdJe7p1j+6zFHdy3miHXtq59Y/us8Q7uW80wvt m59Y/us8Q7uW80w6S8XL0/8AdZ4h3ct5phUvFy9P/dZ4h3ct5phfbFy9P/dZ4h3ct5phfa9x9P8A 3WeId3LeaYX2vcfT/wB1niHdy3miF9rXH0/91niHdy3miF9rXD0/91viHdy3miD2tcPT/wB1viL3 ct5phfa1w9N/db4h3ct5pg9q3D0391viHdy3mmD2rcPTf3W+Id3LeaYX2rX+m/ut8Q7uW80we1a/ 0391viHdy3mmD2rcPTf3W+Id3LeaYPatw9N/db4h3ct5pg9q1/pv7rfEO7lvNMHtW4em/ut8Re7l vNMHtW4em/ut8Q7uW9NMJ7VuHpv7rfEO7lvNMHta4em/ut8Q7mW80we1bh6f+6zxDuZbzTDlbrcF 5Mv/AHWeIvcy3mmHzK6qvr2q6kr1Y7uJk5S/rYbx60/tJwh+Rr+IOM6Nyo+udDuOSTJxDvjnEsTi +LN424xl81yVU/8AsyI/9s6xTNPP2/4u3kuZkaMtCLx/xfvNczI0YqByv5gcX7zXMyNGWoHP9QeM N5rmZGjFQH9QuL95rmZGjGmBP6hcYbzXMyNGNMB/ULjDea5mRoxpgP6hcYb0XMyNGNMCL+YXGG9F zMjRjTAn9QuMd6LmZGjLphHK/mFxjvRczI0Y0wOV/MPjLei5mn0Y0wM1/MTjROa6rmafRl0wKz8y OMkX9q6LmZGjGmB9Si/Mrilr2ufcMNP7TFlSURfkYhjLBYfv7VxnWXSUjpdTgzk/flq1kUXzTy56 sXSIiX0vbd16x/cZimNcrphPbl16wvmMxS65NMPiXfjS6W6KLVQX/wCiXinTC5ZmIh+UqPzVu8tV Rtb9XKxTtHTlm4fNm/m7fU5q5E/y5OIbjpSlw+fUfnBxJBcC4wX/AO1JxDcdJLfnq383ON3O/wBP d1an/wBimX9cpTrHShmZeP8Aqz+YO+l2el0Re3juSz+rP5g76XZ6XRDtY7ltP6tfmDvpdnpdEXtY 7kuT+rX5g76XZ6XRDtY7i5P6tfmDvtdnpdEO1juLlU/Nz8wk/nSr9npdETtY7i5bM/ODj1P3ruuz 02iHaxLemX+b/Gq/vXdcxT6Mz2oW3tl/mxxi/wDmy5mn0ZJ6cFvSz80OMXfzZczT6Mzohbbt/Mvj Bf5quZkaMmiBon5jcYL/ADV2ZkaMaIV1/UTjDerszI0Y0wH9QuMd6OzUjRjTAf1A4x3o7NSNGNMD lfzA4x3q7NSNGNMDn+oHGO9HZqRoy6YRyvH/ABjvV2akaMaYHC8f8Zb1dmpGjGmByvH/ABlvV2Zk aMumByvH/GW9XZqRoxogcL+YHGW9XZmRoxogcLx/xnvV2ZkaMuiByv5gcZ71dmZGjGiEcr+YHGW9 XZmRoy6IHK/mBxlvV2ZkaMaIHC/mBxlvV2ZkaMaILcr+YHGW9XZqRoxogcr+YHGW9XZqRoy6IHK8 f8Zb0dmpGjGiBF4/4x3o7NSNGNEFp2/4x3o7NSNGNECdv+MN6OzUjEGiETt9xhvR2akYhdEFnb7i /ebs1JxBoxDt7xfvN2ak4g0QWvbzi7ebs1JxBogs7d8W7zdmpOINEFnbri3eTs1JxBogO3PFm8nZ qTiDRBZ244r3k7NScQaILO2/Fe8nZqTiDRBa9t+Kt4uzUnEGiCzttxTvF2ak4hdEFr214o3i7NSc QaILVONeKN4Lm5WINEFr204n3gublYg0QWvbPibeC5uViDRBapxlxL19c3KxBogddseJOvrm5WIN EC9sOI+vrm5WINEFr2w4j68ublYg0QW67X8RdeXNysUaILXtfxF15c3KxRogtU4u4i68ublYo0QW va7iLry5uViF0QWdruIevLm5WKNEFr2t4g68ubl4o0QWdreIOur5kvFGiC17V3/rq+ZLxRogte1V /wCur5kvFGiC17U37ri+ZLxRogte1F964vmS8UuiEtU4nvvXF8yXijRBbrtNfOuL5kvFGiC3ScS3 vra+ZLxRogdJxJe+tr5kvFGiC1TiO9dbXzJeKNEFu04ivPWl8xmKNEFu04ivHWl8xmKNEFu04hu/ Wl8xmKXRBbtOILt3alfNZijRBbRL/dV//JXzWeIaILaJfbov/wCSvms8Q0QW69t3Nf8A8hfNZ4hp gtfbFz6wvms8Q0wOVu9z6wvms8Q0wW5W7XPrC+azxDTBae17n1hfNZ4hpgT2xc+sL5rPENMFp7Yu fp181viLpgX2zcvTr5rfENMFr7ZuPp181viGmA9s3D06+a3xDTBa+2Lh6dfNb4hpgtfa9f6dfNb4 hpgtPa1f6ZfNb4hpgPa1f6ZfNb4hpgT2tX+mXzW+IaYD2tXemXzW+IaYRfa9d6b5m+IaYF9r1vpv mb4hphV9r1npfmb4hpgX2tVr/wDL8zfENMB7Uq1/+X5m+IaYRytyq1/+X5m+IaYHC3Gr9L8zfENM DhbjV+l+ZviFQM1uFX6X5m+IVAzW4Vfpfmb4i1AzWvq/S/M3xCoGTq+r9L8yeIVAzdX1fpPmTxCo GTq+r9L8yeIVAxdXVXpPmTxCoGTq6q9J8yeIUMnV1V6T5k8QoZOrar0nzJ4hQxdW1XpPmTxChk6t qfSfMniLQydWVPpPmTxChk6sqfSfMniFDF1XUdP5k8QoZOq6jp/MniFDJ1VUdP5k8QofVafAets0 K1aBs0g1aBq0g1aBs0g0aFatA1aQaNA1aBo0g0aBo0K1aQatA1aBq0DVpBo0DVoGjQNGkHaAaIB2 gVogR2gV2gHaAdoQdIUdIQdIB0iAdIB0BSjpEIKiAWAFAsALAoAIAWAAAAgVCACBAgUQBABACQKJ ADKdTyZ7VbNYjkXvliaKfmLpwpLmo6ZSfsu58E7YdbexOL8PcLPOp3q2YxWOTuwPVjnEsTD475b5 awcnJ3zoyzVIgcqhRxACAQoAAIoECIqAcKhRm5sQIx7mKUfattzm001syU9WzG8y+M55Y2sS/qFl vUq6Ska5UbUtT9pnf8KHizw0usTb68DCv5/+YtPOZSsq5UcGGC6HcU9Xxp/NMZv4bPqpz3rFy859 GIcLedXvXncpRyqqvdKIEAAECgRAAACAdI9zeZYAbMrJzO7ElK9Uu5uT94mkt75N0avOpmcVt7pd ex3dM6Vt6mVTV7pKHobNavdJQ7wmqFVIKQXBQoisCJkwOVllHCyhY5WUBwsoo5WUBwsrwFRysoDl ZQHKyijhZYHKyyiZMDnAAZMImAUMAC4AFwQGCBcEC4IFwQGCBcEBggXBKLggXBAsALADqAFAoFAR KCKEdRARA6RQOkA6QDpAO0QDtEKOkQDtEA6RAOkQDtEA7RAO0QDpEKjtAO0WAGiOA0RwHaOA65AE EAmAgHKsA5VgHKtUCAAEQEQEQJEBEokQJhATDAmGAyqgXKgXKgTKIByrwOVcBmqgZqoGaqBm5QMn AZOAzcBkoGTgMnAZOAxcBk4oycBk4D7bT8+9jZoGrQNmkGrQNWkGrQNWkVq0DVoGjSDVoGjQNUIN GgbNCtWkGrQNWgatA1aQaNA0aBq0DRpB20DRANEA7QK7QDtAO0A7Qg6QDpAOkA7QDoCgdIgFRAOg LACgIAUCwAQKEALAAAAQKhABAKkAgBIAIASBQgBIAeWqoKasYrJzEdHu901GUwlPxl44SexHTKVM NnPg909GHW3sTi/FVVBNkOVMFUVOdqnpjK2Jh4VTlgqQXvGkcK0o4VAOSoRCkQgBAAVyqBHKoUZu bEDlrllr4Cj7lquUynmsmMfgvasUU5Z421Ev6varlLuVMkxIJNakJjfD3zxZ41LrE2t2t0u6UE6i mpyTGrgqvcd3FGGWmbJi3+Zr/a51quM6mnNVqtcqcp9fp5aot5pinyToyBUABAABAoEQAAAgAAAA 7bNmN5nAeiXXzWc6k0rb3SrtDkcpmcS3ulXRi/2jOlbe6XXMd3SaVt6mVLV7pmhqk1q90UNEcgV1 yKBMECYEQjlZYHKyyjlZYHCy/AUcrLA5WX4AOVllRyssDhZZRyssCLLAmABMmUMABgBDAAYIFwQG CBcEouCAwQLggMEC4IDBKLggIAIAAJEAUAioB0gHaIB2iAdIgGiNA7RAO0QDtEA7RAOkQo7RoHSN A7RoHSIB1ACwKLAI6RAO0A6RQOkcB0jgO0UCxAQRQOVaByrQOFaByqAcgQokSCRKJECRAkQOVUDl VA5VwEVwEwwJlFAmVAmUQCK9AOFcBmqgZqoGblAzcoGTgMnAZOAzcBk4DJwGTijJwH2WnwHsbNIN WgbNINWgatINWqBq0itWgatUDRpBq1QNGgbNINWgbNCtWkGrQNWgaoBq0g0aBo0DVoGjSDtoGjQr tANEA7QDtAO0A7Qg6Qo7QgqAdoB0gFQDpAOkAqIBQKBQEAKBYAIFCACAFAgCBUIBSAECACAEgAgU SAEgAhED5FzsNJcGqqtRk3uOQ6YdSYSYt/Pbxw1U0blVWKrO49D14dWJc5xfmpkp8pYPTk752iWG StiUZq0DhSogUiAAAAiAcqhRw5sQOWOdLdHuFH6/hu9OpZ7Iu5OZU76d48/UwuG8Zf1GVNZPltmy 1ixyRRTxz+HR/OfzO4XSupPa1Mz/ABpSQnIic6dxT1/G6tTTn1MX8Lc1WuVq8ipyKfRcHJQCoACA ACBQCBAABAAAAAAhRUcqcywA1ZUzWcziUPXKucxv7xNK290m7IvOpmcVt9CVcmO7pnSW9suta7um aW3obUNXukoapMRQruKKBYIoEwQiKwDnJlHKywOVlgcrLKOVl+ADhZfgLaOVlgTJgRZZRMACYADA AYBQwAJggXBCGCAwSquCEMEC4IFgAwQIqAcqhRwoEABHUAKiFHaIB2iAaIgV2iBGiNA7RoGiNA7R oHSNA7RoHaNA7RoHSNKOsEC4IFgBYAIFRYAVAKBUA6RQLEDrCAsQJECKBFQDhWgcK0DhUA5UDlSj mIEiByqgcqoHKqByqgcqoHCqByqgcq4DnDAizAOVeByrwOFcBmqgZqoGaqBk5QM3AZOAycBk4oyc B9lp+fexs0DVoGrSD6VntVdfrlKtNuRMvMRXzJr/ANyVKb+8936k8JYhH9ct/wCVvC9PIa2vlzbj UQ/xJ02bMloru7gtlObBP+KjUPan5bcFbq+8VOlGqR0n5bcF7r+8VOkGqRU/Ljgvdf19TpBqkdJ+ XPBm6/r6jSDVI6T8uuDd2fX1GkGqR0n5d8Hbs+vqNINUjpPy84P3Z9fUaQXI6T8veEN2/X1GkJcj pPy+4R3b9fUaQXI6TgDhLdv19RpBcjpOAeE93fXT9ILkdJwFwnu766fpBcq67B8Kbu+un6QXI6Tg ThXd/wBdP0guUVOBuFt3/XT9ILHScD8L7v8Arp+OLV12I4X3f9dPxyWKnBPDHUPrp2OLHXYnhjqH 107HFipwVwz1D62djix12L4a6h9bOxxYqcGcNdR+tnY4sXsbw31H62djix12N4b6j9bOxxYvY7hz qP1s7HFipwfw51L62djixeyHDvUvrZ2OLF7IcO9S+tnY4sE4Q4e6l9bOxxYvZHh7qX1s7HFi9kuH upfWzccWL2S4f6l9bNxxYvZLh/qX1s3HJYdk+H+p/Wzccti9lLB1P62bjgOylg6n9bNxwL2UsHU/ rJuOLDspYOp/WTccli9lLB1P6ybjiw7KWDqf1k3HLYdlbD1P6ybjiw7K2Hqf1k3HFh2VsPU/rJuO LDsrYep/WTccWHZWw9T+sm44sOyth6n9ZNxxYdlbD1P6ybjiw7K2Hqf1k3HFh2VsPU/rJuOLDsrY ep/WTccWHZWw9T+sm44sOyth6n9ZNxxYdlbD1P6ybji5DsrYOp/WTcctyHZSwdT+sm44uQ7KWDqf 1k3HFyJ2UsHU/rJuOLQ7KWDqf1s3HFyHZOwdT+sm44uRxM4Q4dmtVkyhRzV50WZNxy6pHx6n8suD psXey0VV50y1Qn6phuOtlvTTD5b/AMsuDGL/ALV94qdKdO9lvTTDj+mvBW6vvFTpR3ct6aYRfy04 J3V94qdKO7lvNMOf6acE7q+8VOlHdy3mmD+mfBO6vvFTpR3ct5pg/pnwTur7xU6Ud3LeaYP6acE7 q+8VOlHdy3mmD+mnBO6vvFTpR3ct5pg/pnwTur7xU6Ud3LeaYP6Z8Ebq+8VOlHdy3mmE/pnwRur7 xU6Uvdy3rphF/LLghee0/eKnSjvZ700wsv8ALXgqWqK21Q+0VOlHdy3mmH6C38I8MymZFlDBvcRZ 05f1vOWWUtQ9szgzhqdLdKmUCOlvRWuas2dyov8A1mYzlafh7j+T3ADJznussUcsYpU1Sfqmnox+ RnvYnCHi/pJ+Xu5fvNXpjXfz3ppg/pJ+Xu5fvNXph5Ge80wn9JPy93L96q9MPIz3mmD+kn5e7l+9 VemL5Ge80wf0j/L3cv3qr0w8jPeaYP6R/l7uX71V6YeRnvNMH9I/y93L96q9MPIz3mmD+kf5e7l+ 9VemHkZ7zTB/SP8AL3cv3qr0w8jPeaIP6R/l7uX71V6YeRnvNEH9I/y93L96q9MPIz3miD+kf5e7 l+9VemHkZ700Qn9I/wAvdy/eqvTDyM95og/pH+Xu5fvVXph5Ge9dEH9I/wAvdy/eqvTDyM95og/p H+Xu5fvVXph5Ge80Qf0j/L3cv3qr0w8jPeaIP6R/l7uX71V6YeRnvNEH9I/y93L96q9MPIz3mmD+ kf5e7l+9VemHkZ7zTB/SP8vdy/eqvTDyM95phU/Kb8v281m+9VemHfz3mmGrfyt4DbzWhdpq9KTv Z7zTDZv5Z8Cp/KfvNVpSd7PeaYat/LXgbdX3iq0o72e9dMNW/lvwPur7xU6Unez3mmGiflvwTur7 xU6Ud7PeaYdJ+W/BO6vvFTpR3s95phf6bcE7q+8VOlHez3mmF/prwTur7xU6Ud7PeaYT+mnBO6vv FTpR3s95pg/ppwTur7xU6Ud7PeaYT+mfBO6vvFTpR3s95pg/pnwTur7xU6Ud7PeaYT+mXBG6fvFT pR3s95phP6ZcEbp+8VOlHfz3mmE/pjwRun7xU6Uvfz3mmD+mPA+6fvFTpR3895pg/pjwPun7xU6U d/PeaYT+mHA+6fvFTpR3895pg/phwNun7xU6Ud/PeaYT+mHA26fvFTpR3896aYP6YcD7p+8VOlHf z3mmD+mHA+6fvFTpR3895pg/phwNun7xU6Ud/PeaYP6YcDbp+8VOlHfz3mmD+mHA+6fvFTpR3895 pg/phwPun7xU6Uvfz3mmD+mHA+6fvFTpR3895pg/phwPun7xU6Ud/PeaYP6YcD7p+8VOlHfz3mmD +mHA+6fvFTpR3895phP6Y8D7p+8VOlHfz3mmEX8sOBt0/eKnSjv57zTCf0v4G3T94qtKO/nvNMH9 L+Bd0feKrSjv57zRB/S/gXdH3iq0o7+e80Qf0v4G3T94qtKO/nvNMKn5YcDbp+8VOlHfz3mmF/ph wNun7xU6UeRnvNEOv6Y8Dp/KfvFTpR3895phf6ZcEbp+8VOlHfz3miHSflnwRur7xU6Ud/PeaYX+ mnBO6vvFTpR3895oh1/TXgndX3ip0o7+e80QqflrwVur7xU6Qvfz3mmF/ptwVur7xU6QnkZ7zRC/ 034L3X9fU6QvkZ7zRC/034M3X9fUaQeRnvNEL/Tjgzdf19RpB5Ge80QqflxwZuv6+o0g8jPeaIX+ nPBu6/r6jSDyM95phf6dcG7s+vqNIO/nvNMH9OuDd2fX1GkHfz3miD+nXB27Pr6jSDyM95phf6dc Hbs+vqNIPIz3mmD+nXB27Pr6jSDyM96aYP6d8Hbs+vqNIPIz3miHlrfy14bnSXNoGTbfUQ/YnSps yYiL4WzHOinyGsfk5xt/JOEP5rcLfWWe4TbXcEbrEpEfLms/cmS3cz2/+vhPbhnGUXDlMUwNooAA BQJEBEBECRAigcqgHCoBwqFHCoBwoHCgcqoHKqByqgcKoHKqBwqgcKoHCqBwqgcq4DhXAcq4DhXg cq4DhXAZqoGblAzcoGTlAzcUZOA+w0+A9bVpFbNA1aQf0z8n5bHVt+nqn+JLZSy2O7zX5Ryp8rUN TsR/XDI6AoFCqRFQDoCoFVAOgKBUAqAUCgVAKB0AQCgVAKBSClFIBRSCgCikAAUdEAAUAKRAKAAK UAAAAAAAAAAAAAAAAAAAAgAIAIAZTZDZicqcvfLEj5s6ndLXm5O+biUedeTnKEAIBAAAAAKAACEH ct6scgH1pE1JjEXupzmJhXNVISolK3+0n7qiJol+cmMWW5WuSCodWXJQAAAAAAAAAAAEAQCIFAAA AAAAAAAABUcqAdpMVAO0mkGiTAO0ehB2jgLECgAoEAEAEAJABABACQKEAEAEAEAJABAAAAAAOQAE AAAKUAKgFIKBQKUVEAoACgUCgALABAABQAAABAj+Y/mfKa2vsc5E/wASYyplvXvtYktyJ8rlPZ8S drn1H4iB7HMAAAAEAgEARAkQJEDlVAigcKUZqgHCoBwqAcKBwoHCqBwqgcqoHCqBwqgcKoHCqBwq gZqoHCqBwqgcK4DhXAcK4DhXAZqpRmqgZuUD7DT4D2NWkGzQNWqQf0/8nf4jiL7F+qcanZCP60ZF QCoBQOgKRXQRUCqgHQFAqAVAOkAoFQCoBQKgADpABB0UCCgAKBQAFAAVAKAAFAgoAABSgAAACBAB AAAgBYAIFEAAAAAAAAAAAACBACOajkgqRQDwVFJCLm8qG4keFWq3kU0iAQCKBAAFAFAAQRUA9FPO WW5O93STA+s1UciOTmUwr5typMJMsxOVP3jeMpL4p0QAAAAAAAAAAAAABAiBQAAAAAAAAAAAAAFi qAdI9UA7SaQaJNA7SYB2jyDrCAsQKAAQAQAQAkAEAEAEAJABAoAAIAA5UCAAEAEABQILACgUCgUC oBQKBQKAAsAKUCAUIAIAIAIAIAIAfzX8z0jV2D7X9GUez4n7c+o/DK09jkkAEAJABACQAgHIEUDk CAcqoHKqBFUo4VQOVAzUDhQOFAzUDhQM1UDhVA5VQOFUDhVA4VQM1UDhVAzVQOFUDNVA4VSjNVA4 VQOFUDNVA+y0+A9jZqkGrVA2aQf0/wDJ3+I4i+xfqnGp2Qj+toZFQCoBQOiChXQRUAqBXSBFCqB0 BUAoFAqAUCgAOgCAdAEIKAA6AFBCCgCioQUAUCCgAAFAFAAQAKAAAAAAoAAAABACQAQAAAAAAAAA AIEeWfSteiq3kU1Ej5syW5iwVDdo45wIBAIAAFACgAJzcpB76Ooh+w5eRTMwQ+gqI5FReVFMq/P1 9IsiZhNT9h3MdcZtJh4jSAAAAAAAAAAAAAAIEQAFAAAAAAAAAAAAAAAAHSOVAOkmKBo2aQaJMA7R 5B2jgLECxAoAKBEAQAQAQAQKIBAIoHKgQAAAAWAFAAUCgUCwAoADoCgAKBQAFAFAgACgAAAfzf8A M5P9XYftf0ZR7Piftz6j8RA9bm5gUSARyBAIBFA5UDlQIoHKgcqgHKgcKUcqBwoHCgcqBwoGagcK BmoGagcKBmoHCqBwqgcKoHCqBmqgcKoGaqUcKoGaqBmqgcKoHCqB9pqnwHsatUg2aoGrVIP6h+Tn 8RxF9i/VONTshH9bQyOkAqAdIBSK6CKBUCukAqBFCugKBUAoFAqAUCgUCgVCClFQgAVAKAKKQAAH QAAUCCgAAFKBACgRQAAAUAAAAAAAAAAAAgAgBIAAAAAAAAAMZ0hs1OXn75YlHy50h0teY3EoxKIB AIAAAABRSAiq1YgfWpZ6TG4K/vIYmFhpPktny1Y7u8y+ERND83USHSJiscnMdYm2WRQAAAAAAAAA AAAABAIEAoAAAAAAAAAAAAAAAAAAKjlQDtJigaJNINEmAdo8DtHEFwgLECgCgAAARSDlSjlQAACA AKAAAWAFAoFQCgWAFAoCAFAoFgAAAUAAKAACAAP5t+ZzoVdh+1/RlHs+L+3PqPw6vQ9bm5V6Ac4a FRFegHOGBMNAJhoBFcByrgJhARXAcq4DlVA5VSjhVA5UDhQOFA4UDNQOFA4UDNQOFAzUDNQM1A4V QM1UDhVA4VSjNVA4VQM1UDNVA4VQOFUD7bVPgPY1apBq1QNWqQf1H8m/4jiL7F+qcanZCP64hkdI BUA6AqAdIQUDoKqAVAihXQFAoRQqgVAKBQKgFAqAUCoQCikFAAUAUVCCgCgBSAAApQIAVQgAAFAA AAAAAAAAAAAAAAAAQAkAAAAAAAAOJktsxIOQo+XUUzpaxTm7im4ll5vApRIAcgAAAAUAKQdypiy3 IqCR9iVNSaxHJz91DnMK89dSpUS1VE/xG8xrGaJh+ec1WOVq86HRlCgAAAAAAAAAAAAAABIBECgA AAAAAAAAAAAAAAAAAAAKjlQDtJigaJMIO0mAaI8DpHgdI4gsQKAA5VSjlQIBQIAAAAKAAoFAoFAo FAoFAoACgUCAIgIgSICJQiAiBIgSIH8z/NNypVWD7Z9GUev4v7c+o/BK9T2ObhXqBMNSiK9QjlXq BMMBhgXCA5VwDCAmEBMICYRRyrgOVcBFcBwqgcqoHCqBwqgcKoHCqBmqgcKBmoGagcKBmoGagZqB wqlGaqBwqgZqoHCqBmqgcKoH22qfAexq1SDZqgatIP6l+Tf8RxF9i/VONTshH9cQyOkA6QCoB0gF QgoV0BQKgRUCugKBQioFUCgVAKBUAoFAoFIAFApQIKAKKQUAUEIKAAoAoEFAAABQAAAAAgAABQIA AoAAAAAAAAAJABAAAAAAOXNRyQckUA+bU0qs/ab+6biUePm5FNIigcgAAAAUUAQeimnrKf4O6hJg fWa5Hojm8ymFfLuVFFFny0/+pDeOSTD4x0QAAAAAAAAAAAAAAAASAEAAAAAAAAAAAAAAAAAAAAAA AAKjlQDtHgaJMIO0mAaI8DpHgXCAkQEAKAAASACAFAAAKBQKAA6AoFQCgAEQEQEQACCgIKBcFQGA veAYCgdZNQGTUo5yagfzX8z5CzKqwonc1v6Mo9fxf255vwjqV3ePW5snU7k7hRmspyAcrLUDNWqV HCoAAAQogEARAgHIHKgcqByoHKqBwqgcqoHCqBwqgZqoHCqBwqgZqoHCgZqBmoGbijNSDhSjNQM1 UDhVAzVQOFUD7bVPgPY2apBq0DdpB/Uvyb/iOIvsX6pxqdkI/riGR0gHSAVAOkAqAUK6IKB0EVAq oBQKBUAoHQFQAB0gACgVCCgAOgBQQgoFAoAAUUgAAKUCCgAAAoACAAAoAAAAAIAABRAAAAAAAAAA AAAkAAAABFRFSC8qAfOqqSEXs5jcSkvCsUWCmkRUA5AAAAAopAA91HU4K4Dl/ZUzMEPoqiOSC8qK ZV8C4UayH4bU/wANx0xm0mHgNoAAAAAAAAAAAAAAAAIBAAAAAAAAAAAAAAAAAAAAAAAAABYgVHAd o4DVqqpBq1ANEQCwIIUAEAJABACwAAAKBQAFA6AAUC8oFRqqB0ktVA6SS5e4B2lOoHaU4HSU6AdJ JaBck3vAMmneAmAgDAQBgoByrEA/B8e0zZtbZEVObWvoyz1/F/bnm/Lvt7O8eq2Hlm25O4hbHimW +HcLaPLMolTuAeV9IqdwowdTqncCMXSlTuFGasVAOVQDhUAhRCCFEUDlQOQOVA4UDhQOFA5UDhQO FAzUDhQM1AzUDhQM1AzVQOFKM1AzUDNQM1A4UDNQPuNU+A9jVpB6GAbsIP6l+Tf8RxF9i/VONTsh H9cQyKgHSAVAOkAqAUK6IKB0EVAqoBQKBUA6AoFQAB0gADoAhBQKgFAFFIBRSCgCgQUABSgQAKAA FAAQUKBACgAAAAAKAAAAAgAABAAAAAAAAAEUAAAioi8i8wHz6qlhF7E5DcSjwLycimkQDkAAAACi kFRYLFAPp0dRhojHLy9wzMLD0zZTZzFlvTkUzEj81VUzqeYrXJydxTrE2zLA0AAAAAAAAAAAAAAA ACAIAQAAAAAAAAAAAAAAAAAAAAAAAAAVFgBuxxB6WqBohAKBBIAIAQoAWACACAFAAUCwA6RqgdpL VQNW07l7hBs2m74saJJagV2jGp3ALBAHIBIgIhCIEiAiBIgCiAQD8Vxt/HWX7V9Fh6vjftjN8FyH qc2LmoUYPlovcA8z5DV7hR5n0re8VHkm0qd4DxTKbwFHkfIh3Co875SoBi6WoHCsgBwqAcqUcqBy oHKgcqByoGagcKByoHCgcKBwoGagcKBmoGagcKBmoGalGagZqBmoGagcKBmoH3GnwHsbsIN2Aehh B/Ufyc/9/iL7F+qcanZCP64hkVAOgKgHSAUDpAKRVA6AqAVAKB0BUAoFAqAAOgKgFAIQUoqEFAAU AUVCCgCioQAAFKBBQAAAUCChQIAUAAKAAAAAAAAAAAAAQAAAgAAAAAAACAEAipHkUD59XS872Jyd 43Eo+eqQ5FNIgEAAAAAopB0x6scioB9innJOZ/zJzmJhXNXStqZap/bT91RE0S/NTJbpT1Y5IKh1 hlyUAAAAAAAAAAAAAAAAACQAgAAAAAAAAAAAAAAAAAAAAAAAAA6asAPQyYQehrgO0UgoCAVIBAAU IAWACAFgoHSS1Ug1bIcvcA3bS98WrVtO1OcljRGNTuAWKIBMJAOVehRFmATDUImGAwwGEAwgGEAw ii4QCICIEiB+K42X/XWX7V9Fh6vjftjN8FVPUw4UIzcUZOQDFyFGL2oEeWZLRSjyTJJR5n0/gAwf T+AqPM+TADzvYBi5oGaoBwpRwoHKgcqBwoGagcqBwoHCgcKBmoHCgZqBwoGagZqBmpRmpBmpRmoG agcKBmoH3WHwHsehhBuwDdgH9S/Jz+I4i+x/qnFnZCP62hkdAUDpAKgHSAVAqoQdIBQKgFQCgdAV AKgFAoFAoFQCgVCAUVCClAgoADoAUAKQAAFAAUAAKBBQoEUAAAFAAAAAAAAAAAAAAAAAAgAABAAA AAAAIARUjz8wHzqulhF7E5DcSkvnqipyKaRAIAAACigCDWRNdKeioJgfZlzGzGo5v/E5q8Vwoknt WYxP8RPnNYzRMPgOarVVrkgqHRlCgAAAAAAAAAAAAAAAAAQCAAAAAAAAAAAAAAAAAAAAAAAAADpr oAbsmEHoa4DRFIKBShAgQA6RqqBo2Sq9wDVtMqi1bNpk7pLGqSmN7gHX7KARZiIBys0DlXqpRzFV AnKAgoCCgIBCCgIAQCFAAAiAwgGEAwgPxHHT8Gusn2r6Ms9Xxv2xm+BlUU9LCK9CjhXoEZq4o4VQ M3FGLgjFyIUYuagGD2lHlmMA8cxhUed7AMXMAyc0DNyFGagcKBwoGagcqoHCgcKBmoHCgcKBmoHC gZqBwoGagZqBmpRm4DNQM1AzUD77D4D2PQwDdhBuwD+o/k5/EcQ/Yv1TizshH9bMjoCgdIBUA6Aq BVQg6QCgUCoB0gRQqoBUAoFAoFAqAUCkAopBSghBQKBQBQIKAApQIKAAAAKFAigAAAoAAAAAAAAA AAAAAAAAAAAAgAABAAAAAAARURUgvMoHzKulwVwmpyG4lJeH9JpEAgAAAKKBSD0U1Q6U6C83dQkw PrNc17Uc1YophXgrre2cizJaQf3U75rHImHwXscxytckFQ6MoUAAAAAAAAAAAAAAAAACAIAQAAAA AAAAAAAAAAAAAAAAAAAA6RYAbseQbtcBqikHaJEDRstV7gVs2nVe4Sx6GU7U5xY1RrWkBXtQDhZn eKOVc5QJBygXAUC4AFwAGABcABgoBcEBglEwQJggcq0IitA5wQJACQKJACAAPwP5guVK2x/avoyz 1fG/bGb8vllPUwZZe+BcqEXKFBXgcK9AM3OQoyc4IycpRk4DzvQo872geZzSoxc0DF6AYPQDFyFG agZqBwoGagcqBmoHCgcKBmqgcKBmoHCqBmoHCgZqoGagcKUZqBmoGagfoGHwHsbsA9DCDdgH9Q/J z+I4h+x/qnFnZCP62hkdIBQOgOgKBUIrpAKgRQqgdIBUCKFUCoBQKBUAoFQCgUgAdACioQCikFAF FQgAUAUCCgABQIKBQAAAUAAAAAAACAAAFAAAAAAAAAAAAAIAAAQAAAAAI5qORUXmUD5NXTLLWKc3 cOkSzLxlACAAAAopBQPVT1LpToLzd4kwPqMe2Y3CaphXjrqFs9qvYkJifOaxyomH598t0tytckFQ 6MuSgAAAAAAAAAAAAAAAAAAJACAAAAAAAAAAAAAAAAAAAAAAAAHTVgoHrlRUg9suS53cIr2S6aHK pLHoRjWkBXtQDlXuXmQomC5ecDpJYHSS0AuCgCCAWCAIIAAAAAEAAAAEgUSAEVoHOCERWgcq0DhU KJAD+f8A5hJ/rLH9r+jLPV8b9sZvyanpYZqpRMMILMKOVmgcrNAmUKJhgcqoRm5SjFwGLijzvQqM XAYOQDFyAYuQDJyAZqhRm5AMnAcKBmoHCgZqoHCgZqoHCgZqoHCqBmqgZqUcKpBmqlGagcKBmoH6 Jh8B7G7AN2EHoaB/UPyd/iOIfsX6pxZ2Qj+toZFQDoCgdAUCoRXSAVAihXQFAqAUCgVAKgFAqAUC gUgpQIOgBRUIBRUIKAKKhAApQIKAAFAgoFAAABQAACAAgBYAAEAAAABAACAAAUAAAAAAAAAEAAAI AAAAOXsbMarXFHx6mndKcveNxLLzlEUCAAAAopB0B6KeodKcnLyEmB9WXMbMbhN/4oYV5a2hZUNV zUhM/WaiaJh+emynynK16QVDpbLgoAAAAAAAAAAAAAAAAAACAQAAAAAAAAAAAAAAAAAAAAAAB0xF VYAfYo6VXQVU5DMyr6rWNYnIhkR0zuIBzgudz8wHaS2oBeRALFAJhIAwkARARARKEQEQEQEQJEBE BEBEBEAAKIQAJAqOVQDlUA5VAPwXHzI1tk+1fRlnq+N+2M35N8s9TDzuYqAZOQoyWIRwqlHMQJhA MIoivA5VxUZucBi5SjFygYuKMXKEZOAycBkoGbgMnFGLgMnAZqBwoGaqBwqgZqoGagcKoGaqBwoG aqBmqlHCgZqBmoHCgfpGHwHsbsA3aQbtA/qH5O/xHEP2P9U4s7IR/W0MioB0BQOgKBSK6AqBFQK6 AoFQIoVQOgCAUCoBQOgCEFKKhBSgQUAB0gAoEFAAUABQAACgUAAAFAAAIAFAAAAAAAAAAAAAAAkA AAoAAAAAAAAAIAAAQABnNlNmtwV5+4pYlHx50l0pyoqG4lGJRIAQAAKKAIOgN5E90pycpJgfVlTW zWxTn7qGFYVlGypYqokJicyliaJh+dnSXyXq16QVDrEssygAAAAAAAAAAAAAAAAAAIAgBAAAAAAA AAAAAAAAAAAAAAfQoaZZjkVU5CTI+81rZTIJ3DCuFVz1gnMBo1iNSKgR0zuN+UDhVcvOoE5SicoC KgXCUCo4DrCAsQEQEQEQEQJEBEBEBEBEBEBEosUIEQIUAOQiKgH4bjlsa6y/avosPV8f9sZvzT5a HoZeSZLKjyzGwKPM9CjBwRwqlHCuA5VxRyrwOVeBmryozV4GauKMnKBk5SjJVCM1UDNygZOUDFyl GTgM1AycBmqgcKoGaqBmqgcKoGaqBwqgZqoGagcKoGaqUcKBmoGaqB+nYfAexuwDdpBu0D+ofk9/ EcQ/Y/1TizshH9aQyOkAqAVAOgKB0RVAqBFQquiCgUIqBVA6AqAAOkAIB0AQCgVCClBCClAg6AFB CCgUAAAoACgAKAAACgQAKAAAAAAAAAAAAAAAAAAAACAABQAAAAAAAAgAABAMp0ls5sF/e7iliUfH nSXSnKiobiUZc5RFQCAAKUABB0BtJnOlOSCkmB9aVNbNbFOfuoYpWVXSMqW8qQf3FLE0U/OT6d8h 6tch1ibZZFAAAAAAAAAAAAAAAAAAAAIBAAAAAAAAAAAAAAAAAABvTyVmvTkJMj9HTyWyWJ3zEyrp VV6wTmA0RGsTlCs1VX/oCOkbABABADlUA5VCiKgEA6RQLECxARARARAkQEQJECRARKEQGEBYgMID pFARAgAI/E8bJGusv2r6LD0/H/bOb869p6WHmmMA8c2WVHjmMKPO9pRg5AjJxRmqgZq4o4VwGauK jhXAcqoGaqUZuUDJylRkqgcKoGblAycBk4oycBm4DNQM1AzUDhVAzVQOFUDNVAzVQOFUDNVA4VQM 1Uo4VQM1A/UsPgPY3aBuwg3aB/UPye/iOIfsf6pxZ2Qj+soZHQFQDpAKgFCugKQdBFQqqhBQOgCA dAUCoBQKBUAoFQABUIKUEAoFIKAKKhAApQIKAAAUKBFAACgQAKAAAAAAAAAAABQAAAAAAAIAAAUQ gACgAAAAAAABIAAAGM+Q2c2H9ruKWJHxpsp0tyoqHSJZZgQCFFAAAKQUDWTOdLciopJgfWkzmzU/ 5u6hiYVzU0supZguT9ruKWJofnamlmU71RycncU6RNsy85oAAAAAAAAAAAAAAAAAAAAgEAAAAAAA AAAAAAAAAaS5azHIiAffoqVJTUc5OU5zKvS5VcuC3mCtERJbfCQZ8r1ivMVHaJAKoACKgRAOVQDl SjlQAFiBYgIgIgIgAJECAAJEogCICICIFiB0jgOogAPxfGn8dZftX0WHp+P+2MnwHtPQy872hHne 1CjyTGIUeSYxCo8z2ohR53oEed5Rk4DNSjhQOFKjlQOHAZOKMnAZuKjJwGblAzVQM1UoyUDNQOFA zUDNwGagZqBmoHCqBmqgZqoHCqBmpRwqgZqoHCgfq2HwHsbsA3aBuwg/p/5PfxHEP2P9U4s7IR/W UMjpAKgHSAVAOgKFUDoiKgVUAoHQFQCoBQKgFAoFQCgUAB0AAqAAKhBSgBSCgAAFAFAgoFAACgQA KAAAAAAAAAFAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAgADz1NOk5sU/eQsSS+O9iy3KiodGXAEAACg QAKBQNJU10tUgomB9WRPbNSC8jjEwrqfIZPYrHp+hRE0PztXRzKd68kW9xTpE2zMPKaAAAAAAAAA AAAAAAAAAAAIAAgAAAAAAAAAAAAdMar1ggH26CiRqI96GJlYfQc6P7DTKukRJaRXnA55XrFebuIU dohBQEAIUAIoEUI5UDhSiAAAFiAiAiAAgEAgACFAAQQoRARA6RwHcQPxnGn8dZftX0WHo6H7YyfD cehl53qUeZ6hHmmKUeOapUeOY4o871KMHAZKhUcKgHCoUcqgHCoUZuCM3IBkqFGbgMXFRi4DJVA4 VSjNVAzVQM1UDNVA4VQM3KBm5QM1UDNVA4VQM1AzUDhVAzVSjhQM1UD9cw+C9jdhBu0DdpB/Tvyf /iOIfsf6pxZ2Qj+tIZFA6QCoB0gFQKoHQFCKhFdIBUAoFQCoBQKBUAoFQCgUAB0AIKUAKgFAEFAo AAgFAAUCgABQAEFAAAAAAAKKQAIBQAAAFAgAAAQoAAAAAAAAAEAEAIAAAAAAAAAAeSrpkmIrmp+1 3TUSkw+Q5qsWCm0cgQAAAAAKBQNJcxWLyLyAfUkVCTERHL+13zEwrWbKZOYrHpFFJEq/P1tA+Q5X NSLF5lOsZWzMPCaQAAAAAAAAAAAAAAAAAAACAAIAAAAAAAAAAdNarlggH2KGh5nvTkMTKw+mqw/Y YZV01ElpFecCcr1ivN3EA7RAKBAAACFADkIigcKByUAAAAAAAAOQAEAACgAAgEAqc4GqAfjONf46 y/avosPR0P2xk+E47svM8o87yo8swo8cxCjyTEKjzuAyUo4VAOFQqOYAcqgGaoUZqgGbkKjFyAZO QoxcgGLioxcBmoGTijNygZqoGaqBwqgZqoGaqBwqgZqoGaqBmqgcKoGaqBwqlGaqBwoH7Bh8F7G7 CDdgG7SD+nfk/wDxHEP2P9U4s7IR/WTIoHQFQDpAKgV0gFQIoVSDpAKgRQqgVAKBQKgFAoFQCgVA KAAoFIKAKCEFApQIKAKKQAKAKAAgoAAAAAAKAABQAAAAAAAAAAAAgAAgAoAAAAAAAAAIAAAAAAAA A8FZSoqK9ifpQ1jKS+WqK1YKbRFAgAAAAAUCgdserFinMB9OnqkciNcv6FMTCvS9jZjVa5ItUivi V1tWXGZK5WnTHJmYfKVFRYLzmkCgAAAAAAAAAAAAAAAAAAAEAgAAAAAAAHTWq5YIB9mhoeZ705DE ysQ+kq/2GIZV0jUlpFecCIiuWK83cQDtEA6IIUAIAAKBAIpRyoHKhHCgCiAUAAAgACAAIAAACgBF AgFTnA1QD8Zxr/HWX7V9Fh6Oh+2MnwXHdlg8DzvKPLMUqPHMVCjyTFQo87ioycBwpRyBIBHKoUcK 0DNWlGbmgYuQIychRg9CjzuQDFyFRi4DJxRk4DNVAzVQM1UDNVA4VQM1UDhVAzVQOFUDNVA4VQM1 Uo4VQM1UD9mw+C9jdhBuwDdhB/Tvyf8A4jiH7H+qcWdkI/rCGRQOgOgKBUA6QKqBFCuiCgVAihVA qAVAOgCAUDoAgFAqAUAgFAoFAAVCCgAAFAAUKBFAFAgAUAAAAAKACgAAACAUAAAgAABQAAAAAAQA gAoAAAAAAAAQAAAAAAEVI8i8wHzKylwVw2/uqbiUl4ObkU0iKBAAAAAAoFA7a5WrFAPoU9VyYLuV DEwr2/suTvoplXy622I9FmSU5e603jkkw+I+W6WqtckFOjLkoAAAAAAAAAAAAAAAAAAABAAEAAAA HbJbnrBEA+1RUCNRHvQxMrEPeqx/Yl83fMq7RGy08IERFcsV/wCCAaIgFIAACFACAFAgEUoigcKE cKBAAAAUAAEAAQAAAAAIUQCoiqBojYEFA/F8a/x1l+1fRYejoftnJ+fe6B3Zed7io8syZAo8cybz lR5HviUedylGahGalHCoBzABAokAOFQDNyFRm4DFyFGLkAxehUed6FGDwMHlRg4DJxRk4DNygZqo GaqBwqgZqoHCqBmqgcKoGaqBwqgZqpRwqgZqoH7Zh8F7G7CDdgG7QP6b+UH8RxD9j/VOE7IR/WEM jpAKgHQFAqAdIFVAihXRBQKgFQCgdAVAKBUAAdAVAAFAoFQABUAoAgoFKBBQBQIKBQAAABQAAAAA oAKAAAQAoEgBQAAAAAkAEAEAAAKAAAAAEQAUAAAAAAAAIAAAAAEc1HIrV5UUD5FXTLLdFObuKdIl JeQqIoEAAAAACoBQOkVUWKAe2nqVTk+VDMwr6DHtekU+QyrzVVDLqEVYQf3yxlSU+DU0c2ncqKnJ 3zpE2zTzGgAAAAAAAAAAAAAAAAAAACAAIAA2kyHzXIiISZH3KWiZJajn85iZV6orM/ZbyN75Fafs y0gnOBEaqrFwHaIQUAAAAAIUQAoEAigcqBwpUcgQAAAACgBAAEAAAEAGCoFRigdIzvgdQRAAEiB+ I45fg11l+1fRYejoftnJ+ZfNTvndl5Zk1O+VHkmTCjyvcVGLlKOFA5wQJgFEVgHKsCOVYUcK0DhU KMnIBk5CoycgGLkKMHIBg9Co870KMHoBg8qMHFGTlAzcBm4DJwHCqBmqgcKoGaqBwqgZqoHCqBwq gZqpRwqgfuGHwXsbsA9DCDdgH9M/KD+I4h+x/qnCdkI/rCGRUA6QCoBQOgqgdIEVAqgUg6CKhVUg oFQCgUCoBQKAA6AAUAQdFAAhBQKUCCgAKFAigCgQUAAAAUAFAAAIoAAAAAAAAAAAAAAACQAQAAAA UAAAARCgAAAAAAABAAAABxMltmNVq/8AAo+NUSHS3KkDcSywKIqAQAAAAUCgAOkXuoB6ZNQrVSKw XvkmB9GXOR6QXkUxMK6mS2TW4L0igtXxqy1q2L5XKneNxkzMPlOY5iwckDaIUAAAAAAAAAAAAAAA AAABAEIgeymonzVSKchmZKfbk08unbzRcYmbaao10xYryNA7VUYmC3nICN5YryqB3AAAAAAAACFE AAQCKBypRwoRyFRQgAAoABABABglDBAYAHSMAuAgFgiAIoByrgIrgOFeByrwP5/+YU1W1ljh3da+ jLPT0P2xk/JOnOU7ssnPcpRm5VAzdEozVFCOSiogHaNAYIHKtAzVCjJyBGbkKMnIBi5CjFyBGLij FxRg9APO9Co870KMHoB53lRg4ozVQM1UDNQM1AzVQOFUDNVA4VQM1UDhVA4VQM1Uo4VQP3jD4L2N 2AbsIN2Af0z8of4jiH7H+qcJ2Qj+rmRUA6QCoB0BQqgdBFQKqAUDogqAVAKBQKBQKgFAoFQCgAKB QKAAqEFKBAAoACgUAUAKhAAAAAFABQAEUAAAAAAAAAAAAAAAAAFAgAQAACgAAACAACACgAAAAEAA EAAYz5KTWw/tJzFiR8abLWW5UVDcMsyiKgACAUAAAoACgbS5ys5+VCUPfJqIpzxQzMK9TXNcnIRX lqaGVPRVhgu75YypKfFqbfNkqqwi06RklPEqKnIqFQKAAAAAAAAAAAAAAAADtkt8xYNQg+pS27mc /mMzktPpJgS0wJacplXbZfLhP5V7xB0ro/st+UA1sP0gdgAAAAAAAAIBAIUQCAcqUcKEQCAIAWAF gB0jQLggXBAQAsEAciAcq5AOVeBwryjlXKBIqBAJygIAfgPzCbhVtj+1/Rlnp6H7ZyflskdmTIls crTi0crTixm6nLYydIVBY4yaoVFRAoqBHKoBm5CjJyAZOQoychUYuQDFyFGDgjFxRg4owegHnehU ed5Rg9APO8qPO5SjNVA4VQOFUDNQM1UDNVA4VQOFUDNVA4VQOFUozVQP37EPgvY3YgG7UIN2Af0v 8of4jiH7H+qcWdkI/q5gdIBUA6QCoBUCugigUK6QgqFRQqkFQCgUCoBQKBUAoFQCgEAoFAoAgoFK BBQBRSABQBQIKAAAAKACgRQAAAAAAAoAAAAAAAACAAAAAFAAQAAEABQAAABEAFAAAAAAAEAAeaqp 0mNwkT9pCxI+O9isWCnRlyBAAAAAAoACgUDpr3NWKKB7JNQi86wUzMK9jZvS+UzStINekFgqd4g8 NRbJU2Ks/ZXvG4ySnyJ9vnSlXk5DcZJTyK1zeRUgVEKAAAAAAAAAAAArWOcsEQg91Pb3zFRXJyEn JafVlU0mQnLyqYmVbJhzORORpBo1jZaR7vfAiqr+bkaB2jUQCgAoEAAAAAAgACAQoigcqoHClHIA IIgHSNCukaB1AgsAHIgHKuRCjlZiBHCzFAiuUo5iqgIKAwQGCAwQGCAwQGCB+E49ZGtsn2r6Ms9H R/bOT83k4HZkwQIqAcKhRwqAZuaVGLmAZK2BRwoHClGahGbkKMnAYuKMXBGTijB5R53hGLijB5R5 3oB53lRg4owegHmehUYOWBRmqgcKoHCqBmoGaqBwqgcKoGaqBwqgcKpRmqgf0JiHwXsehiAbsQg3 agH9K/KL+J4h+x/RnFnZCP6sYHSAdAUCoB0gFQChXQFIKgRSqpB0gBAOgKgADoCoAAqAUCoAA6AA EIOgBQIKUCCgUAUCCgAAACgAoACKAAAAAUAAAAAAAAAAAAAAAAAgAAAAAEgAAAAoAAAAiACgAAAA AADw1dMjkV7U/ShqJSXynNVqwU2iAQAAAoAAAAoFAAby6hzOReVCTCvbLmtdytWCmaG6TFT95P8A iRXUWPSCwXwKB5p1vkzeVEgpYySnzZ1pe2Ks5U8BuMkp4H001nOhq0pkrXJzoBCgAAAAAHTZb38y EHtkW+Y+CuTkJOS0+lKo5MlIu5zEytN0c5f2ZbYJ3yDRslE5XrFRY7VyN5E5V7wVyjVcsXfIEaIk AAUAAAAAAACAEAgACAcqUcqoHCqUQDpGkHaNA6gAAivRAM1mFHCuVQicqgXBAYIFwQLABABABABA oQAgAD8Pxyka6yfavosO/R/bOT86rTqjNWlHCoBwpUcKBwpRm5AMXIVGTkAzUozcBm4oxcEYuKMX FGTgjF5R53lGDgjBxRg8o87wPO4qMHFHnehR53hGCqUcqoHCqBwqgZKoHCqBmqgcKoHCqBwqlHCq B/RWIfBexuxAN2IBu1CD+lflF/E8Q/Y/ozi5bIR/VjAoHQFA6QCoBUAoV0BQKhBUKKQdAVAihVAq AUCgAOgAFAoFAAVCClAgqFACkBAKUABBQAACgAoACKAAAAoAAAAAAAAAAAAAAAAAAAAAAABAAUCA BAAUAAAAQAAQoAAAACQA+fV0v9pqchqJSYfOVFasFNokAIAAAAAACgAKAA6a5WrFFgB65NX3HmZh XrarHpFqmR1/iN5ligVcrD95BQi5GZ+8iL+kDB9BImc3IXVKU8sy0tX91TWop5n2qYnMXUlMHW+c ncLqKc6jO7wtKastsx3ONS09cu2NbyvM6inqbJkSuZIqS1aIr3cjGwQg0bI7r1iosa/ssTvEVmrn O5uRO+VHTWogHRFAAAoAAAAAACIAAgEAhRwqgcKoBGqoGiNA7RAHMBw56IBmsxVKOOVQio0DpGhX UAAAAAABEAAAAEUCAfiOOf46y/avosO/R2SzL88p2RwoHCoUZqgGahHClGagZOKM3AYuKjJylGbl AxcUYuCMXFGTijFwRg8o87yjBwGLyo87yjzPKjBwGLyjyvKMHBGSqUcKoHKqBm5QM1UDNVA4VQOF UDhVA4VSj+ksQ+C9jdiAbtQDdqEH9J/KP+J4g+x/RnFnZCP6qhgdIBUAoHQFCugioFVAKB0EVCKq AUCgVAKBUAoFAqAUABQKBQAHQAAQUoEFApQAEFAAAKACgAIoAAFAAAABQgAAAAEAAAAAAgUAAAAA AAAAAAAIAAEAJAAACgAAAABEKAAAAVEVILzAfMq6XB/aan7KmolJeBUVqwU2iQAgAAAAAUAAAoAA Boya9i8i8hKHuk1aO5HGZhXqRWPSPORUWS1RY4WS5P3VFiYM5vMsSoZSanOgEyzu60UJlVXmYKCM 53M2AHSSHu/fcLGjZLG9yK+Elq05EAzdM7jQIjVXldylR2iQIqgAAFAgAoAAAAIAQCAQCKpRyqgZ qseYDprO+BojQOuYg4c9EKMleqgcwVSio0DpEIOoAAKBAAEKAAAACIAAigQD8Rxx/HWT7V9Fh36O yUl+eU6o4UDhVKjhQM1KM1AzcVGTlAycpRk5QPO5xUZq4ozcoGLijFxUYuAycpRg8IweUYOKMXhH nmFHmeUYOKjF4HmeUedxRk4IyXkKOFUDNygZqoHCqBwqgcKoHCqUcKoH9MYh8F7G7EA3agG7UIP6 T+Un8TxB9j+jOLOyEf1RDA6QDpAKgFA6AoFQK6QCoEUKpBUAoFAqAUDoAgFAqAUCoBQKAAqAUAAA oFIAFKBAAoAABQAUCKAABQAAAoQAAAAAAAAAAAAAAAAAAECgAAAAAAAQAAAAEABQAAAAAgBABQAj mo5FReZQPl1VMrVinN3DcSkw8SoqLBTSIBAAAABQAACkAoAUBzcwHok1DmrBVJMK+jLnI5DEwrYA AAkEAQQCgQDlz0QDOKu/QVHTWwIrsAAAAUCAABQAAABEQogVAiKoHCuKOeV3MB21kCDREAjnIgGL piqUccqgdI0DpEAsAKAAAAAACFEAAAAEAARQiAfiOOP46y/avosO3S2SkvzzjqjNSjNVA4VSo4co GTlKM3AZOKjNwGL1KPFOmYJUZo/CKCqBm4DFxRk4qMXAYuKMHhGDijFxR53lR53gYOKMHlR5nlGD gMnFRi4oycoGaqBmqgcKoHCqBwqgcKpRwqgf1BiHwnsbsQg3agG7UIP6R+Uv8TxB9j+jNLlshH9U QwKgHQFQDpAKgFCugKgFQIoVSDoCoUUgoFQCgVAAHQACgUCgAKBQAFAEFCqVAAQUAAAoAKoQAAAA UAoQAAAAAAAAAAAAAAAAAAAAAAQAAAIFAAAAAAAAgBIAAAUAAAAAAEQoARzUeiovMB8upplasU5u 4puJR4lRUWCmkQCAAAFAAAKQCgAAoE5gPVImKZlX0Zb4oZVqQCgAAikHDlKMlWKlR20iu0AoAAAA AAAAAAABEAhVQIiqBwrgIjVdzlGqNRCC8iAZumd4oxVVUCo0DtEAsAKAAAAAAAAAgAogAAQQoARQ iBX4jjn+Osv2r6LDt0tksy/OuOiM1KM3FHCgZuAxcpUcKpRmoGTioxmLyAfIq5kFU3COZD1USPQq kHClGTgMXFGTioxcBg4owcEYuKPO8o87ioxeB5nlHncVGLijFwGLioxcUYuA4VQOFUDhVA4VQOFU DhVKP6oxD4T2N2IQbsQDdiEH9H/KX+J4g+x/Rmly2Qj+pmB0BQOkAqAVAKgV0BQOgioFUCkFQClF IKgFAoFQCgAKBUAoBAOgBAKKAIKUUAQVAAACgAoEUAAABQChAAAAAAAACgAAAKAAgAAAAAEAAAAA ABAoAAAAAAAEAAACAAoAAAAAQAAcuaj0g5OQo+ZU0ytWKJydxTcSjwqitWCmkQAAAAAAFIBQAAUA B3LWCkkfRku5jMq9KGVdFAAQcqUZuA4KjtqkV2BQAAAAAAAAACRCAEKqKoRyqgcKseYDprO6oGiJ ACOcjQMHPVxRESIHSNA6gQUBAooEAAAAAAAAgACAAAEKIQQoAfiOOf46yfavosO3S2SzL8646DNw Rk4o4UDNxR53LylRwBy4DJxRhNXkKj4VW6LlNwi04kewiuVCMnFGLgMXFGTgjBxRi4oweVHneBg4 o87yo87yjBxRi4IwcUYuAxcVGLijJVA4VQOFUDhVA4VSjhVA/rDEPhPY3YhBuxAN2oB/RvymT/U8 QfY/ozRlshH9TQyKQdAUDoCgVAqoB0EUKqAVAKBSCoUUg6AIBQOkAAVAKBQAFQCgAKAIKBSgAIKA AoAKBFAAAoAAoQAAAAACgAAUAAAAAAAAAAAAAEAIAAAAACAACBQAAAAAAAIAQAFAAAAAAAAOXNRy QXmKj5tTTYKxTmNRKU8KorVgppEKIAAAUAQCgBQAACt/eA+hI7hiVe1EMq6AgACKBwqFGbkAIoHa KB0BQAAAAAASIACAIgRVKOFcEc8rgNGsgB3yIQZvmQ5ijFVVxRUaB2iEFgBQAAAAAFEAAAAACAAI AAAQohBCgB+H45/jrJ9q+iw69LZLMvzqnQZqUZuAzUqM3ged3OUchHClGTgPJUPwWqpqB8Cc7Cf/ AMTcMvVTJyElXqIOXAZOKjFxRi4DJxRg4IxcUYPKPO8qMHged5R53FRg4owcUYuCMXFGLijFwRi4 ozVQOFUDhVA4VSjhVA/rjUPhPW3ahFbtQDdqAf0X8p/4niD7H9GaMtkI/qSGB0BUA6QCgUK6AqAV AihVA6IKhRQKhBUAoFAAdAAKBQKAA6AAUABQAFAEFAAAKAAoAAFAAFCAAABQAAKAAAAAAAAAAAAA AAAAAAAAAAiAAAACBQAAAAAAAAEIASAAAFAAAAAA5c1HJBeYqPnVNNgxVOY1Eo8Dmq1TSIAKIBQB AAFACgAK1IuA+pTt5InOVepCKoAAByBFKOHIBnzKUdIpB0igUCxAsQJEBEBECAIgSIEVSjhXBBGq vOBqjUQiqqoiAYPmR5EKjiCqUdo0g6RAKAAAAAAAAAAAIAAAQAUQABAAEAhQIPw/HX8dZPtX0WHb pbJSX5xTaOHFGalGagYvUqMFKIoHDgMXqVHya6dBFQ1CS+Q39p5tH1JDYNMq1Ug4cUYuAycVGTgM XFGDijFwRg8o87yjzvKjzvKMHFRg8DBxRi4oxcEZOKMXFGLgjFxRkqgcqoHCqUcKoH9gah8J7G7U A3YhBu1AP6J+VCf6niD7H9GaMtkI/qRkUg6QCoBUA6QChVA6CKgVQKBSIpVUgqAUCgVAKBUAoFAA VAKAAoACgUAQVAAACgAqhAAACqEAAACgAAUAAAARYAAAACAIAWACAEgAAAAoAAAAAAAEAIAAAAIF AAAAAAAAAAIgAKAAAAABHNRyQXmCPnVFNg8qcxuJR4HMVq+A0jkAUABAAFACgANZDcJxJV9eU2DU Ocq0AAAAEAigcqhRm5AOeYCooHSKB1EBEBEBECKoEiBFUDlXFROVeYDtrO+FaIkCDlz0aBg56uKg jQO0aB0ACgFABCAUCIAAAAAEAAAAEKIAAgEAKBAAH4bjr+Osn2r6LDt09kpL86psZuAzUqOHAed6 lGRURQM3AeSfMRrVU1CPztXOV71OkIlMxVdESPqsbBEMKqgZOKjJxRkoGTijFwRi4o87yjB5UYOK MHAed5Ued5Rg8qMXFGLgMXFRi4DFxRk4oxcEYuKMlUDhVA5VSj+yNQ+E9jdqAbtQg3agH9D/ACoT /VX/AOx/RmjLZCP6ihgdFFIOgKBUAqAdIBQqgVAKB0BUIAHQFQAB0AAoFAoADoABQAFAoAAQUAUU gBQIoAAFUIAAAFABQAACKAAAAAAAAAAAAAAAAgAAFAAAAAAAAAAIgABACBQAAAAAAAABAAAAAAAA I5qOSC8wR8+op4RVOY3Eo8D2K1TSOAAAAAKKAAAe2lZzGJV9JplVIAAoAAIBFQDlUAzVpRzyoARQ LhAXCAYQEwgIriiRCHKoFRkQrVrYEHXMBk+ZDkQDFVVylR01oGiIFWBAgAgBQBQAARQIAAAAgBAA ACKBAAEKAEAKBAAH4bjr+Osn2r6LDr09kpL86psZqBwpRi9So8zuUogHLgPPMeiIqlR8OuqudEU6 RCS+SkZjzSPq00qCRMzKvXAyOXFGLgM1KM3BGLijFxRg8IweUYPKMHFRg4o87wjB5R53FGLioxcU YuAxcVGLijJwGLijFxUYuAzVSjhVA/tTEPhPY3agG7UINmoB/Q/yp/ir/wDY/ozRlshH9QQyKgHS EFAoHQVQKgRUCugKBUCKFUgqAUCgVAKBUAoFAAVAKAAoACgUAQUAUUgBQIoAAFAKEAKAABQAEUAA AAAAAAAAAAAAAAAAAAAABIAAAUAAAAAAEAIAAgUAAAAAAAAAIAQAAAAAAEVEckFCPBUU8OVOY3Ej wPlqi8hplmAAAVCgBSB3UA+hTdwzKvchlVIoACAAoAQCKgHKoByrSjlWgc4KgIKAgoEgpRcEgqMA 7RoHaIAVUQDB8yPIhRnBVCNGtCu0QgoAAAAACgQAIBABQABEAAAqBEAAAIUAIBAAAD8Nx1/HWT7V 9Fh16eyUl+ccaHClGTlA871KjIoigZPdBCj5FdVo1FRFNxCS/PzZizHqdGXqpZKrBYGZkfWYzBQy 0qgZOCM1KOFAycUYuCMHFGDijFxUYOAweUYPKjzvKMHlR53FGLgMXFRi4oxcBk4qMXFGTgMXFGLi oxcBmqlH9uYh8J627ECt2oQbtQD+g/lWn+qv/wBj+jNGWyEf08yOkAqEHSAVAKB0BQKgVUAoHQBA KB0QVAAHQACgUCgAOgAFAAUCgCCoUAKQAoEUAACqEAKAAAAoBQgAAAAAUAAAAAAAAAAAAAAABAAA AAQKAAAAAAAAAARIAAIFAAAAAAAAAACAAAAABFRFSChHhnyIcqcxqJHhmSlTlQ3aMYKEIFFAEFAd 0D2068xmVfQbzGVdEUAAAAQKAEAkAJABACQAmCAwSiYIFgB1AgFHLnI0DB71cVHKJEDVGkV0iAUA AAAUCAAAACAAIAABEKAUABHIAABCgQQCFACAfh+Ov42yfavoyzphskfnFNDNylHne4qMV5SjlQM3 ugVHzK2rRiKiKaiEl+bqqhZjl5TrEMlNJVyxgJkfakScFEOcy02Ug4cpRmoHCoUZuCMnFGLijBwR i4oxcUYOKjzvKPO9So87wMHlGDioxcUYuKjJwGLijFxRk4IxcUYuAycVGLijFwH9yYh8N627ECt2 oBs1CD+g/lYn+qv/ANj+jNGWyEf05DIoHRBQKgHSAVAKFdAUCoEUKpBUApRSCoBQKgFAoACoBQAF AoACgCClACkAooAgBVCAFAAAoACKAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAgBAAUAAAAAAAABEAAQ KAAAAAAAAAIAAAAAEc1HJBQjxzZMF5uQ1Ejyvkopq0ed0tzS2jkAAAAeqnXmJKvpMXkMK7IoAAAA AQAFEAAAJABABABABACLyAZvmQ5ijFXK4qDWhWqNIOoAUgAABQAEEKAAABAIAAAAIUAAACAQIAQA BFAhQIIUfh+Ov42yfavoyzphskfm3KaGD3FGLuUqOFQDN7kRCj5dZWNYioimohJfnKqpWY7kU6xD LCXKV7kUWj7FLIRqJyGJlp7oQQg4VQOFA5VAOFKMnAZOKjBxRi4oxcEYOKMHlHmeVHneUYuKjBxR g4oxcEZOKMXFGLgjJxRi4oycEYuKMXFGTgjFxR/dGofDetu1ArdqAbNQg/f/AJWp/qr/APZPozRl shH9NQyOkAqEHQFAoHQFQKqAUDoIIFUDogqAUopAKKQVAKBUAoACgUABQAFAAUgFFAEAKoQAoAAF AigAAAAFAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAAgUAAAAAAAABEAgUAAAAAAAAAQAAAAAIqIqQU I88yT3ULYwdL76FRg+Qi8xqxg6U5C2OIKgQA9MlIElX0pfMYVoQAoAAAAAAIilAAAAAAAHDnogGL 5kS0M+VSo6a0itUQDqBAAAAAAAAAhQAARQAEAAACgQoAAIBAAACBACKBAAEUo/Dcd/xtk+1fRlm8 Nkj8w9xoYKsVKOVKMnuROcI+TXVqS0VEU3EJL81U1Tprl5TrEMuJUpXrEsyPp09OiQWBiZV9BqI1 DKiqBzACKgHKoEZuKMXFGTgMXFRg4oxcUYPKjzvKPO8qMHged5Rg4qMXFGLioycBi4oycUYuCMnF GLijJwRi4oxcUZOCP7sxD4r1t2oRWzUA3ahB++/K5P8AVX77J9GaMtkI/phkdAUgqAdIBUAoVQOk AqBFCqBUAoFIKhRSCoBQKAA6AAUABQKAAoACkAooAgBVCBRQBACqEAAAAFAAFAAAAAAAAAAAAABA AAAAAAAAAAAAAAAAIKgVAAAAAAAAAACAQAAAAAAAAAAgAAAAAAM3y0XmLaMHS1Qo4VqLzgZOkopb RxkBY1ZLgLV62JBDI0QgBQAAAAAABSogAAAAiqiAZPm94tDFXKoREQo7a0itUQgoAABQIAAAAIUA AACEAogAAAAgAohAAgAoAQABFCIAAgH4Pj1f9bZPtX0ZZ0w2SPy7liaHClGT3o1OUD5FbXI1FRFO kQzMvzNXVOmOXlOsQzLGTJc9YqWZH2KenRG8xzmVp7WtRqEVYkBEAsAOVQDhSjJwGLioycUYuAwc VGDijB5Rg8qPO9SjzvUqPO9SjFxUYuKMXAZOKjJxRi4DJxUYuAycUYuKMnBGLijFxR/eWIfFepu1 CK2agG7UIP3n5Xp/q799k+jNLlshH9MQwKhB0UUgoHQFQKqAUDoIIFUDoCoQUopBSikFQABUAoAC gUCgAKAAoACgCAFUIpQIAAKBFAAAoBQAAAAAAAhAKQAsAEAAAAAAQAkABAKIAAAAAAAAAAAAAAQQ AUAAAAAAAAIAIIUAAAAAAAAAEAAAAACK1FAydLLaM1YqAT9JR22BBogVUIKAAAAAAAAAilQAiqiA ZumogoYumKpRzyqBUaBojQO0QgoFAAAAACAAAEKAAgAQoAQAAAgAAAAgEAFBQIAAigQIigRQPwXH 38bZPtX0ZZ0w2SPzK8hVeebNaxFVVNQj4lbcESKIpvHFmZfnqiodNcvKdYhllKkK9Yr3SzI+rTUy NRDEytPe1qNaZUXlA6a0iu8ECKgHCoBk4qMnAYuKMXFRi4oxcUYOCMHqUed6lR5nqaHnepUYOKMX AZOKjFxRk4DJxUZOKMXAZOKjJxRi4DJxRi4qMXAf3tqHxnqbtQit2oBs1AP3f5YJ/qr99k+jNGWy Ef0swKBUA6QgqAUDoKoFQIoVQKgFQCgVCClFIKBQKgFAAUCgUABQAFAAUAQAqlRQBACgRQAAChQA AAAAhACwABQAAAAAAAAAAAABBIAAAAoAAIAAAAAAAAAECAEAFAAAAAAAAggEKAAAAAAAAACAABAK AACKiKBm6WW0Zq1UAI5UA6R4HSOQg6igVQACICKATCQI5V6d8o4WagocLNLQzV6qBzyqB0jQO0aB 0jSDtEAoAAAAAAAEAAAIAAAAIUAAEAEEKAAABAIAAigAIURQIoRFAgH4Pj9YVtk+1fRlnTDZI/HV FS2Wi8pqIHwK24xiiKdccWZl8ObOfNcdIhHcmmVyxVBMj6cmnRvcMTK09TWwQyrpEVQNGyyWNEaB FQDlUAzcBi4oycVGLgMXFGLioweUYPUqPM9SjzPUqPO9TQwcoRi4oycUZOKjJwGTijFwGTioycUZ OAxcVGTijFwGTijFxUf31iHxnqbtQit2oBs1AP3X5Yp/q799k+jNGWyEf0lDA6AoFA6IKgFQCgdA VAqgUCgVAKBUApBQAHQACgAKBQAFAoACgCClACgCABQAACgAoAABCAFABQAAAAAAAAAAAAAAAAAA ABAAgAAAAFEAAAAAAAIACAEAFAAAAACABABRAAAAAAAAAEIAAAUAAACKiKBm6WgRwstS2OVRUAmE qAMqqFoMspKDLKWhys1RQ5WYvfFDlXKBMIoAdI2JB21gGiNIOoAUAAAAAAAABAAAABAAAABCgBCA BABQAAQABAAEAARQIUchBQrlVgEfzf8AMupSTVWNY8+t/RlnXpx+JSX80rK5z1VEU7Riky+W7Dmu /SdEeuRSKsFVDM5FPpypCNTmMTLTXBgQVrFUWNmyyWrTBICoBwqFGbgM3FRi4DJxRi4qMXFGDlKP O9So8z3FR5nuKPO9SowcpRi4oycVGTgMnFGTioycBk4oycBk4qMXFGTgMnFRi4oycBk4o/v7UPjv S2agVu1CDdqAfuPyzT/V377J9GaMtkI/pBgVAOkAqEFA6CqBUCKFUDoCoBQKAApBUAoFAoFAAUCg AKBQAFAEFKAFAEAKoQAAUKAAAAIoAKAAAAAAAAAAAAAAAAAAAAAAAAAgAQAAAFEAAAAAAAIAACAC gAAAABAAgACFAAAAAABAAgAAAKAAAAAkAIrUUDN0tFKjJ0pRYzVioUcKilEAcoCCkHSNUDtGAao0 g6gBQKQAIUAAACEAKAAAQKIAAAAAEAgAABCgAAgACAAAEAigQCAQo5c6ARi+YUfyn82Hu1qwInd1 z6Mo79HZLMv582Q568p1seyTRw5YGZyKe9klGpzGLaaYIFbLVSWN2yoEsdYIUVAOFAzcVGTgMnFG TioxcBi4owepUed7ijzPcaR5nuKjzvUowcUYuKjJxRk4DJxUZuAycUZOKjJwGTijJwGLioycUZOA xcVGTijJwH+gWofIelu1ArdqEGzUA/b/AJaJ/q799k+jMGWyEf0dDAoHQFAqEHSAVAKFUCoBQKB0 gQCqgFQCkFQopAKKQUCgAKBQAFAAUABQBAAoBVROfkAzWdKbzuQtBrEnpoKHSTGO5nIv/EDsgQAo AKAAAAAAAAAAQABQAAAAAAAAAAAAAAAQAAEAAABQAgAAAAEAABAAAoAABAAAAIAAhQAAABAAAQAA AACgAAAAAHKoByrUUDNZaFtHKyhY5yYsVGIB0jQOoACKoQQChQCFRCKAAAAAAAAFKiAAAAAFcgAg AUCAAAEAAQoAQCAQCKByqwKM3PCMnPiUZrFSj+bfmdIylZYPBrn0ZR16c/iUfk5dKje4WZWm7ZSJ 3DNjtGKLV02V3yWNUZAWOsEliKgGalGbgM3FGTioxcBk4oxcpUYPUo873FR5ZjjQ8z1KjBxRi4qM HFGTgjNxRk4oycBk4qM3AZOKMnFRk4DFxRk5CjJwRk5CjJyAYuQoycEf6Eah8l6W7UCtmoQbtQD9 r+Wyf6u+/ZPozBlshH9GQwKBUA6QCkFAoHSBVAoFAqAUCoBQKQUopAKKQUCgAKBQAFAAUABQBAKK AIPn181zE5DeMJL8/NqZjnKiKdIhGOVmdJSo6bUTm8z1FD2SbtUylSK4Sd5TM4wtvrU14kzYNmfs OMTgtvpMex6RYqKngMq6IoAAAAARQAAAAAAAAAgQCoUAAAAAAAAAAgAAAEAAAAAAUQAAIAAABAAA AUCAAAAAIAAAQoACAAAAQAAAACgAAAAIBCApRyoHKgSJUIgIkACgQKoAIgUABAKAAAAAECiAAAAA RUKIEAAEAAAIBAAEKIBAIqgZueUZOeVHCqqgTBiB2jAPwP5iS0WssX2v6Ms3hP4kflMAWqpLiLVo kuBLHWCLCAHKoBmoGalGbioycBk4oycpUYuUDB6mkeWY8o8r3Gked6lGLioxcUYuUIxcUZuKMnFR k4DNSjJwGTiozcBk4oycVGTkAychRk5AMnIVGLkKMnIBi5Cj/Q7UPkvQ3agVs1CDdqAfs/y3T/V3 37J9GYMtkI/oqGBQKB0BSCoBQKFdAVAKBQgFdAUCgUgFFIKBQAFAoACgAKAAoAgpQAEFCvn3GXhM ibxZl+YmJB6odWXIAAAA9NPWz6dUVjlh3lJMWr7lJd5U6DZv7L++c5wW31GuRyRasUXuoYV1AAAA AUKAAAAAAAAAAAggABAABCgAAAABAAAAAEAAAAAAUQgAAAACAAAAAAAAAAEAAAAEAAAAACAAAAAU AAAggACFHKgZOdAqM1eAwwGGB1hgXDAuGAwgLhASICICICIUiEWICICIUAAAgAIoAAhRAgRUUqAA CRAgACFEiBFUDhXAZq4qOFioEwSjpGEHaNCrAD8F+YDY1tj+1fRlmsZ/EkPzGTFtOkZAlhgixFQD hSjNQjNSjNwGTijJxUYuUoxcoRg9xR5Jsw1CPK90TSMXqUYOUozcEYuUoxcVGbkKMnIBm5CjJyBG aoUZOAzchRk5AjJyFGbkKMnIBk5CoycgGTkKMXIUZOQIxchR/olrT5T0N2oFbNQg3agH7H8uU/1l 9+yfRmDLZCP6GYHQFQCoB0QUChVQCoB0BUCAVQOkQAB0AApBQKAAoFAAUABQKAAAUAQUAFCo89Wk ZSlgl+VqmwmKdYZYFQAAAADm5gPfR3OdTqiKuEzwmZxtYl+jpa2VUtRWr+13jlMU09RACgAAAAAA AAAAAAAAAgAQAAgBABQAACAAAAAAEAAAAACAAAAAAAgAAAAAAAACAAAACAAAACAAAAAAAAQAAAgG b1ghR5HvNIyV5QwwhhhVygQygVcqKDKkoXK+EULlRQuVFBlBQuU8IoMoAygoXKChcMg7RwHSKFUg AAAEKIAIBUQABAIAiBIgcqpRyrgOFVQJBShggVGAXBILABABAD8Lx4ka2yfavoyzUbJWH5vBMtJA o5UIzcoGaqUZuKM3BGblKMnKUYuUI873mh53PKjCY8sDxTHcpqEYqpUZvKMXAZuKMXFRm5AM3FGb gjJyFGbijJwGaoVGaoBm5CjJyAZuQqMXIBk5CjJyAZOQqMXIUZOQDFyFH+i2tPlu7drQrZqAbtQg /Yfl2kKy+fZPozBlshH9BMDpAKgFA6IKgFCqBQKgRQqoBUAoHQACkFKKQAKBQAFAAUCgAKAAEFKA ACkHnq//AG1LA/LVf752hl5ioAAAAAAA0kzpklyOYsBMD9FQXVk5EZNWDu+cssWol9VFRUinMYaU AAAAAAAAAAAAAAAAAEEAAAAACFAAQAAAAAAgAAAAAAIAAAAAEAAAAAAAAAQAAAAQAAAAQAAAAAAE AAAIoHlmuNQjxPeaRkryiZQUGGBcMCYYDDAmGAygDKChcoKDKigyooXKihUmih2j1INGuCtmqQaI 4g6iFIkAAAAASIAIkSiAIgRVA5iBCiQAYIDBAuCAgAgAgAAgAD8Px3/G2T7V9GWWNkrD82plpw5S jNVAzUqM1AzcpRk5SjNyhGL3QKPJMmGoR5XPippGbnAeeY40jyvKOFKM3BGTijNQM1QozVAjNSjN yAZOQozVCozVAM1QDNUKM1QDNyFRk5AMnIUYuQqMnIBi5CjFyFRk5AMXIUf6Na0+Y7t2tCt2tA2a 0g/Xfl4kKy+fZPozBlshH9AMDoCgUCoB0QUKoFCKFVAKBQLACgWBBSikAopBQAFAoACgAKAAoAAB SAACsahIy1LCPy9akHKdoZl4yoAAAADWW1HAaLIjzEsZOlOb3CjlFVqxRYKgH2bfdVbCXNXkOeWL US++yYyYmE1Yoc1dQAQAsAEApACQIEAEABQAAAAAAAIIAAAAAACAAAAAAAAAIAAAAAEAAAAACAAA AAAAAAIAAAAIAAAAIAAAAAAABAM5joIUeCdM5zUQjwzJhuEed0wtI5ypaFSaSh1lRQZQULhgMMCY YFwgGEAwgGEBUVSDRsQrZqKQbNQitUIOkIOkUCxAsQESChQCRKiBTlAgAIkAEAEAEAEAEAEAIUAB AAAQo/C8d/xtk+1fRll/UrG1+bVTLbNVCM1KM1AzcpUZOUoyc4oxe8qPLNmFhHie+Km4GceUI5cB hMKPO40jNQOFKM1QI4VCjNUAzcgGbkKjNUKM1aBwrRY4VpRmrQM3IEZOQoycgGTkKMnIVGLkAxch Rk5CoxchRi4DBxUf6Ra0+a7t2tCtmtA3a0g/Wfl8kKy+fZfozBlshH75DA6QCoBQOgKBUQiqEUAF dAUCogFAqAUCkAopBQAFAoACgIAUABQAFAEAAUWAHExIsVAPzNwZBynXFmXzTSAAAAA2kryiR72I ioYV0spFA8s2l7rSxJTyKitXl5FQ0j6FFcXyXI1y8hmcViX6SnqWT2oqLynKYppuRQAAAAABAAAI AQAAAFAAQQAAAAAAACAAAAAAAAQAAAAAIAAAAAEAAAAAAAAhAKAAAAAgACAAAAAAAAcuWCAeOdM5 zUQj502YbhHimPNowVxUcxARA6RygdI4guEFWIFiAiBYgVCDtrQNmsIrZrCWNmtMq0RAOoEHUAAF gFdQAEFAAAJACQAsAIAAAAACBRIAAAQA5CgRAIB+F48X/W2T7V9GWa/UrD8y5TLbNVCM1Uoyc8ox dMKjFzwMXzCo873mh55jolhHmcaRAOXKBg8oychUZqgGaoUcKgHCoUcKgRmrRY4VpbHCsFjhWCxw rRYzVpbGbmhGTkKMnIBi5CjJyFRi5CjFyBGLkKMXIUYuQqMXFGDio/0q1p853bNaRW7WgbNaQfqu AEhW3v7L9GYMtkI/eoYHQFAoHSAVEApBQAVUQDoCogRQqwAoFAAUgpRSABQKAAoACgAAFAAUAAAp BHcylH565N5VOmLMvirzm0AAAABpLWDgPfKUzKvS0yqq1FA802mR3cNRKPHMp3M5uYto3o6t8hyI q8hJi1iX6amqWz2py8pymKat6CKAAAAAAAEAAAAAQAAKBBAAAAAAAQAAAAAAAABAAAAAAAQAAIBR AAAAAAEEAACgAAAAIAAgAAAAAAMJr4IWB82c/nNwy8M1xuEeRylRmpQAAAOkUCooHSEVQKgHbWxI Nmy4ksbslEtW7ZZLVqjCDtGkFwQLABAKsCCwAsAEAKAAAQAAAAAIAgBAAACFACKoECIoEAgH4Pj5 YVtk+1fRlmv1Kw/Lq4y2zc8IxdMKMHzDSMHP5SjJXlRk5wGTlKjF3KUZuQo4UDhxUZq0DlWixwrC 2OFYLHCsFjhZZbHCyxaOFlixwrBY4VpbGbkAychRk5AjJyFGTkKMXIEZOQoxchRi5CoxcgGLijBx UYuKMHmoRg4qP9NNafOd2zWkVu1oGzWkH6jgJIVt7+y/RmDLZCP3ZgdAVAKiAdIBSCgCqqEHSAWA RQqwAoFAoFAAUgAWAFAQAoACgAKAAAUABSAAAKnIB8G5N5zpikvgrzqdGQAAAoFZzge+UpmVethF aIhAgBHS0cgseKfS91ENRKLSVD5D0RV5BMWP0dPUNnNRe6cphpuRQAAAAAAAAQAAAABAAAABAAAA AAgAAAAAAAEAAAAAAAAgAgAQoAAAAAQAIAKAAAAAAQghQAAAAEcsEA8FQ81CPmzXnSEeOY41CMFU qIAAAAAFQDtCDpGxCtmy/ASxuyUpLV6WSzNjdrCK0RpB0iEV1ABACwAQAsAEAEABAAgAoAAAEAAA IBAAEiAKJECBEVQJEDmIEiUfgPzCdCssf2r6MssbJWH5R0wjTJzwMXPNIxc5VKMlCOFKOFA4VIlH CtFjlWCxwrC2jhZaixFYLHKsFjhWixyrC2OFYLHCtFjNWlsZuQIzchRk5AMnIVGTkKMXIBk5Coyc UYuAxcVGLijF6lRg9SjBymkYuKMXFGDioyc0WP8ATrWnz3Zs1pFbtaBs1oH6bgRIVt7+y/RmEy2Q j90YFQCoB0BQKQCigVEIrpAihVAoFAsAKAApBSgQUCwAAUABQAACgAKQCgBSAAA+VcpcUVTeKS/M zEg9UOrLkABQABOcD3SV5jMq9jCK1Qg6A6RCC5PCSAHnm0SrytQsSU2pEmSnIi8xJH2WLhIimGnR AAFEAAAAAAQAAAAAAgAAAAgAAAAgAAAAAAAEAAAAAAAIIAAAQoAABACgQAgAoAAAACEUCIUAAADG a6CFgfMnvNwy+fMcbhHmcppGYAAAAAVEA7axVIN2SlUlq9DJBLV6WSDNjdsmBLVqkuBLHSNIq4IF gBYAWAAAQAAAAAAgACAAAEAhQAgCIEAkQIUSIRFUDlVA5iUIgSIH89/MVYVli+1/Rlmo2SsPyCuU jThVCOFKOFQDhUA5VCiYIsMmLEWWLEyYscrKFjlZYscKwWM1YW0cK0WM1aUZqgGaoVGbkAychRk5 CjJyBGTijFxUZOAxcUYuKjFylGD3IVHne40MHKVGLijJxUYuKMnIBwrRYzcgH+nWtPC6tmtIrdrQ NmtA/ScDJCtvX2X6LyZbIR+4RDAqIBQOgKAAAdIgHSIRVAoFgBQLACgIAUCgUgFFIAFAsAAACgAK AAAUAAIAUA8lazCZE1CS/KVLYTDrDDAooAAAA9cheYkq98tDKt2tUg1bKVSDZkhV7hLVuynhzksb pLb3iK5dKZzwForVhyAaJykUgAAAAAAAAAgAAAAAAAEAAAAEAACAUQAAAAAAEAAAAAAQAoEQABCg AIoAAAAiACgAAAQigAIhQAi8iAeOe81CPmzl5TcI8T1NIwcaRwAAAAOmtVQN2SVUlq9UuR4DMyr1 Mk+AzavQ2UZsatYhFdo0g6gAgAgAgAgAgAgAgAgBAAAABAIAAgAogACASIEiBIlEiEcqoEVQJEog EAAQD+e/mKkayxfa/oyyxslYfkVQjTnBAmBEWGTFiLLFiLKLYZMlhk4CxFYLHCtA5VAOFQozcgRm 5CjJyFGbkAychUZuKMXAZOKjJylGLlKjFylGLnFGDnFRi5xR53vLSMHKqlRk5FKMnNKMXIVGTkAz VpbGbmixk5CoxcBk5Sj/AFE1p4XVu1oVs1pBs1oH6HghP9devsv0Xky2Qj9uYFgB0BQAACogHaIQ UKoFgBQLACgWAACwAoFgAIKAKKQAKAAoAABQBAKKAAAIEGNS2MtSwPydakJh2hiXkKAAABWtVywR APp01I9YchmZWn1pNEsEiYmVp620zU5zNq1SW1O4QXkQKivRAjnKChFeUZo5YgehhFdgCABAAAAA AAAIAAAAAACAAAAABCAAKIAAAAAAghQAAABACgACBACFAigAAAABEKAACEUAAACgQqOHrBBA+fOc bhHhmcpqEeR6GkZOQqOFQomCoHSMVRY1ZIVSWr1y6bwGZlaeplOZtaehsmBmxskuBLV2jSCogFAQ AsAJAAAAAAAACAQABIgQABABRIgSIEiBIgcqpRIhEiBIgQABABRAACAH8/8AzDbGssX2v6Msv6lY flMAxbapLFjpJZLDJixzgCxMAtiK0ljlWlGatA4VCjNUCM3IUZuAycVGTijFylGTnFRi5xRi55UY ueUYOmFpGDnloYueVGLnKUZOipRk5qqEZqwtjhWgZOQoxchUZK0WOFYLGTkKMHqWEYO5TSMXIUZO QD/VDWnhdWzWhW7WkGzWgff4KSFdevsv0Xky2Qj9oYHQFAAAKgHSIB1AiugKiAAKBQKBQKAAsAAF ApAAoACgAKAAAAKAAQApACgHExMJsCo/L3KUqOVf/wDOc64yzL5hpAAiKvIiRUD2U9uqJ6p+yqNM zlS0+7S2iXKRFfyqYnJafRZKly0/ZREMqqvahBys1C0OFmKoHKuVQIAAsADU5QPQ1IIRXQAAQAAA CAAAAAAAgAAAAAQAAAAAIQABRAAAAAIoEQoAABACgAABAiAAoAAAAAEUAUQiAUAAAAEAymryFhHz pvObhHlehpGDmFRwstS2JkhY0bTx7hLHoZTJ3iWtPSynRO4ZmVp6GykQzatUYiAdIhBYAUAAAACA FAiFACRARAkQEQJEABAEQOYgIlEiBIgcqoEiBIlRAIFCohAAAAEAJABACwA/B8fsjW2P7V9GWJ2N Y7X5rJnO21yYsTAFjlWixyrQOVQtjhUA5VAM1QqMnFGbgM3FGTioycBg9TSPM9yFHne9DSMXPLSM HOUoxdFSozVjlLY5WUoscLKFlOFloLGbmIgsZOQqMnIUYuQoychUZK0DhyAYvVEKPM9TUIxckSoz VBYxchRi5Co/1Y1p4nVs1oVs1pBu1oH3ODUhXXn7N9F5MtkI/ZmBQAAAB2iAdIgHRFWAFCKFIAUC wAoFgAAoCBBQLAABQEALAAAAoAABSAUAAAAAVCD5dbSLMiqIbiUl8V1snK6DUN6kp6pNjc6CzXQT vEnMp9ORbaWRywRVMTlK09aPlsSDUh+gios1V5hQ5VXKBMFQEAAEAQA7a0DvB5CCIkFA2ROQKAAA AAQAAACAAAAAAAgAAAIIUAAAAQQAAKIAAACKAAIUAgQAoAAAAIBAAAAAAAAIAAgAAAAKBAMpiRLC PJMlqpqJR53Si2OFlFtESR4BY0bT+AlrTdslE7hLGqS0Qlq7RpB2iAWAAAAAECICIEiAiAKJECRA kQEQJEBECRAkQJhFEwgJECRAkQJEBEogQAAAJAKsAEAEAEALABAgQAQA/DcdtjW2T7V9GWJ2Ljtf nME5W6GCLEVoscK0DhWlHCoBmqFRmoGbijB7kQqPO+aiGqHndUIWkti6oLSWxdOcvcLQxc969woy c2YpbRwslylspyshRqKcrIGopFkoLKcLLRBYzc1BYxchUYvKMHFRkqFGStKM3NFoxchRi9YFR53u 7xqBg5FUqM1aLGbkKMnIBk5Coxc0WP8AVzWnkdGzWhWzWkGzWgfa4PSFfefs30Hky2Qj9iYFAgAD pEA7RAOgqkFgEUKsAKAgBQLACgIAUABSCgIAWAAABQEALAAAAAALAAAIAADJ82WnOsSjBZyR/ZQt CYT3AVGOXnA7SWQdYKIA5AOVUDlVAFFRpB2jANEaRXUAOHcigdt5UIKAAAQAAAAAAACAAAAAAAgA gAQoAABACgRABRAAAigAABCgRAKAAAAABAIAAAAAACAAAEAAAACAEVAM3MRS2jNZQsc5FC2LkkFi 4CIQXBAsAKAARARARAkSCRKJEBhATCAYQDCARAkQJECYRRzhAIgSIEiBIgIgSICJRAAQAQCkALAB ABAgsAEAEALAAAgAAAfiOOGxrrJ9q+iwzlsax2vgKw5W6OVaLHCoBm4oycpUZOeiFGL5rU7pYhHm fUNTmNUW876hV5kLSWwc97uY0jJZb3c4sEp4841FLq6E1FIshveFlOVlN7wspwstO8Wxw5iCxk5p bGbkCMXIUYuKMHFRi5FNDFzRaOFYWxm5kBYychR53qiFhHle41CMHIqmkcKwWOXNJYxchRi5CjJz SoycgGTkA/1g1p5m2zWhW7WkGzWgfX4RSFfePs30Hky2Qj9cYACKARANEQDtEApFWARQqgWAFAsA AFAoACwAoCAFIAFAQAQAoAABQAAgAUABy57W86wKMH1SJ+6kRQ87psx/dghaERirzlRq2WiEVqiI hB1FAIrgOVcByqgQCo0DtGAaI0iqiAdQAAZTeaIgcyZiL+yomEbhQgAAAEAAAAAAAAgAAAAAQgAA IUAAAigAIgAogAgBQAAAgAAAAAAAEIBRAAAAAAEEKAACAAAAgFEAigRQOVKiRAkQJECRAYQDCAmE AwgGEBFcBzEokQEQJhAMIBhAMICRAkQJEBECAAACBQgAgQIAWACAFgAgAgBYAIAIAWBAgAgAgAAA Qo/E8bfx1l+1fRYYz2N4bXwVOTozcoGLnIVGD5iIaiEeWZO7xYgeV8xym6RkrXOCCSkFlOsigtaT JohLEViILHKtA5VCjhUCM1QozVAM3IUZOQIychRi5pRk5hbRi5hbGbmCxk5pUYuVEKPM96IaiEeW ZMjzGohHncjnFRzky2OVZAljJyAZOQoxchUZOQoycgGLkKMXIVH+tGtPM23a0K2a0g2a0D6nCif+ QvH2b6DxlshH6w5iKpRzzgaNQg0RAOgKAgRVA6gAAoFAsAAFgBQAFgQAKUIEFAAALAAAAmEnfAoF ARRO6Bm6a1vhAwfPcvInIWhisXc5URGoFdpBCC4SIBcMC4YEwwGEA5wKiEHaNA0RpB2iBVgAAAQD l6RQDwOVZb4mke+VMSY1FQyrsAQAAAABAAAAAAAQAAAAAIRQAEQoACKAAAECIUCAFAAAABAAAAAA gAgACiAAAAAQAIUAAEAACABFKIoHKqBwqlRyqgc4QEwiiYQEwgGEBIgTCAYQCICIEiAiAiBIgIgI gAIAAAWACACACAFgBYAIEFgBYAIAIAIAIAWACACACAEAAAIBAPxPG6wrrL9q+iwznsbw2vzrnHJ0 YPmIhaR5Zk41EI8z3qppGatVS2CSyWOkli1XAJYitA5VoHCoUcKgRwqFGaoBm5AM1QqM3IUZOQDN yFGTkCMnFGLoFHne9qGohHkmTk7hqIS3mc57jSMllqvOW0c5NBa05ViILGbkCMnFGDijFyFRm5AM nIBk5CoxchRi5Cj/AFw1p52mzWhW7WgataQfR4WSFwvH2b6DhnshH6hTmOYxKOmoBsiEHUAKBYBV gQUCwCKFIAUCwAoCAFgAAoAgoACgOQDlZjG86oBi+slN7sS0PO64R5GIWktnl5r15VggoeiU9E5V 5V8JFb5bvAcrNVQOVcqgcLygchHMSqkQiRAkQEQLECoRXaIBo1oGjWkGiIQdQCqEAAACKFcqB4ap O6ahGFNVZN8FXkLMI+s1yORHJyophpQBAAAAAEAAAAAABAAAABCAFAAEKBEAoAAAQIgUAAAAAgFE AAAAEIAAAAKIAAACAAAhQAEEAACjlVA4VwGavKjhXFHKuA5wgEQJEBEokSBEqEQpEBEgAAACACAC AFgAgAgAgAgBYAIEFwQLggIAWAFgFIECBQgAgQWACACAEKAQIIoVCoAQCKoH4Xjt6NrbL9q+jLJl sax2vysyd3jnEOjzue5xUcYCrzlsdJLQljrAQWGCRUgByqAcqhUcKgHCoUcKgGaoBwqFRkqAZuKM nKhRi5yIVGLpjU7paHnfPahaS3mmVHeNRilvM+ZMdzGqhGSy3O51LYmRRBZSKxEJYzc0oycgGTkK jFxRg4qMlQozVosZOQoycgRi5CjJyFGLkKj/AF41hwabNaFbNaBojYEHt4Y/3C8fZvoOGeyEfpXK YBqAbtaQdogFAoFgFUiLAChVgBYAAKBYAAKAgBQAEV7G86gYvq5TO6KHlmXJqful0pbyvr5ruYtF sHTpr+dxaRE8PL+kDVqhWzCDdhBshFdAIAMECYIHCtA5wSomCBMECQAqNA7RCK7agGrSDRAOiDoK BFAAQCKFZPeiIB4KmYiopqEfEnzlY6KKdIhl77fdERUY9eQzlisS++x7ZjUc1YopzV0FQgAAAAAB AAAAAAhAKAACEUAAAIAAAAAACKBAAAAAIAEKAAABCAAAAAIUABAAAAIUABBAEQOFciFGTphaRisw tDhXKUSIQAgAARQAAAsAEALAAAAQAsAEALAgsAEAEAGCBcEBggWBFWACACAFgAgAgAgAAgAAAAAQ oEEUCFRyqgcq4DlXFH4D8wVXXbH9q+jLE7Gsdr8scmxIAdJAirFAGEgEVyAcq5AOFe3vgcq9vfA4 V7SjN0xvfFIydOYndLQwdUtNaUti6qQuktk6qLpS2Lqpe8XSWwfPe7mLSWwcsxxRmst686ltKcrJ 76iynOSRBZSKxBY5VAM3IBk5CjJyFGTkCMXNKMnNLaMnNLYyc0WMnIUZOQIxchRi5CoxcUYuQo/2 C1hyVs1pFataBV5ANuGHxuN5h3NW+g8Z7IZfqE5VOatmNA1RIEHUALACgWBBSiwIoBYAUCwAAWAF Aiqic6gZuqJTOdwoeaZcZbeYtJbyTLi937pdJbzPqJr+dYFpGSqq86qpQ5AJEBEDtoGzVINWqRXo YpBu1CDRECu0aB0jCC4AHLpYHOSKGSAzdLA5wQJAAB0gHaKQaIB0hFdBFAoADlVAyfMRAPJNnc5q h86fNii8pqIR8ie6Km4ZYIqosU5FKPq0F1fIcjZixaYyxtYl+lkVMqoajmLHwHKYppsQQKAAAAAQ QoAAAAggAoAQgBQAAAgAAAAAAIAAgAAQAAEKAACEAAAAACiEAAAAAAIBIgcq6BRk6YWkYumKpaGa rEqOQAAARQIAWAUgBYAIAWACAFgBYECACAFwQLggXBIq4IEgBcEBACwAQAsAIAAEAoAABBCgAAgA ABAIBFKOVCIoHMCiYIH4Tj2Wr62yfavoyzOU/hrHa/MrIU5W6U4WS4WUzVjkLY4VHFHCq4I4VXFH CucBmuEUcLhoEcK55Rm5XqBzknO5y2C05NRTlZCd4WU4dIQuopwtOneGpKcLJancFlM3MRO4Wxmr U7wGbkKMnFRkpRmoHCoBmrSozc0DJyFGLioxcqFGLlQqMnKhRi5UAxcpUZOUowcpUYuUoycUf7Ha w5K2a0iu4QCPPPmIxqliBeEHq+43pf8A9b6Lx1NkJD9oxsTkr0NSBB1ACwAoFAsAKFWBBQLAABYA RXsbzqiAeeZWyWd2JaR5ZlyVeRiF0lvI+rnP7sC0jBXuXncqlHMUARARAAAEALADpANGqQatUK9M sg9TUMq1agGqIQdAUIQAgVyoGbkAyVCjmACCgVEA6RCDREA7ILEBEBhIBy56IB55k6BaHjmTzVI8 U2fzloeGZONRCPG50TSOQAHopqydTORWOWHeJMWW/S0V2k1CI164LzlONN2+mioqRTlQwAVAAAAA IIUAAAgAQAUQARQAAAAQAAAAAIAAAQAQAAAogAggAAAAAAIAAAAAEiByroFGTphUYueUZqoHKqVE AAAAVYAIEFgBYAWAFgBcEguCBcEBghVwSBggXBAuCBYAIECACACACAAAAAgAogAgAAAACACgBAAE AgCAEgAgBIFEgB+K42bGusv2r6LDHU2N4bXwFl+A89ujhZZbGTpXgLYwfJLaUxdJU1aUzWSospms hS2U5WSospysmPOLKcrILqKZrI5RaU6SVAlrSOYLGbmltGatKM1QDNzSjB7S2jFzS2M3MFozdLLY ycwtjNWixm5EKjFyohRi5yFpGD3oWh53vNRCPO95qkYuVSjJyqVGTlUDJ0SoydEoydEDJ0SoxcUf 7Qa04tNEaQczHI1FUo+NVTsJYIbiEfR4Kauv3le/q30Xmersgh+7Y04q1RCCwAsALACwAsAqgWBE ORAM3T5TOdyFoed9exP3UiWi3mmV013NyIWi3kfOe795ylpGauAmEBIgQAAgBYAWAFgAgBYAAOkU DVqkHrkklXsbzGVdtUDZOYg6CAACBUgBFbEDNWATJgXJgXAAYAFRALEiuVdAqMnPA4WaWhk+b4RQ 8c2capHimTi0jxzJxqh53OVSo5KBAAAEcrVi1YKndQD69DeJklUZNXCZ3zGWCxL9FIq5NQ1FY5Ir 3DlMU03IIFAAAgAQoAABFAiACiEUAAAAACAAAAAQQoAAIQAAACFAgAAIAAAAIAAAIgcq4ozc8UMX PKjNXFHAE5SoAIAIBVIAFgBUaB1gkDBA6RoHSNIq4IFgAgBYAIECAFgAgAgBAAAAAAAQAAAAQBAC AAAAABCgAAhAAFEAAQABAPxnGaRr7L9q+iwx1NjeG18RWnmdnCtLaOFYLGasQtjNWFtGasFjhWFs cKwWOFYW0cK0WM1aWxwrQOFaBk5pbRkrSjhWixwrC2MnNQtoxc1CjF0EKjB7kKMHzGoWIR5nzkNR CW875ymqS2DpjlNUMXYSlRk5rgOFYpbGayxaMnNQtjNzUAyciFRk5CjJyAYuQqMnIUYuQo/2o1py VV5EA+XWT4IqIpqIR8pIveaR+l4NlYNbd17+rfQcc+rshYftkQ4q6gBYAWAFgA5gIsxjedUAxdVy 283KooYPrXr+6kC0PO+omO53FpGDpkSjNXgcqqqBAIAgBYAIAWACAFgAgBQAFAAEA0aQeuSpJV62 qQdtUit2KQdoEUCwAkALABACQBZAFkAWQBaQIqKgHDkKMnAYPUowc6BUeeY8o8U15UeOY80POqxU qIUAAAgAAAGsmomyHRluVPASYst9yjvaLBk75TnODUS+1KqJU5EVjkU5zCtAoAAEACFAAQAoBFCI ACgAAAIBRAAAAQAIUAIQAAACKAAAAAEAAAAEA5VyIBm6YWhkryo4c4o4VQOSgQAACAFgBUaB0jSD pGAdI0guCFXBA6gQIAUBABABACwAkAAAAAAigQAAAAAIAAgAAAUCAAAAABIACgQQAAAhQAEEKPxv GSf66zfafosOfV2N9Pa+MqHmdnCoBwqFGaoEcKhRmqFHCoBwqFRwqAZqgGbkKOFQqM1QDNUKM1QD NyohUYPeid0tDzvnNQ1EJbyvn941EJbzPmuU1SMVSY7mQv4HOrTHc41QlItGvdUa1pwtK1Ocaimb pMtpblKed6S0LFjB72IapHnfMaWkti56KaoZKsQjhUKOFYqixwsollM3SkLZTJ0tospi5rS3KMXN aW5H+0UQyPJVT0ltXl5TUQPztTUYbl5TcQylPMbhJFRMD9bwg9rqy6wXq/0HHLq/pYfskOKqAVzW 86gZOqpTe7EtDB1d0EFFsXVMx3OsELQyV8edYhHKvKOFcoHCqoEAkAEAEAEALABACwAAAKAAAAAA AgHbSD1SuQivS1SDZhFbNA1QiOwgAAAAAAAAAkAEArlUIrB7SjzvQo8z0KjyzEUo8U1FNQjxzEKj EoFAAAIAAAAAAbyaudJX9lywJMFvs0t6XkbN5f0nOcGol9iTVSp6Jgu5e8YmKabkAgAAIUCAFAAE UCAAAAAQABRAAAgAQoAQgAAAACAAAAABAJECK4DhzyjFz4lRmqgSJRyoABABACwAuCBUYQdIwWOk YRXSNAuCQWAFgAgAAAAAAAAAAFCoQCoAAIFQgFQAAQABAAAAAgAgAgBAAAABIAAIAAACiEEA/HcY /wAfZvtP0WHPq/6unT2vjqeZ2ZqEcKUZqUcKEcqgHCoUcqgHCtKOFaBk5CozcgGTijJywKjzTJqN NRCPHMnqvMbiEt51SY/vl/CGrTHc41FLqffJrWl1aW3ngTVJTCbPpZKftvan/E1ETJcPmVF+t8mK ZRFVDrj0MpYnOHy53FNLGDFQ6x8WWZ6kPE/iLKfur8huPj0ncYrdZj++a7UQmpytZMcNEFuFnuUa S3OUcoodNVykkdwXvGVRUd3iK4XCCM3K7vgYuVe+UYu/SaRk4DJyL3ij/Z1RObKYrlJED8lcrmmE qIp0jFmZfBmXFsYxN0zbBbw2Wv7xdJb9l+XV0Wqq72qLHB1X52zPEcetjVLjL+h629E5Dz004dVz V5hQzWbMdzuKOYgWIDlAsAJACYIEgBIAIAIAIAIAAAAAAAAAAAAAAoGjEIN2EV6JZB6paEVu1oGi IRFKgAAACAAAAAAABADhzYkat55kso8z2FHmmSyo8cyUaHjmSi2jyvlqhq0ZqioBCgAAEAAAAAAA Hpp6qZKVILyEmFt96kuauREdy8xynFqJfUlzmTE5FMTCtCAAAhQIoAAAQABAAAgAAIUABAAAQohA AAAAEAAAAHKuA4V5aHCvA4V5UcK4DkogEAQAsAECDpGgdI0DpGkV0jQLAgsALABABACgAAAAQQCA CgAIAAKgAqBBAqACoAABBAIUAAAAAAAAIFAgAAAQCAAAEAAfjuMf4+zfafosOfV2OnT2vjKeV2cK hRwrQjlWlsc4IsRWgcKgHCoUcKgGTioycpRg9yIVHlmTmtNRCW8cyc53IhuIS2aSZkxeXmLcQU1b SNbyuMzkUyn1dDSNVZs1jUTvqhYxyy2EzEPz9dxtZqWLWPyrk7jeU9GHw88nOerjD81WfmHNdFKW RBO45x6sPgR+5c56+58Cq4tvFSq/4uAi9xD0Y/Fwhznq5S+VNuVdOWMye9Y+E7R08Y/TE5S8znvc v7TlX9Km6R2x2CvKpJge2TUN5EOWWLUS+nISfNhk5bl8MDjlUNw+pJtdZMgrm4KHHLq4w3GMvYyz q3/3HHKes1oaalTS/wB5YmdcyumEVshvIxsR+T8MnI9f3ZcE8JRksuY5I8kPBy/qFwM1p3ryxVf0 cn6y6kpw6m/4/pUa1pm6nRF7kP0eUaimbpLf0fINSUydLaLKZOYhbH+qLxUOSWsFO+MOcv51caic r1gp2iGJfHe+od3YG0cslKrovWKgf0b8ruSpvqJ6p9Gaefr/AKbxf02J5mnIFRALggdI0DtGgdIw gYAEwCjlWgcqgEgAgBAIAAAAIAgAAoAAAAAANGqQbMUK9Esg9koyr0oEl0EAAAAAAACAAAAAAADl zYhYl55ksK87pZRg+SWx5ZlP4C2jyzKfwFtHmfTr3i2MXSF7xbRmspyFscK1U7gEAAAAAAAArWqq ge2Qx6QMyr69Or0+U5y0+tLcqokTEq0IAACAAoAAAQABABAAACiACAAAAQCAAAACAAOVciAcOeWh mryozVwEiAAgEgAgBYAMEDpGgdI0iukaBUaQdQAQAoAARQAAAFQAEAKAQIgAAACgEAAAAEAgAIAA oEAJABAAUQAAAAAAVAAQAgUCIAAgAD8dxin+vs32n6LDn1djp09r5EDyuyYJByrSjlWixyqAcKgG alGblgVGLnFHmfNRO6aiEeSZUJ3DcQlvK+c53IhqIZRtNMmcruRBOVFLN1SjYr6iY1iJyxcpIvLY v4h+Vu3H1rocKXSf6ianJ+zzRPX0vhZ5bfw5ZdaI2PxFx44vFaqtluSRLXuN5z3YfDwx4uGXWmX5 2fWVVSqrPnPmKvSVYfIenHGI2Q5zMy8xtACAQD1Ultr65yNpad82PdROT5TGfUxx2ysYzOx+louA 66bB9bMbIb0U5XHkz+djGz8uuPQn9v0VLw1Z6BEimVenOq8p5M/k9TJ1jp4w+i1kuWkJFPBO4sIH GZmdstuHZZ3da1O6icq/MX8DJ1O50cJXOX5EGpKc6s1O4n61GpacrKREh5P1Cymay2osURI98WMn IVGLkAxchRi5CoxchRi5CowchR/pm8OixT14uMvwdakXqdYZeFWlRwicpR/QPyvT/VX37J9Gaef5 H6axf06B5m0ggFSAHaIgHaIgHaIhB2iIFFRAOFRAjhQM1KIBAIByAAAAAAAAAAAAAAQdIUaMUg9U tSK9ctxB7GcxCXQQKAAAQAAAAAIAAAAAARUiRbZrLQLbhZSKUZup0UWPO+m8BbHmfS+AtoxdS+At jNaXwCxk6jj3C2UydReAWlM1oV7xdRTlaF3eGopzqTxZRqTxqKdtoXd4aim7LfHuE1FPVLt3gM6l p7Jdvh3CTktPZLpmtM2rdGonMQUgAACgQKAAAEAAAIQAAACAAAAABAIAARA5VwHCvKOVeBwrio4V QIoEAAAACAFRoHSNIrpGgdI0gsALAABYAIAAAAigACAAAQABQABAIAAAAIAAAAIAAgAAAAAAAACQ AACogAAACoQABUAqBEAASAH5Hi5I19m+0/QYcut/q6dPa+TA8lu6KgHKoBwqFHDgjFzkQoxe+BqI R5Zk9qJzmohLeObU943GKW8iufMWCGtiO2Ub3cruRCTkUxrbharTLWZVz2Mh3FVIlxwzz2QTlEPw l5/MpP2pNplR7mVdyJ/wPodL/n/vJwy6+5+BuF6uVzerquoc9F/sIsG/IfQw6OOGyHnyymXz0a53 Mir+g6MiscnKqKgscgQD0UtDWVr8nSU8yc5eT9hqr8q8xnLPHHbKxjM7H6eh4BuU5EfXzZdHLXlV qrhPh+hOQ8mfzsI/1/LrHQn9v01BwlY6GC5J1bOT+3M5Uj+jmPH1PldTL907Y9LGH3EY6U1GS2S6 dncaiJH5EPPd8XRysnC/eVz/ANP7KCykyMOZEb+hPGSynLpSd3l/SLKcK1E7gsZOQqMnIUYuQoyc hUYuQDFyFRi5CjFyFGDkKjFyFGLkKj/RN0nfsqe2IcZfjKuamEp1hl4XTUKjljnPdBqRA/pP5X08 1Ki9q5IYWqQ82Yeb5H6bxf1FtMqnmtp2lJ4BaukpfALF1bwCx1q/gFi5FCCLLgBw5sCjFwRkqlHK gcgAIBAEAAEAAAAAAAAAAAFQDRpBuxSK9UtxB75SxQhLQqKAAAQAAIAAAAAEAAAAAAJAgQC2itQF uFlNXuBbZrIaoscLTIWxNWTvCxNVQWLqjRYmptFhqbCWLqcsWLqksWO0kMTuCxojGpzIQUAAIIFA AACAAoAAEEKAEIAAAAUCAAAACRA5VyAcK8o4V4HKuUqOYgSIEAgABABACwAQA6RpFdI0DqBBYAWA CAAKpAAAAIEAAUAgAAAAAAAEAAQAAAAQAAAAQABAAAAAAAAAAABAAEKgQAoBAAAqJAARUKj8lxak a+zfafoMOPW/1deltfLVDxu7lUKM3KVGL3ohYHlmT0TumohLeOZVd43GLNvJMqVXmNRilsITJi8h r8I2ZRrDCmLBO7EzOa0+bc+IbLZWKs6c10xP7DVip06fQz6mxnLPHF/O71+ZFdVK6TbWZGWvIj1/ ePpdL4GMfnJ58+vM7H5JZF5u83DcydUPVed0YHs1YYRucqnJ+ktP5dXKsRJlYuRZ0e6eXq/Pxx2O mPQmdr9XT/l1bZDIvTDeic7uU8eXz8pdo6EQ+JcLZQW5sxrWNwk7x3w6mWTnljEPxs2lq66Y6XSy HPivIjUie2Moxj8y4zEy+rQ8BXaog+scyjlL01i6H6EOWfzcI2fluOjM7X6m3cE2WlgrpUy4Tk53 TOSX8nMePqfMzn/+XXHo4xxfpGUqU7ElsydLLTmlympH5jyTlfF1qlSQ3nSWr16Uxf8A0JqWnWSe vI50E7zf2U+blJZSZJreZBZTlzQMnIUZOQDJyFRk5CjFyFGTkKjFyAYuQqMXIUYuQoxchUYOQoxc hUYOQo/0Nc6dcFeQ98PPL8lUUqq5eQ6RKMW0OEsIC0fctNjWdMb+xGKmcsmoh/UeDrRqNTc0VsMP V/mY7xnl603TUQ/aJLRDg06wEAYKAMBAIrUA4chRg8DzvUoweEYqpRAIAAgEAAAIAAAAAAAAAAAK gHbSDVoV6GOgQe6S8yPUEUoAAAACAABAAAABAAAAAAAAIAEgAgFQBABAgAAAECgEAAABACoAAAAI FAAAghQAEEAAAAEAkUAiuQDhXlocK8DhXFRIgQCAAACACACAFgRTBA6wQKjQOoEFgAgBYEUgBQAA ABAAACAAAACAAAAAAAEEAFEAACABCgAAgEAAAAAAAAAAAAAAAgACAAAACACoEVAPyXFn8fZ/tP0G HHr/AOrp0tr5ankd2EyYjSxCPDNqmpHlOkYpbwzaxVjBTcYs28b5rnKbiERsqZMXkEzRT0No2sTD muRqJzxMTmtPjXXiyzWdrkyiTJyf2W8p36fxs82MupGL+fXLjO+XyYtPbZbmS3LBMBFifQ6fxOn0 /wA5PPl1cstjW2fl1eLo5Km6TVlMcsVw1i5SdT5+GH4xXHoTO1+5t3ANgt7UwpGXmJzufzfIeDqf N6mX7d8ejjD78uhpJDUbJkMlonMjWoh5pzmdsulRBNfLlJFywTuIIix8ypqZ81jmyWpLavJlH8iH THGI2szL897GpJ01XzsOsmqsVa3kb8p6e9MR+Pw56IfUk23V2Qa2VRy+8xEwvlOOXUvi3GNNW08l FiyW6c7pzOb5zM5StNFlTHJBzsFvRZyJ4zNwtCSGM5kFlIrQM3IBk5CoychRk5CjNyBGLkKMnIUZ OQqMXIUYuQIxchRi5CoxchRg5CjFyFRi5CjFyFR/qS60EGryHuiXCX5KdRftryG7R6KO1rNeiYPO Jkp/SOG+HmtRsx7OQ45ZNxD9BIktlXO4NakE/wAD/tnHPZCvbA5iwCLACQAioFZvQo870A87mlGL 2hGDmlHCooE5QJygQCRARARAoAABACAUCgQAAAIBo0g2agVonIQemS6BB9BjooQl2VkKBACgAABA AAgAAAAgAAAAAAIAACBQABCAAAgAKAQAAAEECgAABAAUAEACFEIEUAmEhRyrwIrwOVeBwrwjlXKU SIEAgAAAAAALAgQCrADpEAsCCwAsAEALAgAAAUAAAAEAAAAEAAACgQAAAACABABQAhAAAQoAABBA IUAAAAAAAAAAAAAAQAAAgAABAAEUD8jxasK+zfafoMOPX/1dOltfFnTmsRYqeWIdpl8ioq1VVRqn bHFmZeBznvU2y7l0syZ3CTktPTq0mnbhz3o1E54mdUzsWn5+7cZ2q2NcyQqTZqdxvLyno6fxc89r nl1Yh+ErOIOJOI5uQoZb2y3LBEYinvw6HT6UXLhOeWWx9Oz/AJZVdU5Ki8zVai8qs53HLq/9CI/G LePQmdr+iW3h+12mWjKSna1yf21SLvlPm9Tr5Zz+ZejHCI2PoqhyacKhR46msp6fke9MPuNTlX5E NY4TKTNPnqtXVLhSpOTYv/yzef8A4IdPxG1n8y5WjkI6NRMdUzegnN8iDXP6/BTZGzIYMtrZLO8i cviM3CiU7UXCd+07pO5VGopVaiEscKgGbkKM3IVGTkAzchRk5CjJyBGTkKMnIVGLkKMnIUYuQqMX IUYuQIxc0oxc0qMXNKMXNKMXNKjByFH+xbvSpgLyHsxcZfkH0mFNVId06Wy/TWGzZR7XK3kMZSsQ /otLTNkS0a1IQQ5LMvkqkLtcf8n/ALZM9kJEvRA5qoAIAIBXDkCsHMAxcwDBzSjFzQjNWlHKtA4V oHCoBIASAAAAiAAAUAAAAAEAKiAasIN2oRXUANJawUD3SXGR6CopUAAAgBQAAAgAgAAAAgAAAAAQ AAACBQAQQAAAgUAgAAAIAECgAABAqRQCYaARZiAcLMFDhZilpEw1AmEoEioEiBAAAABAEAEALABA ikALABACwAsCDpEAsAAAgsAEAoBAAAAAAAAIAAAAIAIAEKAAAQAAACACiEAAAAhQAEACAAAABABA AUQAAAAAAAAQQAUAIAAgHIH4rjaekqtsy9/WfosOfVi4b6e1+UnT3zVghxiKdZlzLo3zFiqCcqKb PSko2Yc97Uh3yReWw/EPy9345o6NHS6NMo/mRU5j1dL4eWW1zy6sRsfkXVXE/E87J07HpKcvciiQ PZp6XSj8uN5Zv1Fn/LWRLVs+7TFmzOdZac3/ABU8nV+fM/jF1x6G9+3pLZQ0DEZSSGSkTuonL8p4 Muplltl3jGI2PQqGVcOg1FVyoiJzqpR82dc5KOydM11TN70tOT/ip0jpz+/wzqYOk19SmFUzUppP dly/3oeFS3jGz8pUykqTSyP4aVlH92a7l+df/QTMztIiGiypkz/3XcnQbyIS4haVJLWJBqIieAlg rQM1QDhUKM1QDNyFRk5CjNyAZOQqMnIUZOQoycgRk5CjJyFRk5CjFyFGTkCMXIUYuQoxc0qMXIUY uQqMXIUYOaVH+07vK/YPbDjL4VHbnT56QSPKamUf0C129tLKTk5TlP5Jmn1EYGJl8CYkLtcP8n/t mc9kLi1ObQUAAABAis3NCsXtA870KMXIEZqgHCoUcKgGaoBIARUA4AAAAFQCgUCQAQAsAAFQDtpB 6GhXcCDpqAeqUpB62rFCJLoqBQAAABFAAACACAAIAEiRaIgoiCkVwKTCQLRhAowglGEgWjCBRhAo wkIUmEgKWIKIgIoCkwkBREBEKkUARQgRAkUAmEgEw0AivQDhZhRwr1UDmKgIgQABAAAAAgAgAgAg QWAUgAgAgAgBYAWBBYAIAWACBBYAAKFAAEAAQAAAAABBABQAACCAAAEKAAgAAAEAAQAAAAAIAAAA AAAAAAAAEgAgAAhQAEAAAAgAoigcqsAMnP7xUfh+NpL59fZETm/1UfNYY6s1i6dOPy+FOmUNuYr6 iY1FTuKp5YjLLY7TUPyd246ly8KVQMwncyKevp/DmfzLjl1tz4VPRcScTzIwe2Qq8rncjUQ75Z9P pQxEZZP11q/Ly3UuDNrlWonJyqn9k8nU+dlP4j8O2PRiNr9dIo6aklpLppTZTE5INSB4ss5na6xF NFQisZ02VJar5r0Y1O65YFiJnYkvmuuM2oVWW+Qs3/8Atf8AssQ66Ij/AGlnVexi+hV/+Jc6hX96 U39lnyd0sZ//AKwVvasXBbgUklJbOkqQ+YzPFU1fCXCmuV7vDzfINRTTAROZCWOVQDhUAzVCjhQj NSjNUKM1QDNUKjJyAZuQoychUZuQoyc0DJyFRk5CjJyAYuQqMnIUYuQoxchUZOQoxchUYOQoxc0q MXNKP9w11G6akESMT2w4PZarU2QiPe39oTNpM0+2jUQlOUy6gWkfnZv+7XD/ACf+2Z6kfiG8HZyb CgAAACCLzEVg8K87kKMnIEZKgHCoBwqFHEAIoGagcgAAACogHQAAAAAAAHbSDZihW7eUg0RANWEH pYvIQlqVAqBQIAAARQCACAQSICIWnKuC04VwEwwGGBwrwOcIBhgXDAmGAwwJlCKZQUGUAZQDrKCh FmKBzlFAuUUUGUUUGGoEw1AYakEV6lEwlIEVAkQBQAEAABIAIAIAIAIAUBAikAEALABACwAQILAB ACwAQAQAEFCgAAAAgAgAQoAAAAAQAIUABAAAAIAAgAAAAAAIQQoAAAACAAAAAAAAAAAAAAAAAEgA AgAAAA5VSjNz0QtDOLnFQXAlpF6gfyr81uIpttn2NtI3CmzdbRF/+lstP/5G8ehGUfkjOn8/orFx FxLMys9Xy5LuXCfyIM+t0+lsajDLJ+2tPAdroER9QmsTudVdzRPB1fm55bPw749GIfqZcmXJYkuU xGMTkRrUgh5ZmZdaVUIPNUVNPTNwp8xGJ3EXnX9CGscZnYkzT5y1lbWclDJycpf/AJ53J8iHTTjj tlm5nY41CmlOytdNWpn9xHcqf8Gl1zOz8FR+2qzJz0wZTUky05u//wAE7hmojaI2nai4Tv2n9J3K o1FO1QiuFQDlSjhQjNUKOFQDhUKM1QDNUKjhUAzVpRm5AM3NKjJyFGbkAyc0qMnNKMnNAyc0qMnI UYuQoxc0qMnIUYuQqMXIBi5CowchRi5pR/0A1dqrFT308etsjURIIWIYmVNUKapH5ud/u1w/yf8A tnPrR+IbwdnB0UAUAAEIIvMZlYYPCsXFGTgjJQM3FGagcqBm5QOFKIQAEAOkQCgAAFAAAAADpCDV gV6GKQbN5SDVEA1YRWqKGXRQKgAAEUAhAAkSLSK4FOVcFcK4DlXAcKoHMShEgiqBIlEiAiQIgQAA 5QHKAAoAioVFIAUgBYAIAIAIAIECACACACACACACACACACBFIAALABABABACkFAAAKAAEUAoEAAA AACACAAAhQAACAAAhQAEAAAAARQIAAAAAAgARSiAAAAAQQoAAAAAAAAAAAAAAAAAACAQDhz0QoyV 6u5ELSIqI1MJ6wQDyza1rf2ZSRXvm4wS2LJFRUrhOijfCWZiEq353imy0U652OZUS0mula1gYXNy tZ4jzfI6uUY/h26WMW7bLYxqNY1GtTkRESCHzbeoVArzVNVT0rcKc9G95O6v6ENY4zOxJmnzVqrh X8lFKyElf/nmc/8AwQ6accdrFzOxG0NHSLlqpy1FQv8AamcvL4EGvKfxH4haiHbp0+dyS0yUvv8A dJUQWjJDG8vO5edy8qicinaoRXKhHCoBypRwqAcqgHCoUcKgHCoVHCoBmqAcK0ozVAjNUKM3IUZu aBk5CoychRk5oGTmlRk5pRk5pRi5pUZOaBi5pUYuaUYuaVGLmlGDmlGLmlR/0DPqRD56mqA1QpaH 5ud/u1w/yf8AtnHrxsbwdnndAAUAAAyOHKZWGDlCsXKUZOUIycoGTlKOFA4VQOFUDkBAoQA6RCCw AoEAAIAUCAIAAO0INWhWzSD0MINUA0aRWiBFRQilFAAAIQIgcKpFcq4K5iBFUDhVAhRyoEAAAJAC QAQILABggMEC4IDBCmCBcEgYIDBAYIFgAgAgQIAIAIAIAIASACACACACBFIAIAIAIAIAIAWACACB AgBQAAAQIBVgAAAAIAAAAAEAEAABCgAIAAAAAigAAAAAAhAgVUABAAAIAACFEAACAAABQIAAAAAA CkAECiQAAAgAAAcK5EAydMjzGqHOD/acsECMJlUxn7MpMJ3fNRilskkVFSsXrgt8JdUQVb1yaKVK 5VTCd31MTnMrEPTBE5EMq/L8TQS4WhV5v9T9Bp5/k/6u3R2vmzaiTKar3uRGp3V5jxRjMvRb5b6+ rrXLKt8uDeZZ7+ZP0HWMIx/2YuZ2Opdtp6dcvWPy8/nVz+VE/QhJ6kz+INNbXM2tfM/YkJgs5sLx CMK2lsWsRFwnLhOXurzmpkaR7xkUKpByqFEVAOVQDlUA4VAjlUKOFaBwqAcKhRwrQM1aVGaoBmqF GbkAzchUZK0ozc0DJyFRk5CjJyFGLmhGTmlGLkKjJyFGLmlGLmlRi5CjBzSowe0o/wCgJ9qnzgtI pqgNUPzc/wD3a4f5P/bPP8mNjp03R5XQKAAAQRVgYkYvcRpi5SjFyhGTlAycpRmqgcKoHCqUcgIE CAHSIBYAIAIAIAAAAAAAoFQg1aoVsxSD0sINQOmqRWiAWIRUUCxCACIEiFcxIOVCuFKIAA5UCAIA SADBIGCBcECowC5MimTAuAARgFwAGABcEg5wShgkFwQJggSACACADBAQAQAkAEAJABAgQCkAEAEA EAEAEAECBABABACwAQAQAAAoRAKAAAACAAAAABCAAAAQoEAAAAAAIAAAAAEIAAApVQAECAAAAAIV UIAQAAAAAAAAAAAAAAAAAoUcqqIEZOm9xCxAzg53KvIhUZvny5fI39pxYiy2aSqipWL1wWFuISre uVSypXMkXd9TE5TLUQ2gRUXk5V5gjzOqouwJKYbu/wBw1p3pb8bxlMe2vsqQWbNdrWCxP3Y4LOc4 9aP/AJdenteGVa5k5UnXB8YcqSk5kPFPUiPxi9EY73qmz5VOzAktRETmRDERM7VunyJ81810XLyd 47YxTEuGqBokVIrVrVMjRGkVcEgmCBFQDlUKOVQDhUA5VoHCtKOFQDhWhHCtKM1aBwrSjNyAZK0q M1aUZuaBk5CoychRk5AMnNKjJzSjFyFRk5CjFzSjFzSoxchRi5pUYuaUYOaVH+/T9BT5qloDVIFo fmp/+73D/J/7Z5flRsdOm6PI6gAAAMzIye4wrBziqxc4IycoGTnFGSqByqgZqoEgUWBBYAWACAAA AAAAAAAAAAVCDpFA2YoV6pakG6EHSAdoRVAAVFCLECAQKEHKgcKUIECAEgBIAXBAuCBcAC4BBUYg LdI0FrAJaQBZALZABABAgkAEAqQAQAQAkAJACwIJAKQAkAJABABABACQAQAQAQAQAEAABAAAAAIK ACgAAAAgAABAAAAAIAEAAAIUCAAAAABAAhQAAAIQAAACFUIAAAEAAAKgEABAAFAKAAAAAAABAAAI KsAMnzEQtDJVc9eQ0iOVkpIu5V7w2jL/ABqhYN/ZYX8QbXplUsuXywwnd9TM5WtNjKgQA809Fmfs quDL7vfU3j+ElJcrkwZaYLe/3VEyPz3EiS5dwtCqkVTWYL/0NPL8n84u/R2vlzpznc3MeKId5l8+ b4TpCPI9IqbZVjCTI9DGGZlWzWGbV1gkUwQIqATBA5VAOVQDlWlHCtA4VoRyrQOFaUZq0DhUKM1Q IzVpRm5pRm5AjJyFGTmlGTmgZOaVGTmlGTmlRi5pRk5pRi5oRi5pRi5pUYuaUYuaVGLmlH++T9NT 5amqA1QpaR+ZqP8Ad6//ACf+2eP5kbP8uvTdHidACEUJMjhzoGFh53uCsXOCMnOKMXOAyc4DhVA5 VSiIgFgQWAFgAgBQAEAQAAIAAAAAQQCgdIB20D0y1Ir0tcQaNCtEIAAABQiAAoQRUA5VAJACwAQA 6RoFRgS3WCgLIBFgAIAACQAQABUIEAAEgFIAAIAgFIEEAAQAFSACAAABCAUCCAAAAAAAAIACKgFA AAIAAAQAAIAEKAAgAAAACAAIAAAAAAgAAIUAIQAAAAACoAAAAAQAAAqAAAAAAAAAAFAAAIAA4c5E KjB8xV5jUQI1iu5VFo1wVRINQyrlKZFWL+VS6im6IiJBEghkAAAKymTMH9lvK9e4WIRy2Uq/tTOV e8Wxoqw5EIPyXFX+4Wf7T9Bpw+R/q69La+U/kPFD0PFNcbhlijYqasbslmZlXoawxMq0RpLFwSKk AOVaURWgcqgHKtCOVaByrSjhWgcK0DhWlHCoEZq0o4VoGbkKMnIEZuQoyc0ozc0DJzSoyc0oyc0q MXNKMnNAxc0qMnNKMXNKjFzSjFzSowc0oxc0qP8Ae5+sp8oLQFAD8zUf7vX/AOT/ANs8XzP1/l16 bo8ToEEMzKuXOgYmVed7wrBzgjFzijJzgMnOAzVSjkCo0DqBBYAAAAAAAAAAACAAAAAAQDpCDtoG zFIr0NUDdikGqEUAAAKEAIFABAAQAQAqNCW6gECgAIAAAAAEAABABACoAgBAAUgBCAACoAAkAAAi gEAAQAAAQAgAAAAACAFAAACKAAAAIAIAEKAAgAAAACAACgQAAAEAAAAAQKAQIAAAAKAQAAAAAAAA BAKAAAAAAAAIAAAUZvfBCxCPK96qpqkGpFQPSxEMyrSBFAAAABlNmYCQbyvXmQsQkpLl4KYTuVy8 6iZHSqByB+T4r5K+z/afoMOHyP8AV16W18aa48cO7yqiuU2jVkszMq9DJZmZVsjTNq6wSCYIEVoE VAOVQDlWlEVoHCtA5VoHKtKOFaBmqBHCtKOFaBmqFGaoEZK0ozc0ozc0IychRk5pRk5pUZOaBk5p Ri5pUZOaUYuaVGLmlGLmlRi5pRi5pRi5pUf7yP175IAAAfmaj/d6/wDyf+2eL5n6/wAuvTdHhdEM zKuXOgZmVed7yDBzijFzgMXOAyc4ozVYgWAFRAOoECBQgAIAABABAABAAAAAAgAABQKgHbSDZoVq 0g3YpBuhFUIAAKAAACAAAsALAIFAAAAAAAAgAAAAgAABBAAVAAEAEUAgAAFQABCAFAIAAAAIAAgA AAAEAKAAAACAAIAICgQAUCAAAAAAACEBSiAABAAAAAACBQABAgAABQABAAAAQABQAACAAAAAAAAA AARywQo8kx0VNwjEqOkdADeU9VWBmYV6TCgAAUcvcjGq5eZBAxlNVyrNdzrzFlGrlIrhSogH5Hi1 YV9n+0/QYcPkf6uvS2vhvWKnkh3VksTI9TJZiZVsjDNq7wSKYIsMEDnBAitA5wQIrQOVaByrQOVa UcK0I4VoHCtKOFaBmrSjNWhGatKM3NKMnIEZuaUZOaUZuaVGTmgZOaUYuaVGTmlGTmlRi5pRi5pR i5oRi5pRi5ppGDmlH+7j9g+QAAAH5mo/3e4f5P8A2zw/MnZ/l16angmXVw56IYV53zAPO55Rk54G LngZK4o5gqgdIgFgBSBAAAgAAAAAACAQAAAAAIAAAUDpEIO2gatIrVoGzCD0NCuiIAAKACAUCAFA AUoAAAACACAAAEAAAAEAAQAIACoAIIACgEAAAIFABBAoBAAACAAIAAACKAAAAABAAACEAAAAgAAA AAAAAgAQKhUCAAAAAAAKAQAAAAQAAAAAIAIAAAAAAAAAAAAAAAAABlMXkNQjzONI4gUAPTIZ/aUz MrD0GFAAADzu/wAaZgp+43nNbEbLBEghFcBBQOVKPxvGC/6+zfafosOPX/1deltfKayKnimXd6Zc szMtPS1kDEyrtGkFwQECKmCBFQo5VoRMEKitA5VoRyrQOFaBwqFHKtA4VpRmrQjNUKM1QDNzSjNz QjNzSjNzSjJzSoyc0DJzSjJzSoyc0oyc0qMXNAxc0oyc0qMXNKMXNKjFzSjBzSo/3SfsnyAABFWB zyziFp+Ynr/5e4f5P/bPnfJzunXpw5e+B5HV53zCjzueBi54GLnlHEVUCogHUAEALAgAAAAABAAA ABAIAAAAAEAAUCoB0hB20K2ahBogGrCDdoVohEUIgFAAAAAABSgAAFQIAUAgAgAABAAACAAAEEAA QKEACBQAoEAACCFUIIFAIAAAQAQQABQoBAAAABAAAABCAAAAQAAAAAAAgAAAEAgUABAAACgAABAA AgAAIUAABQIQAAAAAAAALAAAAAAAFA5coHnepuEYqVEUorG4ToEke5rUakDnLSgIAIAYznq1MBv7 7jUQS6lsRjYd3ukmQcsQOQIpUcqoH4/i1I3CzfafoMOPyP8AV16W145cs8Ey9L1MlmJlWqNM2rrB IGCBMECYIEwQJgixFaBzggRWgcK0o5VAOFaBwqFHCoEZqhRwqAZq0ozVpUZq0DJzSjNzSoyc0DNz SjJzSoyc0oyc0Ixc0oyc0oxc0qMnNKMXNKjFzSjBzSoxc0o/3Ifs3xwDlXQOGfVpYh5ptQ1ic/Ke TLOZdIxflNZSbd7nBebIfQOHW2Q6YunzDi08zngZOeUZKqqBEQDpEAsALABAAQAAACAAAAABAIAg AAgAAAAAAKgHSEGjQrZpBqiAaNINmgaIEUAQAAAAAAFFAFQAAABFAIAAEAAQAAAgAABAAgAKhAAg UAAQAAIIVQggUAgACAABAABQABAAAABCAAKAEIAAAAIqFAIAAAAgAAAEAgUAAAgACgAABABAAAAA AABAAEAAAAFgAgAAoAAAAAAIBk9SwMFNI4UqJzqB65MvBSK85iZahsQAAHLnI1quXmQDKU1XKs1/ OvMalGjlMq4KIByqlRyUfleKGxuNm+0/QYeb5M//AC7dHaxZLPnTL0t2sM2rtGktVwQJggMECYIE wRYitA5wQIrQOVaByrQOVaUcKgRwrQM1aUcK0ozVoRmrSjNWgZuaVGbmlGbmgZOaUZuaVGTmgZOa VGTmlGLmlGTmlRi5pRi5pRk5pUYuaVGDmlGLmlH+3z9pM0+MymTWsSKqePqdVuMbfNqbgjYoinCf y6RjT4lVcIx5RSvg26pyt0uyx5tX+gpz62yFxfRfMODTFzgOeVQKjQOoAWACACACAAAQAIUCCAAA ACAAIBQIAAQAAAKiAdIhBYAdoFbMINkQDREINWoFaIGVAAQAAIAAABSgVAAAAACKAQAQABAAAABA AEACAAqACAoECgEAACKhQIIFAIAAgAAQAAUAAQAAAACABCiEAAAAEACFUCAAAQAAACAAqAAAAAAA AABAAAQAAAAAAACAAIBYAAKAAAAAAKQIEAKBw5SowepqEZqUcKVGsmXhLHuEmVh7ESBzUAAIAed3 +NMwU/cbz/pN7IRsvIkDKs1KIBFA4UqIiAfnOI2xuNn+0/QaeX5X+rt0drhrD5sy9bRGksXBAYIU wSCYIDBAmCBMEWJggcq0DlUKjlWgcK0DhWlHCtA4VpRmrQjhWlGatAzVpUZq0ozc0DJzSjNzSoyc 0DJzSjNzSoxc0oyc0qMnNAxc0oyc0qMXNKMXNKjBzSjFzSo/2w9YNVT9j1sqxfHiH52vrlRyoi8h 4qd3wKmuXl5S0Pi1VfCPKWkeLhupytyvPLzat9B5x6/6XF+kVVU87YjQO0QCwAQAAABAAFEAACCA CgAIIAAkAACACACAAABIgVFA7RSDoCoFasUg3aoGrSDVAO0CKAAAQAQQCgAKUCoAAAAARQCACAAA EAAAIAAgAQABAoQFAgUAgAAQQqhBAoBAACBAAhQIAUAACCFAAQAIAAgAAAAEACFUABAgAAAACBQB AABABAAAABQIAACAAAAAAAAAAAAAAAAEALAgAAAAApRk9SjFxUZqURqK5YFHulswWwOcyroKBADK c9Wpgt/fdyIWIJdS2JLbDu90kzYjliByURQOFUqJADpEA/P39sblaPtH0Gnk+X/q79Da5Rp8y3rd 4ICBAgBMEBgixMEBggTBA5VoHKtAitA4VpRwrQOVaBmqFRwrQOFaUZq0ozVoRwrSjNWgZOaVGbml GbmgZOaUZOaVGTmlGTmhGTmlGTmlGLmlRk5pRi5pUYuaUYuaVGDmlH+yq+ckqne6PcP1nXyuafIw h+AuFb+27lOUQ6PgVNbz8paHw6mrc5VRq8pqke7gxrlr70ruddW+i88/yP01i/aI08zawAsAEAEA AAABCAAAAQoEAABAIAAAAKBAIqgcqoHOEAwgKigdooGiKQUDRqhWrVINmqBs1SDRFA6CBUCKgBSD kKRAsQigUoFQAAAAAigEAEAAQAAAgACABAAAKhAAgUAigABBAoBAoAAAQgAAIACgAgAQoACABAIA AAABAABUKAAgBAAAAgUAAACgQgAAAAAAAAAAEgAAAAAAAAAAAAUIKACAAAFAAHLlKjFylHDiozUo 9EiX/aUzMrD0QMqQAQAjlRqK5eZCjGU1XuWa7u/up4CzuRo5SDgogHKgclRUQDtEIr4F9SNytP2j 6DTx/L/1d+htVGnzHqXBCpABggMEBgkEwQGCLEwQOVaBzggcq0o5VoHCtKjhWgcK0o4VoGatKOFa EZq0ozVoGatKjNWlGbmgZuaUZOaVGTmgZOaVGbmlGLmlGTmlRi5pRk5pUYuaUYuaEYuaaGDmlH+q uIK7AlK1OY/UXcvlRFP5pXV/7a8pqIHx5k+ZOWDSjqXTd13KoH2uE2YNfeE//W+g88/yP01i/WwP M2AIAIAAAAghQAAQgAChAAQQAAAAIAIARVA4VQOFcByqgQCwA6RAO0A7RQOkIOmrADRrgrVryDZr yDVr0A0RYhJdFQIAVFIOVCoFIgVFCU6iEUoFQAAABFAIAIAAgAABAAACCAAChUIAECgACACCBQAB CAVQAQQAoEABQAQAIUCAAAgBQIAAACAAUqoAIAAAEAIFAAAAQAIAAAAAAAAAAAAACBQAEAAAAFCC gAgACgACwAARQM3KVGalGTlNIstivcJke1EgkEOaqAAAed/+K/AT9xv7ymo/A2WCJBDIzVYlEKOV A5UqCIB2iEV0iEHwr2kblaftH0Gnj+Z/q79Da6wT5j1mCAwQGCQMEBghUwQGCByqATBFjlWgcKhU cq0DhWlHCtA4VoHCtKjhWgZq0o4VoGatKjNWlGatAzc0qM3NKMnNAyc0qM3NKMnNKMXNCMnNKMnN KMXNKjFzSjFzSoxc0oxc0qP9AcRVbsBeXuH6uIfLl+DdLfOeqrzGkemXTo3uAehJcCD3cMNhcLv9 m+g44fI/TWL9SeZsAAAJACAAIAAAAIQAKAAgCACACAADlVA4VQM1UokIgWBBYAWAHSIBQKQdAUCx CukcB2jyDRs0DeXNIPS1yKgSXRUCUqKQcqFcqFcxAsQKjiDpHBKdFtFKBUABFAIAIAAgAABAAACC AACkVAAECgACACCBQAAIIoAqoQACgQKAABAAhQIAACAAIAAEAABCqACAAAAAIAAAABAAgAAAAAAA AAAAACCBQAAKAACkAIAAoBQAAIoEA5coGalGbjUIy51KPZKZgtj3VMTKw0IoAAzmvwWwT953IhYh JWWxGNh3e6omVhHKEcgRSjhQIiFHaIQdIhBYAfEvKRuVq+0fQaeL5n+r0dDa0wT5j1pgkFwRYYIs MEBgkDBA5VoEwS2IrQOFaLHKtA4VpRyrQOFaVHCtA4VpRwrQM1aVHCtAzVpRmrQM3NKjNzSjNzQM nNKjNzSjJzQMnNKjJzSjFzSjJzSoxc0oyc0qMXNKMXNKjBzSj+33tHTVwe53T9bD5T4bZGD3Co1S WBcAg9PDaQuN3+zfQccPkfprF+mPM2AQAAAgEAAAAEAAAKQQAAAARQOFUDhXFHHKoFRoFgQWACAF gBQKBQLEgRARAsQKFdIBo1VIPVLmQIPS1yKhYlJh0aQMzAioZVm5A04UCRARAqOA7R5B2ixDNKWx SgAAAQAQABAAACAAIIAAEECgEABQCACABAoAIIAKqEAAoECgAgAFAgAAAAgEAACAAAAAIFAAAAAI IUAAAgAAAEAAAAAAAAAABAAAAAVCgQUIAAoBQBAAAUoARQOFKjhxRi5SwjuTLisV5iTKw9UDKrAA BFVGoqrzIBjLRXuWa7/pQso0csCKzKiAcqUQDpEA6RCDqAFgRXxLun/krV9o+gh4/m/6u/x9rbBP lPYYIDBAuCAwSBggTBAmCBFaByrQOVQo4VoHKtCOFaUcK0DlWlHCtAzVpUcK0DhWlGatAzVpUZq0 ozVoGbmlRk5pRm5oGTmlRk5pRk5pRk5pUYuaBk5pUYuaUYuaVGLmlGLmlH9/uNFgoqqh+uh8l+fm SoOKjPBgBzggbcOp/wCRu/2f6Djh8j9NYv0Z5mwABAAACAIAIAAIAgBYAIEEAAAIqgZq4DNVKCIB YEFgAgBYAAAAABYgIgIgVCCwA6RArREIO0QDtFgBq2ZAg3bORecFNEVF5ixKUpUcqhiYWJZOQNOF A5iAiBUUDtHEHaPBTtFiGaUoACgAIAAgAABAAEEAACCBQCAAoQQoEACBQAQQAVUIAACBQAQAIUCA AAAQCAABAAAAChUAAAAAgAAAACAAABQIAAAAAAAAAEAAAAAAIFUAAAAUAQAKAKAADlQOFKjJ6lgc NarnQLKPY1qNSBiVdEUAAYvVZj0lp+6nK5TUfhGvI1IJzIRWarEqOQIpRyARAO0Qg7RALAigHxrq kbnavtH0EPF83/V6Pj7XowT5T1mCAwSC4ItTBAYJBMEoioByrQOVQWOVaVHKtA4VoHKtKOFaBwrQ jhWlHCtA4VpRmrSjhWhGatKM1aBmrSozc0ozc0DJzSoyc0ozc0DFzSoyc0oyc0qMXNKMnNKMXNKj BzSjFzSo/wBKXeUmCvIfrofJfj57IOU0jzKhRxAg04f/ANxu32f6Djh8j9NYv0R5mwCAAAEAAAAA BABABAgQAQAgHKqBm5xRxyqBUaBYEFgAgAAAAAACAAAFRAOkQg0RArpEA6QgsQJhAMIDpHwA1ZOV CD1MmI4WlNDSOXNiZmGolg5IEVwoEAAWIHSKQdI4DtHgp2jkCUotAoAABAAACAAIIAAEECgACBQg hQIAECgAggAKgACAAoAIAEAAAAAghRABAAAAAECgAAAIAAAAAAQABQIoEAAAAAAAAEAAAAAAAAih QAoAgAUAAKAAAoHIHDuQqPO5YqaR6JLIJhLzmZlWxkAEAOJr8BvJ+8vIiFiAlswG8v7y8qqJkHr3 AOCiKBwpRUQDpEIO0QiqBYACD5FzSNztf2j6CHi+d/q9Hx9r04J8l7FwQEALggIEEgAwQOVaBFaU cq0DlWgcK0DlWlHCtCOVaUcK0DhWlHCtA4VpUZq0DhWlGatAzVpUZq0ozVoGbmlRk5oGbmlGTmlR k5pRk5pRi5pUZOaUYuaVGLmgYuaaRi5pR/pW7omAp+wh8h+NqU/aUqPKqFHCoBbAn/kbv9n+g48/ yP01i/RHmbAIAgAAgAAAgAAsCBABAABFA4VQMnOKOYRA6RALAgsAAAAAAkAAEAAALACohBoiAdBS IEwgGEBIgIkFiBUcBqyYqEHslTUdyKCYbGtrLh7YmJhqJYKkArmAEgAAAdRILEDpHAdI4g6RwSnS KilSlAAAAAgACCAABBAoBFAEUKIQAAECgAgigQKAAIFABAAAQAAAEACFEIAAAAABUAAABAAAAAAA AAACCBQIhVAKAAhAAAAAAAAAEAAUUAQUAAAAUoEADkCKUYzHGoRzKZhOj3BMj1okDAoACKqIkV5k AyYmUcsxebmahqfwNHLBCDIoAcqBCjpEIO0QiuoAUgFAg+Tck/8AJ2v/AD/oIeH53+vrg9Hx9r1w PkvXawBZAJZAFkAEAtpACQCpADlUCuVaByrQjlWlHCtA5VoHCtKOFaBwrSo4VoHCtKM1aBmrSo4V oGatKM1aVGTmgZuaUZOaVGTmlGTmgZOaVGTmlGLmlRk5pRi5pRi5pUYuaUf6QuyfsKfsnx346oT9 pTSPKqARUAWJIXK7fZ/oOPP8j9NYv0EDzNkAJAAAAQAQAAAEAEAEABBFA4coGTlKOUSPOB2iAWBA gAAAAAEAAAAABACogHRAiFMIIkQqRARARARAsQKikHSKBox6oB7JU5F5FIPRzl2ss3siZmGoliqQ CkAEAJABAgQAAWIHSKRVRwHaOCU6wglLEIAAAAggAAQQKARQBFCiEAAFQAQAIpVQgAFAgUAEACKA AAABBFKqBAgAAAACBQAAIAAAAAAAAAAQAAEChQAEACAAAAAAAEAAAKKBSAAAAAKAAARQAGb1ghYG HK5xpHqY3BbDumZkdkAABk9Ve5Jac3O5SwNII1IJzIQZOWKlEKIoHPOB0iAdohFdIgFAoAgAfKuH +52v/P8AoIeH53+vrg79Da9kD5L1WsAWQCECBAKkAJAKkAJAKkAIqBXKoFcq0DlWlHCtA5VoRwrS jhWgcK0o4VoRmrSjhWgZq0ozVpUZq0DNzSjJzSozc0DJzSjJzSoyc0oyc0oxc0qMnNKMXNKjFzSj BzSo/wBI3VsWL+g/ZvjRsfjahn7amh5lYBwrQJZEhcrt9n+g48/yP01i+9A8zYAAgACgIAQBACwA QAQIOVA4cpRk5wERvdUDtEAQILAAAgBAAAABIAAEAEABAKESCAAJEBEAAARCrECgdRIEQO2vVFA9 smfHkUg9SKioXajN7I8qGZWJYcyhWicpBcECYIEwQJACQABQgsQKjgOkcQdI4JS4QSliEAAAAQAq ARQBFCiEAAFQAQAIFQAAAgUIAACAAAAgAQqoRAAAAAAqAABAAAAAAAAAACAAAAQKFAgAQAAAAAAA AQAAFAoAAAAoAAACAVAIoHnmOisDcI0ks/tKSZG5kIAUDiY/Ab4V5EQRAS2YKcv7y8qqJkR7u4WB mUAOQKiAdohFdIgFApEAAFA+VXp/5S1/5/0EPD87/WPW536G17oHyHptYAsgAgCyAEgBIBUgBIBb SAW0gC0VAtuYEW3KoVXKtA5VoHCtKOFaBwrQjhWlGatA4VpRmrSozVoGatKM1aVGbmgZOaUZuaVG TmlGTmlGLmhGTmlGLmlRi5pRi5pUYuaUf6PuaRln7adr4mOx+QqG/tqVXmVoHCsAyszYXK6/Z/oO PP8AI/TWL7kDzNkAAAAAAAIAIAWACBByoHDlKMXKARoHSIBYAWBAAgACAAEAEAJACwAkAAACAIAQ gARQIAAAALEKsQEQESCooGjHqgHtkTu4pB60gqF2oxmM7qGViXDVgsArZOUiSsAlmCFtyrSFuVaF TBCpACQAgCIFiBcIgqOA6RwSlwgUsSIoRAoBFChAUCAAIFABBAIFAAEABQgAAIAAACCBUABAAAAB UAAABAAAAAAAAAACAAAgUgACAVAAAAAAAABAAAUCgAAACgAAAIoEABWUx0ELAyY1XuNSj1okEgYF CADm5QMmJlH5Rf3U5GoXYrtywQgxVYmgAigEQDpEIrtEA6IARQAAAB8yuT/yls/z/oIeD5/+setz t0dr6ED5L0WQBZAgQBZACQCpACQCpACQCpAK5gFRUBaKgVyqBbcqgVyrQOFaUcK0DhWlHCtAzVpU cK0DNWlGatCM1aUZuaUZOaVGTmgZOaUZOaVGTmlGTmlRi5pRi5pRk5pUYOaUf6MuLYyj9xO18PF+ TqG/tKFeZUAzVAMLQn/k7r9n+gp5/kfprF9s8zZAABALABABABACwAQAigZOUDJygRGgdogFgAIA ACQAAAJABABABABACAAJAAAIIoEAAAIBAAAKRARARA6RSCooHbXwA90ifyQUg9XIqF2oxmMhyoZW JJb+4pFbFZCgSggQc4JFtMELaKgHCoFRUA5UCAIgXCIOkcB2ikJdoGQABAoQRQAACKFABBAIFAAE ChAAAAIAAEACBUCAAAACoAAACAAAAAAAAAIAAAAAAAIFQAAAAAAAgAAAFAoAAAAoAAACKAAgEVYI FeZyq5TaPRLZgp4TMyNCIAAMnqr3ZNP0uXwFhWkEakE5kIMnLFSjkoASAHSIRXaIB0QUIAAKEAAH zaxP/KWz/P8AoIeD5/8ArHrc7dLa+jA+Q7kAEAEAJAKQAkAtpACQC2kCCQKtuYBbSAW0VAW5VCLa KgW3KoVbcqhFcK0quFaEcK0o4VoGatKM1aEcK0oyc0ozc0DNzSoyc0oyc0qMnNKMnNAyc0qMXNKM XNKjJzSjBzSo/wBF1rYylP3mcfl8LF+UqWftKZaeZWAcKwDy2tsLndfs/wBBTz/I/TWL7MDzNkAE AEAEAEAEALAAQRQM3KUYuUDlEA7RAOoACCQKECABAAABABABACAAIBABBCgAIIBAAAKgRAAUUCAA LECxIGEB2xyoB75E9OZSD18jk8A2owmMVqxQjUNJbopDukSWhpACEAgASBBFaFtyrSLbhWhXKtA5 VCiEFRQNGqBoikRQgBCKARQAAKgAgARQqAAAEChAAAQAAIAECoACAAAACoAAEAAAAAAAAAQAAAAA AAQKgACgQAAAEAAAAoFAAAAFAAAigAAACKBjNd3ELASmR/aUsyPQZQAAcvdgNj3e4ggJbMFIr+8v KqiZEe7uCFhkaAABUQiu0QDpCIoFABAAAgBQPnVaf+Utn+f9BDwfP/1j1udOltfSgfHeggEsgAgF SALSACAVIAtIBUgC0gFSAW3MAtoqBXKoC0gFtyqBbcqgW3KoGrcqgVwrQOFaUcK0IzVpRmrSjNzQ M3NKjJzSjNzQMnNKjJzSjJzSoyc0oxc0oyc0qMHNKMXNKj/RVSkZTj+gdWPy+Bi/LVLf21OTbz4A EVgHht7YXO6f5H0FPP8AI/TWL6sDzNkAEAEAEAEAEAAADhygYuUDiEQOkQDqAAAQAIAAkAEAEAEA EAAEAgACAQAQSBQAEEAKBAAVFAgQCgEAAAAFwoEFbMVFA+pTTYpBTI9KoioJSGMFYpGmyLFIlhmV KAEIAAgEEgBFQi25VoW3CtCuFQCAdIoHaOIOsIFEQlKQAIAABUAEACBUAEEKBFAAEAAABAAgVAgA AAAqAABAAAAAAAAAEAAAAAAIACoBQAEAACAAAAAKBQAAABQAAIpAKAAABw90EEDFqK9xoelEREgh kUiKAKMmplHYa/upyNKO3LBCEMVWKlaQqAFRCK7RAOkQgoRQgAgBQAACkR8+q/3S2/5/0EPB8/8A 1j1udOntfTgfId7IBCAVIAIASAVIAIBUgBIBUgBzALaKgVIBbcwC2ioC3KoFtFQi25VCtW5VAtuV Qi24VpVcK0DNWlHCtAzVpUZq0DJzSjNzSoyc0oyc0qMnNAyc0oxc0qMnNKMXNKjFzSj/AENOSLHf oP6H1n57Ha/OVMv9tTi6PPkwOVYB86ibC6XP/I+gp5/kfprF9I8zZABABABABAAAA5VYAYuUDLnU DtGgdQAEACFEIAABACQAsAEAIBAAEAgAghRCAAgUQgAQKKBAgFQCBAKgAABIgQDpiRUg9kt2ARXs lz0XkUiU1c3CQhEs2vwVgvMFlsixNRLKgAIQCAAIBBFQK4VAsOHIFZqAiAiAwiKqPA0R0QjqJEAA AKgAggECgACBQgAAIAAEACBUABAAACoAAEAAAAAAAAAQAAAAAAgUAgFAAQAAIAFAgAABQKAAAUAA CKQABRQgFRQPO92EsENQNpbMFPCZmRoRAAUZvVXLk0/6l8BYHcEangQgye6KlacFAIqIRXSIB2iE FCKEUAAABFIAADwVKf8AlLb/AJ/0EPB8/wD1j1ub6e19WB8h2sgQSACACAVIASAVIAIBUgBIBbSA LcwC2kAtoqBbcqgLRUC25VAtuVQNW5VAtuVQLblUC25VAtuFaFZq0o4VoGStKM3NKjNzSjJzQMnN KjJzSjJzSoxc0oyc0qMXNKMXNKP9BPSLVQ/o3Vj8PzkPi1Ev9tTzurzqwDhZYHyqdsLrcv8AI+gp 5/kfprF7oHmbIAIAIAAAEAi8gGTlAxXlUDpGgdQAoEgAIIAAASACACACAACKBAIAAgACACCKgEAA QABAqBAKAcgACgQAByAA2YiIhAdMgBy2c5qxFD6dLUJMTBVeUyS3mMwkinOCJcSnwXBUizDc0yAQ gACAQABByoVwqBpmqAcqgEAigSIFa+BFbtdEiOggBFChAAgVABBCgRQABAAAAQQKAQIAAAVAAAgA AAAAAAACAAAAAIAiFQABQAEAEACgQAAAAVAKAAEFKAACkQAFFCAAKymOgkCwOZTIrhKJkegygAKO XuwUj3e4gCW3BSK/vLyqJJR7u4IWGRVAEAOkQDpEIOgihFAAAikACwAAAPDP/wB1tv8An/QPB/0P 9Y9bmsNr60D47raQBZAKQAkAEAJALaQBZALaQBaQC2kAWkAtuVQLaQC2ioFtyqAtyqBbcqgatFQL blUC25VAtuFQLblUDVuVQKzVoVmrSozc0DNzSjJzSoyc0oyc0DJzSoyc0oxc0qMXNKMXNKj+/LzH 9Lzj8Pzb51RL/aU8jtDyqwCZMD4stsLrcv8AI+gef5H6axeuB5mwCQAQAgCAEAzcoGLl7gERANEQ AAgAIIoEgAgAAgACgQAByBAAACAQgKUQgAcgACgQCBUUAAAgEAAQABFAre+QVXd4DNQBR3LmLLci oQfZp5yTWp3zJJMZBcJCLEu5b8JId0Qkw0NIgAgEAAQCCKFcqgVwqEVyqBUVoHKoUcqgRwoHTHwU ivQixIigABBFAgUAAQKEAABAAAgAQKgQAAAqAABAAAAAAAAIAACAAqhECgEAAAAAAQAAAAAAoAgp QAEFAFAIpAAFFCAADlywQKwRFe41sHpRIJAwigChzcpEZtTDdhrzJ+6hVduWCAhiqxUrSBAK6RAO kQg6RAihFApEAACAFABACgeKf/utt/z/AKB8/wD6H+setzWG19aB8d1IAIFCALSALIEVIASACAVI AtIBbSAW0gC3MAtoqBbSAW3KoFtFQFuVQLblUDVuVQLblUC25VAtuVQNW4VAtuVQNW4VoVm5pRm5 pUZOaBk5pRk5pUZOaUZOaVGLmlGLmlRi5pR/eD+mzsfmnmnNip5JdMXnVhGkVngA+Bgwu1x/yf8A tnn+R+msXogeZtAEAIAAkAOXcgGD3AcIgHaIB1AAAIJAoigSBAgAAAAAEUCASAACAQCKBABAUCAA OQAAK5CAUUCAQAoEAgACKAiBAIpAKIQemmnLLchJgfXY5JjYmRk5FluinMFbMcj0ihYZmHRQIBAA EAggEUKkCK5gFRUA5VArlWgZuaBkvIVGsuZ3FJMK9CLEgpEAIFQAAAhFAAEAACABAqAAgAABUAAC AAAAAAAgAAIFAAACAAAAAAIAAAAAAAKAIKAKBAAoAopEAAFCBQABXne7CWCFgay2YKeEkyS0IgEU DN37bsBOZP3lKrvkRPAhBi50VNK5AoVUQDpEIOkCKEUCkQAoAAEUAAAAeOb/ALrbf8/6B8//AKH+ setzWL7ED47ZACQCkAEAWkAEAJAKQBaQCpAFpALaQBaQC25gFtFQLaKgLcqgW0VAtuVQLblUDVuV QLblUC24VAtuVQNW5VAtuFQNW4VAtuFaFZOaUZOaVGTmgZOaUZOaVGTmlGLmlRi5pbH9xP6g/Ms3 pE8ucflqJcYJhu3KsQFvzj0hdrj/AJP/AGzz/I/TeLQ8zYBAIoCABeRAMZjgMERVWKgdogHUAEAA ACEEgBAAAAAAAQCAQABAIBCCKUQAQFAgACKBFAgECgEUABAIBFAARQIAAikAohAjAD2UtUrFRFXk JMD6v7MxsU5lMmx50VZT4dwK9SKipFC2yACAAIAEICkVAIoVAJAK5gRXLkKMHtKMuZQj0ynxQzKt iIAQKAAIFCAAUCAABBAqAAgAABUAACAAAAAAAgAQKACgQQAAAAAAAgAAAAAAAEFiFAigCgQUABQg AAoAIFADOY6CQEK5lMj+0pZkbmUUIAcvdgpyfvLyIVYGNwU8PdUJMuXu7iCGohmVQCogHSIQdIgR QihFIAFAFRSAAAoAIAeOb/utt/z/AKB8/wD6H+setzWL7MD47ZABABACQBZAi2QAkAWkClkCLaQB aQC2kAWkAtpALbmAW0gC0VAtuVQLblUC25VAtuVQNW5VAtuVQLblUDVuFQLblUC24VA1bhUDVuFa FZuaUZOaUZOaVGLmlGTmlRi5pRi5pUf2s/qL8y5U8+e1UgYpXKoRYfmpqf8Alrh/k/8AbPN8j9Om DQ8zo5A5VQCAdQAye6AHnWLlj3AO0QCwAsACoBFAARQIQQAAgAAAIAcqBAAEAigAJACAQABFIIAA gVFCIACoAAgEUCAFAgEAgAAQQohAUCcwH0qKp/sOUzI98xiPb4e4QhjKmKx2A7mCzD0hkAACAQQA QQKgVAIoVFIIoVm5pR53tgVBjsFRI9bXRQyroggAABCKAAIAAEAKgECAAAFQAAIAAAAAAQigQChQ IIAAAAAAAQAAAAAAAAAAiqACKAAoAAEUABQAQAAcudBCqxaivd4C7B6USHIZRQgBFWCRXmQDliK5 cNf+lPAWVl090EIRDBeU00AUg6RAOkQIoRSIoFAAAigAKEAAFgAA8j0/8rbv876B8/8A6H+setyw +1A+M0QAQAQAkApABAFpAFpAKQAkAWkAtpALaQBaQC2kAtuVQFpALblUC2ioFtyqBbcqgW3KoGrc qgW3KoFtwqBq3KoFtwqBq3CoFtwqBqJcK0NWzc0DJzSjJzSjFzSoyc0oxc0qP7If1N+YRTllCoc5 EUyr83VtyV3qEdyawxkxi9/ATBU8/wAiPxEumEinkdXCqBE5QNEQCPWAHkcuE6HcA6RvIB1ACIBY coACKAAigRSCAAAAAAA5AgEAgACKAIOQBQIOQIAUCBUUIgUUCAAIBAIAAgEAgAAQQohAAgFY9WOi gH2aSoSY1GrzmCXc6XH9pvOFiVkzMJMFedAkw2CAAgEEAEECoFQApFQCBXKoBk9pR5nJBSo2lTO4 pJhXpRYmQAAQKEACAABAA5KBAABUAAABAAAAAACEVCgEUKhAAAAAAAAIAAAAAAAAAAAIqgAigAKA AoQAAUIAACrADByq9YIahWzG4KGZSXYQAAcL/iOwf7Kc5V2O1WCERg5YqVsAAdIBUCOkCKRFAoAI oACgAiwAAAAADzMTLXema3l1aXMmP8GGmCiHzP8AoZRUQQ+1A+S0sAJABABAgQAkChAKQIWkAJAL aQBaQC2kAWkAtpALaQBblUC2ioFtyqBbRUC25VAtuVQLblUDVuFQLblUC24VA1blUC24VA1bhUDU S4VA1EuFQLEs3NK0yc0qMnNKMXNCMXNKP69E/qr8uiqYyVzE5SIqmJV8+5UkmtltR7llzZa4Uqa3 95q+JTM/lqIfn3rdpK4GrMqocmUlzEZHwqjkOM/Hj9S6amazbsnKtt+ulmfH4mpvIbd5vKltgn/3 pY8fik5vQsq7IkfZ/wBdLLPxq/aa3y62tudPyLbcJe4mXYTx+LWphKq7q9I+y4Kv/wDezxDx+Jqe hJ91h/tn17PEPH4mpzrN03Z9ezxDx+JqNZukf9s+vZ4iePxNS6zdN2fXs8Q7HFdSOqboi/7Z9ezx DscTUi1V0T+WfXs8Q7HE1ItXdN2fXs8Q7HE1OFrbon8s+vZ4h2OJqcLX3Pdf17PEOxxNTn2jc91/ Xs8Q7HE1HtG5w/2v69niJ2OJqT2lc91/Xs8Q7HE1J7Sue6/r2eIdjial9o3Pdf17PEOxxNQtxuaf yv69niJ2eJqZrdLmn8q+8M8Q7PE1OPa9y3V94Z4h2eJqcreLkn8q+8M8Q7MbzU5W83LdX3hmKOzx Lc+27lun7wzFHZjetot8uW6fvDMUnZ4luFvtxT+U/eGYpezG8twvEFx3T94ZijsxvLTtDcd0feGY pOzG8tF4iuKfyj7wzFHZjeW4XiO4p/KPvDMUdmN5bntLcI/7R95ZijsxvLF4luG6PvLMUnajeW5X ie4bn+8sxR2o3ls3cU3BP5P95Zil7Uby3Pau4bn+8sxCdqN5YvFdw3P95ZiDtRvLc9rLhub7yzEH ajeWna6v3N95ZiDtRvW3K8XV6fyb7yzEJ2o3luF4xr9zfeWYg7Uby0XjGvT+TfeWYg7Uby3PbOu3 L95biDtRvLcrxpXJ/JfvTcQdqN5bjttXbl+9NxB243lnbau3L96biDtxvLcrxvXJ/JfvTcQduN4i 8c125PvTcQdqN457dV25PvTcQduN5adu63cn3pujJ243jnt5W7k+9N0Y7cby3Pb2t3J96box243j lePq3cf3pujHbjeN6T8wqxs5rXWXBRV59aav/wDAk9ON6w/otruNbdaZJ0mg7n7TctL5DhNbEyuG NwnXmghNS1K+X3XJPYn/AKKS4ax/L0UFdcK6XhMt8HJzty0smqITKJh7cG7bv+uljVDGowbtu/66 WTXBqTBu27/rpZNcGohdd3fXSzPcgtyvtXd310snchbcq667u+uljuw05V913d9dLJ3YVysy67t+ uljuwtOVnXXdv18snehdMuVn3RP5b9ewd6F0y5Wpum7fr2E72LWiXK1V03Z9ezxDv4r25cPq7oif 7Z9ezxDv4r25fNqbrdJSKvsmP2hmKajrYpPTl8xeJ7ix0Fs/3lmKdNcM6JfXor5cKpsUtkF72XZ4 jjl1YhqOnMvoJWXRU/2z69niMeRidqU1u6bs+vZ4h5GK9uTXLpuz69niJ5GJ2pTXbpuz69niHk4r 2pTXbpuz69niJ5OJ2pTXrnuz69niHk4r2ZTX7nuz69niHk4nZlNfue7Pr2eInlYnZlPaFz3Z9ezx DysV7Mp7Que7Pr2eIeVidmU9o3Pdf17PEPKxOzJ7Sue6/r2eInlYnZlPaVz3X9ezxDysTsyntO57 r+vZ4h5WJ2ZT2nc91/Xs8Q8vFexJ7Uue6/r2eInl4nZlPalz3X94Z4h5eJ2JPatz3X94Z4h5eJ2J Paty3X94Z4ieXidiU9q3Pdf3hniHl4nYk9rXPdX3hniHmYnYlPatz3X94Z4ieZidiU9rXLdX3hni HmYr2JPa1z3V94Z4h5mJ2JPa1z3V94Z4iebidiT2tc91feGeIebidiT2tc91feGeIebidiT2vct1 feGeInm4njye17lur7wzxDzcV8eT2vct1feGeIebiePJ7XuW6vvDPEPNxPHk9r3LdX3hniJ52J48 p7XuW6vvDPEPOxPHlfa9y3V94Z4iedj6/wDDx5Pa9y3V94Z4h52Pr/w8eT2vct1feGeIedj6/wDF 8eT2tct1feGeIedj6/8ADxpPa1z3V94Z4iefj6/8PHk9rXLdX3hniHn4+v8Aw8aT2tct1feGeIef ju9cjxpPa1y3X94Z4h5+O71yPGlfaty3X94Z4iefju9cjxpPaty3X94Z4h5+O71yPGlUuty3X94Z 4h9hju9cl8aV9qXPdf3hniJ5+O71yTxpX2nc91/Xs8RfPx3euR48qlzue6/r2eIfYY7vXJPHlfaV z3X9ezxD7DHd65J48r7Rue6/r2eIn2GO71yOxK+0bnuv69niH2GO71yTsSvtC57r+vZ4i/YY7vXI 7Err9z3Z9ezxD7DHd65J2ZXX7puv69niJ9hju9cjsya9dN2fXs8Q+wx3euSdmV126bs+vZ4i/YY7 vXI7Ui11zRP9s+vZ4ifYY7vXJOzL59TfbhKdk0teE7/9hniOuPzMZ9f/AIdPHl66Wsur2JMdasGP cy7F/wDQxl/0MfX/AIzl0ph6dbum7Pr2eIz9hju9cnPtyutXTdn17PEPsMd3rkduTWrpuz69niH2 GO71yO3LCfcrox7JEu14U6Z/Zy7EgnfXkNR87HbXrk1j0ZmLbpUXNjf9t5uf/HZ4jP2GO71yY0TL xT7vcmuwUtcf89niNx87Hd65O+Px5ZJdrnur7wzxF87H1/4vjy6S63Nf5V94Z4h52Pr/AMPHl2ly ua/yv69niJ52Pr/w8eWiXC5r/K/r2eInn4+v/GZ6EtErbov8s+vZ4h5+O71yZnpS7Squi/yz69ni J5+O71yZnpy7Spum7Pr2eIefju9cmdEutYum7fr2Dz8d3rkmiTL3Xdv17B9hju9cjS6y113b9ewf YY7vXJNJlrru36+WT7DHd65Gl1lbru365g+wx3euSUqTLru366WPsMd3rklOsO67u+ulj7DHd65I Yd13d9dLH2GO71yDDuu7vrpY+wx3euQYd13d9dLH2GO71yDDuu7vrpY+wx3euQYF3nfstpmU0eRZ j5iPh4URpnP/AKEV+B9GiopdEx0HOmTZi4U2a7ncviPmdTqTnNyr1xMUERQRFBElBEUERQkRQRAc gAKEEBaBbQFoFtAtpAFuYBbRUC25VAtoqBbcqgW3KoFtyqBbcqgatwqBbcqgatwqBbcqgatwqBbc KgaiXCoGolmqBqJcOQKyc0qsXNKjFzSj+oZTwn9WflkWYhjITKIcpVlMno1Ocw1EPG6Y6c6CRgRt syU1qcvOKS2E+CvSW3nXkCvfJhLYjflOmGLnMsqqpSXLVVUxltaxfmJsxaqer1/dbzEaeuRBOQg3 wk5gMldykHOFygVXBUc6JByruQDnC5AM3OSAGSuQg4wkA5wkA5w0iBMNCK6w0A5V6AZOehBirkj+ kDhXoBmr0A4w0IrhXgYq8DNXIByr0iQcueBm54GauAiv8JFZq8DJ7gMleAwyDlXgZueBwrwMleQc K8K4V4HCvAzV0F5yDlX+EDlXgcK8DhXkHKvA4V4GauA4V4Vyr4EH63hLiqba6lkuY5VlqsFRV7hx 6nTtqJ/Uv7TJqaa5UiPaqPlTU5UPPVuU3jL81UNnWSsSbLVVp3rFFM7XoiYyh+npa6XVSmzGLGKc phwzxqW+UEsJlDMqizEMjNZhGocLMI04WYhGocLMQjUM1mEahwswjUOFf4SNQzWZ4SNQzc/k5w0+ dVwc1SwS/MVrMFyqd8ZYl1bq1ZE1EVeQmeNkS/X09U2Y1FRTyzDo3yid8yIsxO+QcrMTvkVzlPCR pMogHKzEIrlZiARZiEHKzEFCZRCDnKIKVMohKEWYgoTKISlTKIKEyiEoTKIQTKClMoShMogoMoSh MohFTKIKDKCgyhKDKEpUyiAMohAyiAMoRTKEDKIKDKIFXKEoMoKDKISgyiEoXKIKUyiCgyhKDKCl XKEodI9BQ6w0FI6R6CkVHoKR1hoSkdI9C0y6R6EpLVHp3y0lukf4SUW6R6d8Jao8UlusPwikeGtr WyWKiL+0vMbwwt0xh4rfIWom5eb+6nNE6ZzUVC5ZU++1yIkE5kODzzLrDFIuGKRnUVTKeUsx36Gp 3VXuIWMblccblnRy3Nwqify1E3ld/wAqdxELlP6hrqZfqErKxGNwWryqMcWulh+3ysOKxXnU609D pHEGrXIQatchGZlu1UI5zLZriOcy1R6CmJlojyUzbpHikt0jxSW6R5KZt0j0FJbpHikt0j074pLX KIKRcogoMoWgygoMoKDKCgygoMoKDKCgygoMoKDKCgygoMoKDKISgygoTKCgyhKDKIKDKIKDDQlC YaCltMMUWmGgpbRXiltyrxS2ivFLblXiltyrxS25V6CltyrxS25V4pbcq4UtuVcGrcq4UtuFcKat wrgtuFcgatwrkFNRLhXIKaiXCuQU1Es1cgpq2blQoycpR++y/hP6s/LOFqU75xyyVw6rRO6c5lqI Y5V0xeXkaSltsx7WJyG4wZmVfUo1qrEmX4IZSXxcs13OvN+gYY2uUvQtQiJznbKahl8O51+UdkWL y939B5nSHmlORqIB6WzYBXazkIOFnAc5UCZYgZbkCuFnAc5bwgcLO8JBi6aBxlgJlgOMtykEWdyg EnARZyEVm6cBk6cBms4DN03wgZrOIOVnAZOmgZrNCuFmkHKzUAzWaBws0DnK8hBms0DhZoGTpnhA 4yxBFmhXCzQMlmgcLNIOFmgcrNAzWaBm6aQcZUCLNA4WaFcLNIOVmgcLNFDhZvKBws0Dl00DjKqi 4SLBU5iUP6PwNxcsh6UVU/8Aw3cnKvN4TzdXp1+Ya/2in9NqcjWyFlv/AGmPSLXf+qHGYv8ALnjl OMvzdNWTrRVrTzVXJKvIvcgZmLej8TD9PLrGzWo5qxRTDz5Y1LvWPCRlFqPCSlhwtR4SU1DNZ/hM 005Wf4SU04Wo8IpYZrUeElNwzWeSmocrUeElNQzWf4SU1DN0/wAJKV5Z02KKWIHxKzlidcWZfFfM WW86Uj9BarlhNRiryocOpg3jL7ralFSMThTQs8lCLPFK5y5KVFnkocrPFFuVn+ElLaLPFDlZ/hJQ 5y4otMuShMv4RSpl/CShMv4RQmX8JKVMv4SUJl/CKDL+EUqZfwkoMv4SUJl/CKDLeElCZbwilMv4 RQZfwkoTLkoMv4RSmW8JKDLCgy/hJQZfwilsyxKLMv4RQuXJQZcUGXJRZlhS2ZYUWuWJRa5clFmX FLapOJRbpJ3hFFukneEUluknCkt0k4UzbpJwpLVJwpLdZYUWuWFM26ScKLdJO8IpLVJ3hFJbKfWt lMVVUsY21jFvjMmPrp/L+4i8p3mNMOky+/Kc2UxGN5kPPP5cMsra5cUw6y/hJSKtQjUVyrBE5VUU PFJmrWTtZf8A+xLWElq91ekbmKinTKdMV+3qn1iSmKqrymYxYwxuXxn1KzXq5VOsY09cfhUmildp N8Iotq2aSmZls2aSnOZbNmkpzmWzZxKYmWiTiUzMuknCmbdJOFJbrLCktUnCkt2k4lJbpJ4pDL+E Uhl/CWgy40hl/CNIuX8I0hly0GXGkMv4RpDL+EaQy/hGkMv4RpDL+EaQy/hGkMuNIZcaRMv4SaQy /hGkMuKDL+EUGX8I0hl/CTSGX8I0qZfwk0hlxpDLjSJlvCKLRZwpbcrOFLaLOFLblZwpbTKkpbcr OFFuVnCmrcrOFLbhZxaW3KzhTVuVmiltws0U1bhZqCltys1BTVuFmimolms0U1EuFm+EU1EuVmp3 xTUS4WZ4RSv1S1fhP6o/Ls3VMe6ccsZtqJRJ7edeUR0zU7SqRDpGMQya2haGTqrDcje4nKpwq5aj 8Q1SrRDvEUy89VcUlSnOjy9w49Sbaxh8aXOV7lmO/edynNt6NYgB0lUQdpVIoVytSBzrIHOskE1k DlalAOVqUiBytSQZOqAM1qIAc6yFcrUgcrUoQTWQJrRBy6piBktSBmtQBmtSKVmtQBytQQZrUAZr UChwtQKHK1BBmtQBwtQgoRagis1qCjhaggzdPQUM1ngc6wShytQKGbp4GazwOVnihwtQShws8K4W eKGazwJlyUOFnihys8UOVnihys8gzWeWhws8lDlZwVws4UO5Na+nmtmMWCtUkxZb+xcIcUsr6ZtN Of8A4rU/ZVf1Hkzw0yZxcW+7dJbK2SsIJOZysX/0OdUnTyr8Pl2u8OlOWmnLBWrBIkyx/btlFv0C VqKnOc6cJgWrFDhatCUrhaslNQ5WrJSuFq0JTUOFqyU1DNaslNQ4WqJTUOFqhTThaslKxfUooot4 p81HIpqEfDq3QVVOuLMvPS1yyZqLEZY2RL9ZS3BHsRYnmyxdIl6daMUrnWhS2i1RKLc60gotzrRK LTWiaVtzrQoTWkJpEWqQaVtFqiaS01oaS01pCaS01pBRaa0TStprSDSWmtDSWmtISizWhpW01omk s1pBpLNaJpLTWhpLNaJpWzWiaSzWhpLNaGktNaJpLXWhpWzWiaSzWhpLNaJpWzWhpLNaQmks1kaV tdZQmks1lBpDWSaSzWRpLXWhpLVKkmkt0lSNK26SpJpS3SVI0pbpKkaUtUqUGlLdJUoXSlqlSTSl ukqRpS1SpGlLdJUjSlutZGlLczK1rGqqrzFjFY/L4s+ufVzkls/dO0YaYdbfYpFZTy0RP3u6pyy/ Ljnnb060Z0udukqhpLVKoaUt451WtVN1Viwlt5Zzk/UbjGot0x/+YuXs1pkpkEgjWpBEMaXO5mXy 6ivWa+Ef2UOkYU9WEVDJKgtN27SoQlJbRKgaUmWraglMTk2bUE0ucy1bUjSxMtUqSaWLdJUjSluk qSaUt0lSg0s261oaS3SVKDSza60g0hrQ0oa0NIa0XSGtDSLrRdIa0NIa0NIa0NIa0NIa0NIa0NIa 0NIa0NIa0NIa0NIa0NIa0NIa0NIa0NIa0TSJrQ0hrQ0hrRNIa0NIa0NKmtE0hrQ0hrQ0ia0hNJaa yNK2i1I0raayg0luVqRpW3K1I0rblakaWrcrUoNK25WpGlbcrUjStuFqBpatytSg0rbhakaWrcLU INK24WoQaWolytR4RpaiU1jwjS1EmX8JNLUS9S3S8fD1wzlD+KP6g/NuVul5+HrhnKH8UBPad5+H rhnKH8UA9p3n4euGcofxQD2nefh64Zyh/FEkRLleU/8A+euEV5/8Sh/FExxpZlfad5+HrhnKH8Ua lHjqaq/T3p/4CuSWnMmUovxJx7ctRI2ovbf/APn67OUP4kduV1LrV8+H6/OUP4knbk1Gs3z4fr85 Q/iR2pNRrV8+H67OUP4kdqTUutXz4fr85Q/iR2pNSLU3z4frs5Q/iR2pNUOVn31f5BXZyi/EjtSa ky993BXZyi/EjtSakWdfdwV2covxJO1JqcrNv24K7OUX4kdqV1QizL8v8grs5RfiR2pNUOVdf9wV ucovxI7UmqHK+31/kFbnKL8SO1JrhzDiDcFbnKL8SOzJrhFZxAv8hrc5RfiR2ZNcOcDiHcNZnaL8 QTsya4TJ8Q7hrM7RfiB2ZNcJkuItw1mdovxA7MmuEWTxFuGsztF+IHZk1w5Wn4iX+Q1mdovxA7Mm uHK0vEa/yGsztF+IHZk1w4Wj4kX+Q1edo/xA7MmuHK0PEq/yKrztH+IJ2ZNcJqHEu4qvO0f4gdmV 1w5W38TL/IqrO0f4gdiTXDhbbxNuKqztH+IHYk1w5W18T7iqs7R/iB2MjXCLauKNxVWdo/xA7GRr hyto4o3FU52j047GRrhytm4pX+RVOdo9OTsZGuEWzcU7iqc9R6cdjI1w5WycVL/I6nO0enHYyNcO VsXFS/yOoz1Jpx2MjXDlbDxXuOoz1Jpx2MjXDleH+LF/kdRnqTTjx8jXDleHeLNyVGepNOOxkdyE 7O8W7kqM9Sacnj5HchyvDfFq/wAkn56k048fI7kOOzPF25J+epNOPHyO5CLwvxduSfnqTTjx8l7k Oey3F+5J+epNOPHyO5CLwrxhuSdnqTTDx8juQ5XhTjBf5JOz1Jph4+R3Icrwlxgv8lnZ6k0w8fI7 kOV4Q4x3LOz1Jph4+R3ITsfxluWdnqXTE8fI7kIvB3GW5ZuepdMPHyO5DleDeMtyzc9S6YeNkdyE XgzjPcs3P0umHjZHchyvBXGa/wAlm5+l0w8bI7kOexPGm5ZufpdMPGyO5CLwRxpuWZn6XTDxsuB3 Ic9huNdzTM/S6YeNlwO5CLwLxruaZn6XTDxsjuQ+hauGOOrZUNnMs82CLGCT6XTGM/iZTH6WOrEP 6FJruIElNSfw/XZVE/awZlEqR/41KHDwM98MznF/h82vkX2ompPp7BWsmf2sKZRIi/JUqI+B1N8O mPWivy9dPUcRy2I2bYK1VTutm0X4kzP/ADupvj1/hMurjL0a5fPh+vzlD+JJ9d1N8ev8M9yEWqvn w/X5yh/Ek+t6m+PX+DuQ5Wpvvw/XZyi/Ej63qb49f4Xuw51i+7grs5RfiSfW9TfHr/C96Ey9+3BX Zyi/Ej6zqb49f4XvQ5WbftwV2covxJPrOpvj1/he/i5WZf8AcFdnKL8SPrOpvj1/he/iiuv+4K3O UX4kn1fU3x6/wvkYuVXiDcFbnKL8SPq+pvx9f4XyceLhW8Qr/Ia3OUX4kfV9TfHr/C+TjxcrL4iX +Q1mdovxA+r6m+PX+DyceLN0jiJ38hrM7RfiB9X1N8ev8Hk48XinW3iWbzWKq/4zaP8AEGo/5nU3 x6/wnk4vC6w8VK6LbHUZ6k05r67qb49f4TyMX0KOi4qp0wZliqlT/lm0f4gxl/y+pP7j1/hqPk4v oI3iLu2GsztF+IOf1PV34/32XyseJgcQ7hrc7RfiCfU9Xfj/AH2PKx4pk+Itw1mdovxA+o6u/H++ y+VjxTJcRbhrM7RfiB9R1d+P99jy8eKZLiLcNZnaL8QPqOrvx/vseXjxTI8RbhrM7RfiCfUdXfj/ AH2PLx4pkOI9w1mdovxA+o6u/H++x5ePFMhxHuGsztF+IH0/V34/32PLx4pq/Ee4azO0X4gn0/V3 4/32Xy8eJq3Ee4azO0X4gfT9Xfj/AH2PLx4pq3Em4azO0X4gfT9Xfj/fY8vDimq8Sbhq87RfiB9P 1d+P99jy8OJqvEm4avO0f4gn03V34/32PLw4mq8Sbhq87R/iB9N1d+P99jy8OKapxJuGrztH+IH0 3W34/wB9jzMOJqnEm4avO0f4gn03W34/32XzMOKapxJuGrztH+IH03W34/32PMw4mp8S7hq87R/i B9L1t+P99jzMOJqfEm4avO0f4gfS9bfj/fY8zDimp8S7hq87R/iCfS9bfj/fY8zDianxLuGrztH+ IH0vW34/32PMw4mp8S7iq87R/iB9L1t+P99l8zDialxLuGrztH+IJ9L1t+P99jzMOJqXEu4avO0f 4gfSdbfj/fY8zDialxLuGrztH+IH0nW34/32PNw4mpcS7hq87R/iCfSdbfj/AH2PNw4mpcS7hq87 R/iB9J1t+P8AfY83DialxLuGrztH+IH0nW34/wB9jzcOJqXEu4avO0f4gfSdbfj/AH2PNw4mpcS7 hq87R/iCfR9bfjzn2XzcOJqXEu4qvO0f4gfR9bfj/fY83DianxLuGrztH+IH0fW34/32PNw4mp8S 7hq87R/iCfR9bfj/AH2PNw4mp8S7hq87R/iB9F1t+P8AfY83DianxJuGrztH+IH0XW34/wB9jzcO K6nxJuGrztH+IH0XW34859l87DianxJuGrztH+IJ9F19+POfY87DiapxJuGrztH+IH0XX34859jz sN0mqcSbhq87R/iB9F19+POfY87DdLrVOJNw1edovxA+h6+/HnPsedhuldW4j3DWZ2i/EE+h6+/H nPsedhxXVuI9w1mdovxA+h6+/HnPsnm4bpXV+I9w1mdovxA+h6+/HnPsnm4cVyHEW4azO0X4gfQ9 ffjzn2PNw4rkeItw1mdovxA+h6+/HnPsnmYcVyXEW4azO0X4gfQ9ffjzn2PMw4rkuItw1mcovxA+ h6+/HnPsnl48VyfEO4azO0X4gfQ9ffjzn2Ty8eK4HEO4a3O0X4kfQ9ffjzn2PLx4mDxDuCtzlF+J H0PX34859k8rHiuDxDuCtztF+JH0PX34859jyseLyVVNxRO/ZZYqtG+GbR/iDeP/AA+tH7x/vs3H zMI3uqSiv9OkXWGsV686pMovxAy/4fXn94859ky+Zj+reyPEG4K3OUX4kx9D19+POfZz8nHisb/u CtzlF+JH0PX34859jycVwr/uCtzlF+JH0PX34859k8jFzMdxErFSVYKzDXmVZtFD/wD2Cx/wetvx 5z7LHyMb/Nuadl+kS8H2BWq5eV7spRcqr9pE/wDC68/vHnPsufyomUnpxHMSDLDWInhm0X4gR/wu tvx/vsuHycI3vKlJxHuGsztF+INfR9bfj/fZ183Di6Sm4jT+Q1mdovxA+j62/H++x5uHF0kjiLcN ZnaL8QPo+tvx/vsnm4cXSSuIU/kNZnaL8QT6Prb8ec+zPmY8WiM4gT+QVucovxI+i62/H++zM/Kx 4u09vp/IK3OUX4kn0XW34859mZ+Ti7R9+T+QVucovxI+i6+/HnPsnkYukmX7cFdnKL8ST6Hr78ec +zPfhcrftwV2covxI+h6+/HnPsd+Fy193BXZyi/Ej6Hr78ec+yd6F1i+/D9dnKL8SPoevvx5z7J3 oXWL7uCuzlD+JH0PX34859juwus334frs5Q/iR9D19+POfZO7BrN9+H67OUP4kfQ9bfjzn2O7BrN 9+H67OUP4kv0XX34859juwazffh+uzlD+JH0XW34859juwazffh+uzlD+JH0XW34/wB9juwazffh +uzlD+JH0XW34859juwazffh+uzlD+JH0XW34/32O7C6zfPh+uzlD+JL9F1t+P8AfY7sGs334frs 5Q/iR9F1t+P99juwazffh+uzlD+JH0XW34/32O7BrN9+H67OUP4kfRdbfj/fY7sGs334frs5Q/iR 9F1t+P8AfY7sGs3z4frs5Q/iR9F1t+P99juwazfPh+uzlD+JH0XW34/32O7BrN8+H67OUP4kfRdb fj/fY7sGs3z4frs5Q/iR9F1t+P8AfY7sGs3z4frs5Q/iR9F1t+P99juwazffh+uzlD+JH0XW34/3 2O7BrN9+H67OUP4kfRdbfj/fY7sGs334frs5Q/iR9F1t+P8AfY7sGs3z4frs5Q/iR9F1t+P99juw azfPh+uzlD+JH0XW34/32O7Cazffh+uzlD+JJ9F1t+POfY7sGs334frs5Q/iR9F1t+P99juwazff h+uzlD+JH0XW34/32O7BrN9+H67OUP4kfRdbfjzn2O7BrN9+H67OUP4kn0PW34859juwazffh+uz lD+JH0PX34859juwazffh+uzlD+JH0PX34859juwazffh+uzlD+JH0PX34859juwazffh+uzlD+J J9D19+POfY7sGs334frs5Q/iR9B19+POfY7sGs334frs5Q/iR9B19+POfZe7Caxffh+uzlF+JH0H X34859juwmXvvw/XZyi/Ej6Dr78ec+x3oTLX3cFdnKL8SPoOvvx5z7L3oTK37cFdnKL8SPoOvvx5 z7L34TKX7cFdnKL8SPoOvvx5z7Hfhzh37cFdnKL8SPoOvvx5z7L5GKYV/wBwVucovxI+g6+/HnPs vkYpG/7grc5RfiR9B19+POfZfJxRfb+4K3OUX4kfQdffjzn2XyceLlU4g3BW5yi/Ej6Dr78ec+y+ VjxcqziDcFbnKL8SPoOvvx5z7L5WPFFl8Q7hrc7RfiR9B19+POfY8vHimS4h3DWZ2i/ED6Dr78ec +zXmY8UyXEO4azO0X4gn0HX34859l83Di6SVxBuCsztF+JH0HX34859l87Di9/a++fBl1zlPjn69 8tO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++fBt1zl PjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++fBt1z lPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++fBt1 zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++fBt 1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++fB t1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++f Bt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa++ fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa+ +fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwHa ++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxwH a++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynxw Ha++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265ynx wHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265yn xwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265y nxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg265 ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg26 5ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg2 65ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffPg 265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44DtffP g265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44Dtff Pg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44Dtf fPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44Dt ffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44D tffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T44 DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T4 4DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5T 44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc5 T44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbdc 5T44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwbd c5T44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnwb dc5T44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvnw bdc5T44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vvn wbdc5T44DtffPg265ynxwHa++fBt1zlPjgO198+DbrnKfHAdr758G3XOU+OA7X3z4Nuucp8cB2vv nwbdc5T44DtffPg265ynxwHa++fBt1zlPjgXtffPg265ynxwMV444T37RZ3yATtvwpv2izvkAnbf hTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnf IA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb 9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AH bfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftF nfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8 Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75 AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTf tFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7 b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os 75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfh TftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfI A7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9 os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHb fhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFn fIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8K b9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75A HbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTft FnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b 8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os7 5AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhT ftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA 7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9o s75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbf hTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnf IA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb 9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AH bfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftF nfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8 Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75 AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIA7b8Kb9os75AHbfhTftFnfIBe2/Cm/aLO+QDpWt6p LzLcUDmCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZ eZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5 luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW 4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbi gIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKA gnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCC dVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1 WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZ eZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5 luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW 4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbi gIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKA gnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCC dVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1 WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZ eZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5 luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW 4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbi gIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKA gnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCC dVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1 WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZ eZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5 luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW4oCCdVl5luKAgnVZeZbigIJ1WXmW 4oCCdVl5luKAgnVZeZbigIJ1WXmW4oBETqsvMtxQPyzrLak/t3D3hVY4HPse19Kv94VWOBPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/AHhVY4D2Ra+l X+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX+8KrHAeyLX0q/3hVY4D2Ra+lX +8KrHAeyLX0q/wB4VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv94VWOA9kWvpV /vCqxwHsi19Kv94VWOA9kWvpV/vCqxwHsi19Kv8AeFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6V f7wqscB7ItfSr/eFVjgPZFr6Vf7wqscB7ItfSr/eFVjgPZFr6Vf7wqscCpZ7V0q/3hVY4Ect57ty t2wTdMBxhXfeNu2CbpgJG7bxt2wTdMAjdt427YJumARu28bdsE3TAePW+IKqpWitNRb6yoZ/7z9S mNlSv/qcs7n8CAfUkcN1sxuFfLnrMxf/AIqOWlNJTwQi9Xfp5AJN4csjeVKb9vp4b8L9YHy6qgr6 VMKz3DIOT/4qqWlTKXwIkWK0DGmu14WelLX1Vvpah3/tuWimOlv/APpck7n8AH043beNu2CbpgEb tvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0w CN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm 6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2 wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt4 27YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu 28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TA I3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2Cb pgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3b BN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23j btgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7 bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMA jdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJu mARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bds E3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beN u2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbt vG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wC N23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6 YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2w TdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt42 7YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu2 8bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI 3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2Cbp gEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bB N0wCN23jbtgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jb tgm6YBG7bxt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7b xt2wTdMAjdt427YJumARu28bdsE3TAI3beNu2CbpgEbtvG3bBN0wCN23jbtgm6YBG7bxt2wTdMAj dt427YJumARu28bdsE3TAeSqr7rIfLp5NZQ1NbOWEmllUExXr4V/xuRPCB76axcRVUJl7uUiRKX/ APEt0jJOT9M1z3/IiAbTOGrKif4khZzunMe5V+ZUA+fU2hshqrbamZRzf7P/AMkuP/MxYR+UD5vt TiGiejLjVUGrqsNbZQvdCPTa2ckP+AH12zLo9qPZcrc5rki1yUMxUVF/zwLG7bxt2wTdMAjdt427 YJumARu28bdsE3TAVHXfeNu2CbpgOXT6lf5JcU/zKPTAcZWfua4Zyj0wEys/c1wzlHpgGVn7muGc o9MB5J82rrKuRaKa31lJUVXLMqJr6dWypKfvP/w5jl8CAftKGjo7TSMo6NmBKYnKq/vOd3XOXuqo GVRVJy8oHzZtTHugfPnzYgfHrmS6iW6VNSLV5u+i99ALablPmLMoZlvrKqfT/uzpT6dEfL7jv8SY 1Y9wD6uVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgG Vn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGc o9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/ c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHp gGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7mu Gco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAy s/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzl HpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7 muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9M Ays/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1w zlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGV n7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco 9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c 1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpg GVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muG co9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys /c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlH pgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7m uGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MA ys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wz lHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn 7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9 MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1 wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgG Vn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGc o9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/ c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHpgGVn7muGco9MAys/c1wzlHp gPNXV86jkLM9jV6zXqkuS1X0q4Ux37qfszVUD9LYbRLtUhaif/iXSpRHVM50FVI/2Gqn9lvg5wPb UVKJHlA+ZOqYx5QPBOnRQD5dS9HIrXIitVIKi8yoB82hrFt1U2iSlqKqlqFXIpJdKTJzFX93/Fc3 kcB9/Kz9zXDOUemAZWfua4Zyj0wDKz9zXDOUemAqTahP5NcM5R6YDB1ysy814oM+wDjX7Pveg2hg DX7Pveg2hgDX7Pveg2hgHr4TWROW4XeXNlz0nzlp5M2UqObkpPJyKnfXnA+7UVPIvKB8qdPVV5wP KsxVAxmKsAPl1LoRA+UtTKpKymq506XIltmJLmTJrka3AfyLFVA/Ta/Z970G0MAa/Z970G0MAa/Z 970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0M Aa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z97 0G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa /Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G 0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z 970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0M Aa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z97 0G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa /Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G 0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z 970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0M Aa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z97 0G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa /Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G 0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z 970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0M Aa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z97 0G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa /Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G 0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z 970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0M Aa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z97 0G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa/Z970G0MAa /Z970G0MA5tj6K48RSkkVdPVybdJWoVJD0mIk164LYw7ycoH6+dUQTnA+TUVCqq8oHidMVQMnqqo B8+pXnA+JXfty3JhI1W/ttcvcVvLED79JdbTUUsmc67UDXzGNc5qz2IqOhypD9IG+v2fe9BtDAGv 2fe9BtDACXCzp/N6DaGAfWe+uTmluzaYoGeUr+g7NpigMpcOg7NpigMpcOg7NpigePhye9tmkJMi k2MzDRUhy5R3cA9s2dHugeRzogcgZzF5APk1TucD4tQ6ZBclFZkUwYJHlincA/oGUuHQdm0xQGUu HQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0x QGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQ dm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQG UuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm 0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUu HQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0x QGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQ dm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQG UuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm 0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUu HQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0x QGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQ dm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQG UuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm 0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUu HQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0x QGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQ dm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQG UuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm 0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUu HQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0x QGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQ dm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQGUuHQdm0xQG UuHQdm0xQGUuHQdm0xQPDbJ05t4uy1CK1ytp8CLcHkwFj3EA+lNqI90DxvfEDMDl3MB82qXkUD40 937QH6awTK/2RTfsOhB0P8NF5MN3gA+nlLh0HZtMUBlLh0HZtMUCpMr+g7NpigeJ1FQJ13b6rHA4 1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwPm217KKbWW5mG1suas6Uk2Y6a5WTeX956qvIB71qI90Ak 1F7oHSzE74HmnTkgvKB8eqnRiB4ZEhlbW09NMR6sV6TH5OY6U7BZyr+0xUUD9hqlD67t9XjgNUof Xdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t 9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8 cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgN UofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD 67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXd vq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9X jgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cB qlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUo fXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67 t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq 8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9Xjg NUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBql D67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofX dvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9 XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8c BqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNU ofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD6 7t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdv q8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9Xj gNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBq lD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUof Xdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t 9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8 cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgNUofXdvq8cBqlD67t9XjgN UofXdvq8cBqlD67t9XjgNUofXdvq8cD5r2yLfd5c6Vlkl1krIuWdUTZ/7bFwk/8AccsIpyAe91R4 QIk5F7oHeUTvgZTJyIgHyqqcnKB8aofFrk5Vwv2URFgqqvJyKgH62jt1FT0smQqVmFLY1roV9UiY UOXkR8OcDfVKH13b6vHAapQ+u7fV44BKShXru31eOBu5Ll3a+3bBN04HELh1637BN04CFw69b9gm 6cBC4det+wTdOB8u60dwesuulVlG+dI5Hy5NJNlumSoxVqLlXJHvcgHiZWMmtSZLdFq/Ki95QOkq od0Dpavk5wPLOqlXugfPmzk53LBAPv2S211Kx1U+ro2TpyQbLnUk2Y5kuMURVyrUivd5APsQuHXr fsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXD r1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwE Lh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN0 4CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9g m6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det +wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcO vW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQ uHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3T gIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2C bpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh163 7BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw6 9b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC 4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdO AhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJ unAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrf sE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr 1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwEL h1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04 CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm 6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+ wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOv W/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQu HXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3Tg IXDr1v2CbpwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2Cb pwELh1637BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637 BN04CFw69b9gm6cBC4det+wTdOAhcOvW/YJunAQuHXrfsE3TgIXDr1v2CbpwELh1637BN04CFw69 b9gm6cDy19FW11M6S6voGvRUfKe2hmtVr28yxSeB8aXVTOWRUOTW5XJORqK1FXvtRVXkX9IGiVMO 6B1rfhAxm1XJzgfPnTsKPLyAeyzW+pqp7a5tRTyqaVyym1FPMnYUxO6mDMZyIB+nhcOvW/YJunAQ uHXrfsE3TgIXDr1v2CbpwKiXDr1v2CbpwOnTKhf5LcU/66PTAcYU/c1w8+j0wDCnbmuHn0emAYU7 c1w8+j0wDCnbmuHn0emA+RX2idOe6oobTXyKl377XPpFlvXwok7kXwoB8abIvVO6FRZ6yW3uzEyL 2J/xZMcBksyYvJgPw+hD9oCy6S9VLoSLPWTG+kXIsYv6FfMaB9u3WWbTubUVlor59SnK1EfSZNi+ BFncq+ED7OFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59H pgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3N cPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MA wp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh5 9HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO 3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9 MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25r h59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgG FO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPP o9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp2 5rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59Hp gGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3Nc PPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAw p25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59 HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3 NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9M Awp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh 59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGF O3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo 9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25 rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59Hpg GFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcP Po9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp 25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59H pgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3N cPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MA wp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh59HpgGFO3NcPPo9MAwp25rh5 9HpgGFO3NcPPo9MAwp25rh59HpgPDX27XkRy2e4yqhn/ALc9r6OKeBf8blQD4E+iv1Pyvs1XMZ05 a07l/SrWzVUDz5ScnJNlTJLujMSC/NECJKuc5yNpbZV1Mf7UtGI1P0q97QPp0dhrXuR9ytVcrE5U kSplJBf/AKlWd+oD9E1JjGoxlluDWtSDWo+jRERP84C4U7c1w8+j0wDCnbmuHn0emAYU7c1w8+j0 wFR0/c1w8+j0wGTrjZl5rxQZ9gHGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtD AGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe 9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAG v2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9B tDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2 fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtD AGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe 9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAG v2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9B tDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2 fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtD AGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe 9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAG v2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9B tDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2 fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtD AGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe 9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAG v2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9B tDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2 fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtD AGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe 9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAG v2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9B tDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2 fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtDAGv2fe9BtD AGv2fe9BtDAGv2fe9BtDAGv2fe9BtDACV9n3vQbQwD6z31yc0t2bTFAzylf0HZtMUBlLh0HZtMUB lLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZ tMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlL h0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtM UBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0 HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUB lLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZ tMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlL h0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtM UBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0 HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUB lLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZ tMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlL h0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtM UBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0 HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUB lLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZ tMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlL h0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtM UBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0 HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUB lLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZ tMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlL h0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtM UBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0 HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUB lLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUBlLh0HZtMUCpMr+g7NpigeJ1FQJ 13b6rHA41Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d 2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31 eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxw GqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1S h9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPr u31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+ rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eO A1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGq UPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9 d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru3 1eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rx wGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1 Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUP ru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2 +rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31e OA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwG qUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh 9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru 31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+r xwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA 1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqU Pru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d 2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31 eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxw GqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1S h9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPr u31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOA1Sh9d2+ rxwGqUPru31eOA1Sh9d2+rxwGqUPru31eOASkoV67t9Xjgf/2Q== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image002.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAQEASABIAAD/2wBDAAICAgICAgICAgIDAgICBAUEAgIEBQYFBQUFBQYHBgYG BgYGBwcICAkICAcKCgsLCgoODg4ODg4ODg4ODg4ODg7/2wBDAQMDAwYFBgsHBwsODAoMDhEQEBAQ EREODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg4ODg7/wAARCAB4ALQDAREA AhEBAxEB/8QAHgAAAgMBAAMBAQAAAAAAAAAABgcEBQgJAQIDCgD/xABGEAABAwIEBAMFBQUECAcA AAABAgMEBREABhIhBxMxQSJRYQgUMkJxFSMzgZEWUqGxwSQ0YnIXJUNTgpLR4SY1Y3OisvH/xAAb AQACAwEBAQAAAAAAAAAAAAADBAECBQYAB//EADoRAAEDAwIDBQcEAQIHAQAAAAEAAgMEESESMQVB URMiMmFxFIGRocHR8AZSseEjQvEVM0NicoKSov/aAAwDAQACEQMRAD8A5/0ijJlSZmlo8hFtR89u mOQlnsAuuDVLp1IlxprvuqTEU4bISsdR54pLNqGV5rbL6TKbUJUjUy1plNdXE2sQPPFGPa0Z2Rrq LSjKeqaUzmik731f0xaXSG91TYkprMZUCWxKCC4tVlcvthDt1RXQUnQ3HbR9700f1/LAC626sG3X 3kU9AjgaQjzcPfENN1N7KimZdSxAkvuxwFqSdPcHbYWxd0ucItPclBnD6EukxarV5LumKVEND5Rj SrX67NSlrEpk0WaJmuQuzjKj92pHiH64RlbpXhlGsePHX40i/wBMLayraAvSRSIk51v3iOlQbN7+ WIEpap0BXqJsCkcsvrSy0PhubDASC5X2RJVc/wBORTWo8B9KS584IsD64WZROJVtQQTUM7M+7GKx K5+3jWbeInrthplGeagyBKGXS11SU4+yr3R9zcrbF/1GNAO0qimD7XoiE81kvsD/AG6P6jFCWuVt K8N5giz1EBYH73/5i2jSqkKzQ6yEahpN8BJVtKE65JQRy2TqUvyw1GVTSltmVxmBAKl+JaviONKj u5yWmFgsi5k93mVZa0NkczY/Xzx10Fw1c/O27kEvsll1bakm6cNA3SpFl1tpdGgRoqWltpZd+JzT 5n64+WGe67VzCozNKkSFTVt6Vts+Edib4IZQFQBDpginuPOIjKS6+fHtj2sv9EXDVbRKfCrfKTKb 91dj25auh1+XrbFH9zZS15RZTC9BdTEnKSpKj905fCRcmHM1C4VuYVOh1FDxKBztr/XEGowqNpnL 7qiplyEBSgllJv53t3xAqMKDTEIazvNaZpjiI5u88OXFR1+LbHqbvyJ1kfZsLir3L2Q4T2VYcKe2 eZo1rZPVXc3w1NWntMLKEeMrxScvQadLVKUEw6dH2KD4T+QxM85cLc15jLKNJzPRJFVRApy0uuqN g2Nv4jY4qyF2m5V3JkJpsNlltM1z3cuC6r9T9MIukPJWsgLOaYRegwotpLbyxzCfLDlITklUkCoa rQ2ZNgjk6LW06bWHltgzKghV0ILnUJmEolttsr/3lyD9fywYVF1Zsan0SSxGhr5T3M1dHLkn+OBS XJV9KgQMyVB6XIiSI+ybi4/rfF3Qi115fKoQIM03W1yXOodb8J/hiWOIUXQLVnqxRC460777FSPD b4h9cOwxsfjYob5CFVUvMMeYlS5Lmh5XbuMGmpC3ZCZPqQ/mxxEpGhtYUO48xhuhGlAqXXWaag1e uLQyNkdR1x0rPCsZ3jUaTHSp5RU0Ce5xIKghdi0ZIlOmbIkp/G/BT3sB2x8tdOF0wKqv2deS0lLC rtBWmUg+FV/yxR8iM1Q3aPJajBmY04lC1EtudjfpgglHJU0qNJy3KYYSUMh0G/3qNuuPCW5U2X1p 1KSH0suhx9o7st23G3xYDO/CNFvhKvPaZsmoQaTTJzyJCnLqdb2UhIPU4Pw0NF3vGFpVT7RgNw4p h07KdacggnMYdCEapJUNx6bWwLXC52yTdUSt3VnQclLdlCqT3HamiGbt+HSm/kBiXTNb3WIMkr5P Ep7tXlvS324Ud95bd+aGRcJA6AqwIljPErMhc8YVQ/CQ4y/Or0lTLadmKaDuo+uKPqie7GmoaQNy 9X2T+HUqrvoq8iH9l0xneEnTZSvLEOqOzFr3ch1U3abbK+zll+W2yGnpi5EM/GtAuR6EdsTTz5Sl komUx4brgaqa3fJDu9h6Y0cncIZsq+TmDlPe7rVdZ6EYIIQoupXMYTEXJmaVdyDvYYrozYL2vCFI q4VcU87SJgbUgnmI7Ej+WGXx9n4gqCXUpLbMtokLjXv8boHX88VwpurNcQBsOqIHpioUEoDrJcZe 5gbU6yTskb/U/QYajaq3QfPo9MqDZmaSw4PgfQbYdjmczCA5gKXVcQ9S4T8t5XvDbX4agNxjTgcH mwSso0hJmirbfky58z7tbhPgxryjFgs6I3yV4lTY4eXpsR54kNUkr9FQy9HKTo0q8jj4v2i6jQh2 dkFh1anYyhDdVu5cXQr8sXE3JeslZWMvS0yH0GOW2Y/gbVbUhSztt26YE+Qx5Cdp7PwVX07M+U4R TT6w+1BnRhoS0ojSR/kJxfVI4amjCs+kAKh5mzS04qPEytAaqlRlWbRIT132v3Owx6CF8p72AiWZ A25yeiPMkcKINEpz9YzTDROzBVvkIPg8gL73xeoqv9DNkm5xedRX89w7MuomDQob7ZJPvRWbNqPx eE9RhN0h3TEcvIoAzVJqNG5WTWIK6fOmu/6wnK/dPkfLDcEtgXlSKbW7yXiqVGk5apX7NZbR75UX 03nzO5J6qUewwOCF8ztbkWSUNH8BAUpWUMnRabV61Wojrq3ObK96fASpzrZIJ/pjXYHynTG34BZx P7ijeN7SHC2XFUwzmWEJDFkEBelN++i9rjADwSpGS0r3aDqquuZqTV4C5NAks1JaxdttCwf49MGg pg09/CE8nklpMpcx2ImZJQhicv8AEa2/mMP9oAbDZDAPNCjNNlTJapIbTFEL43u3033OCl1l5FUH K9UqCmlOge7ui5Uja49cAdUBqnSiqPw+RFBWywEIV+Nyxa59RhaSuJVmxhUdap0yEppEUJEdJ+8Q rv6X7YvDKHbrzm2UIhua4iOlSUhH4unoPTBwbBDIXvPoMeSyWizZBFlEbG2JZKqkJU51ht02mLRE Z08vZLQF7+mNOlOpyXebJHmiVSux+bUB7nT2h8AuCRjZ7dsZ7uSlNBful5XaPCWoNwmOXytuek2/ XGhDKeaXkYEFrydUHFFYKXQr5umGfaQlTTFfpde4aqZbbNGrD8J1lFm2VK1pvY7nVe+Pit11wVe9 Ts40hDLEuG3UESDobcRcm3y39VG38cUcFYK+rGX4cSgqbqKA0hlGp5w/v9VG/wBcK1DrBNUzLuWL KDwsY4pZvnVNpk/YlKWpH2spPhVZXwpHfGrSzvp48882RuIyteQ0ctytC5eyBJyfLdqSaTHmR46Q Iym2wHBb5t974DNVGQWWc2OyLIWbaTUZ0US2VlxStEWO42b8zuenbphUtIRboxqLTlOgVCfBGl9K FK0q3Gw7W3xRrcrxcsuUNbVdhZkztmaN77IutuJfoylPU+mIrHZ0BaVMzSB5qBlrhrmKq5Yq+aKV RnK43IQX5MRg/ftMatKVFPlg9RMYLN5D5eqo1zah9zjp5pLcXPZ94U8VBRqhlfNFQydn+mscmqZb rSCw3L73juL+71Dy1XPlh3gn6lqKJpDwJGHmOXw5eqvWcMbK6/hI+f8AawPxD4T5iyi8iJSmH6qr cSOSgrtbr0GPovC+NQ1GXEBc7xCkmY20d0losjNOW53NhSp9IloPiS2pbSr+qdsdA7sZm5sQuW0T xHndaH4a8cKxIrcGhZyqXMhSFBv7XWnxtXPVVv52xzvFODNawviGenVbdBWl7tMnxW8JuTJFAqEd pwtVKJKbQ+yGnAptxCxcFJSSFX+uODi4k2VvQrelpDGcpr0WdQnGgJDfuS2xZQUNKfoDhOQuVdC+ dRrFOhyWWYrapBd+HQNRN+wGPNYXKLWVBmCNDrTaWo7R5y9nFp7W63+mGaclqG5LKo5McirDsfq1 0dHX88ajKhALV4isTOVaQ4m421d8eLhfC9ZC9Up/McN7KHrhyKSyA5qXGY4aPdHmrhu48JGHI35u oskqaK00DdINzcX7+pxqie6XMSiqYANhsMF1KuhfpdkP8t1hvMlLbh++KCY0jYi56AqHTHzd5/ct kKskw4saoqkIqPKjwUa0sqOpJUfh9fM4TlexnNHjic5Zzz3PrfEmv03JtDkrbpKnNVfnR7EcpPVO rtfAaX/Ke0eMDYef9JuZ3YN0tPePyC0LlrK+WaDSItFokURosQboPVR7k4dNnZWeFdzKM3yUpZZ1 OP2DSB64o+JWBUZrJ1OYUkpiIDrfWRpGonub4r7OFbUpLmW2V3aAuhQ8aSMT2Ci6zjnvgTqkPLoF SepESeoqqkIWLJHc2PQ4q/B7wRopi3ZTYOXqI/S2aXSZiveobAaZ93eKFoSPMoPzHffrgc8Ym8ar BK6I3aklmGm52+z84UybSEVeDCZIbqE2OFuNeTjS/m09cJf8KZGRIw7LZh4sJO64WJ+CQvFHiLmn htkrLebJEnKjFX8LFHRHhpjy3GmranJjZJQq5+ZNr40eFcNh4hOYg1waN83Hu816qmdTM1F1z5rK 1Z4jDjjxApddrlFS1mSqAMVGJFYRZ7lt+FzSkAK8KevW3W+O0h4c7hlM5ofdgzc8lhSOFS8HTZ3T qr+JwFo2dJsdUNtWW5nNCJb8ltTIYP76026fTCUn6qNMO93x5Zuit4GZTjCdzkB3ItZpNAkZ9g5t jw2Q007HCgASL6fGB8PfbHOtn7cOe2PTcrVkhs0Bx+6bdFmxJq0tLDchJF+WrcYE4kLNc1G7TWWo TDamW1fah/AtbXc9vzxUFx9EAqYKMWWirR989u95D/CPpgwegEIPzdJhUGMyp9r7182QP+2G4AXq iX81tuU3z2xyVL7j+uHGqrkuqwuRBS44+Apsf7UdP+2HoQCguKR2ZKu7KDrkZBdbbvZI+a3a+NSG MXQyUuRVmpWzqtDvdH9MaPY6UDtLryWb7jocTqU2X6A8yZL4+SpOiTU6KKU0Na9DanL26pJXe36Y +av4c/mSf4W8ysb+0K4ytwAn+Oo5+zHMqpkKLkegNuLRHbC/kNrFVhtvg0XDwBlBfWF2yYUnhxSo 0RDWXWEUZyMoLYbb8Ldxf4tNr/ni8sN9kNrlRV7MSMnUh+o54VTKPSYKRrrcp5DLareSlEb+mFzr va10UWWSK77cnDaHUn28gUDMXEmqRU6I7dObtB1fMTKdttbuAcOGhezvSERj/uP03UxgyYYC70+6 W1S9uHjrLeUzSOGOT8sA/D9qTnJLg+qGCBj2unA8bnf+LfumRw2e9iA31d9lCje1t7R63Sp2pcNm h8zAhyTb0vqvgftMPJsn/wCUR3DHNGXs+aLWPan4vS2eRmTKWQ8yQXfx2okyRCcWO6RzAtO+Avli P7x6j7FA9mcOh96t6Px5y7Sp7FWmZIqmSW5SrVFBQ3Mh2PdEmLe1rfMgYEWg+BwPlsfgVSxG4T5k 8VeH2ZW6fRcnZip1fzBXyG4lKYcStfi76T/LCHFJXwxagD9k5QxNe/JwFzE9oSmo4h5vTwnjusz3 KLLWqq19CLnmmyS0i1/Cj4AL7nfGz+lS6kiNT+4WDfqjcV0S/wCM7dVEpvsr5syHU8t192Skfs6p xVCuEOOnWm11J6KAHY4frP1D28bmFvj3SkFOyN7SD4dkyK5xXzNlWkLq7uQYucMzUR5ktwFXajSm En7xLwNli4/dUcc3ScDhllDS8sYfkVsT1rmxEsy5DeQaTlzMD9fzvW6GxS6vX3XJMehxSpbMT3hV xFj6jqKWh4b97XxtV7jGBEwnS3HrbmVjskccnc7orm0eo0J1uWwjloI+A7beWE43h2FDiiSjzpL8 yPUqmyWSqwhI6KPrbHpGACwQCVq+HRG5VJjyXGXoilIBDbiSlX6HCQPJQQldmrKsSpLBeslxi/u7 x3/gdjh6GTSgOSsqtKXEaKNQdDffYX9dsaEeULUkZmp0rU4jXymWhd1zGrTBBelDPgRJTS3oVmgr qtG4P1GHw626olZUaO026pxTHLUD+OjpjSimugujUYR54A5TiXUdl74nW3mp0lfq9deiynYdOac1 B0lySL/Ijc/qbDHImzrNCYyMq50qfvzEgn93F990LZYD9ob2zqHkibNyBwap0XPmf4qizW62tV6R SnLG6XXG933k/wC7RsPmPbA5Qxou42HzPp9ynKWCSU4H55/Zcsc4ZlczPVlZn405qnZ7zAd4sWcd MNnvpjRE+BIH0wp2tRLimGlvUeL3u+1lvMhpoP8And53Q7fD7oJqHGCe4g0zLFO9yhNj7pttATt9 Bhin/TAJ1Sm5Qaj9RlvdjFglu9JzjOqLQ5itctVm0Ha6v0vjo2UULGLnXV0jnXKYdLyxn15ehndt Xwm5vhcshUGV5TDy/kniPLnrie6NSFxEBamkqN9ztcadu3fCk0cOm6syR901Go/EjKzB+0qBNjxR s64EF1r89N7fnjBnoGP2ytSCttuoDyMrZiUzUVU96iVlBHKrUPwKS4OjgCNJuD8ySFDzwr/lh7t7 jofz5HCdYGSeS0H7POVeHsR1UCtn7TznKlOS2K5Lc5nvaEDZLaja7ib+JKwFDrv1xY1ms22HTYDy /Mfwq1MTuf55rWdYpsRuO/Ja93dLjayt6Qq5bFug7BO3bCboblBD7LldxEzNUM21bMFBy0wJdMC+ S/PW3sr5VlHQWvjdpKZkNpH7q2okWCJMg5DboTFJp+W6pyKs+dIYUboUruBfp+WFK6rdO4ucEWMt YNPJOt2nVZcmPFzjTV0+NF8DtRT42nF9rkbD1xm6w3ZV0X2TGoPDqJ7/ABKvBeS8qN42CDqSPVPd P5Yp25cLIRFk65lTWiM2iqx1xtrCSPEj/m/64uyAckF0iX1cipkJPIc5gw2xpCC43Wbc2yJaZrtP bSEqPx/TGnCOaHYJTZiocedCdjLKxqSRceZ7nD8EhaUN4SlVTRSoKYSbfdXtbGjq1ZQUDzEAFajt b4sFarIbS5S3BrC0790mw/hhrS8Klwv0O0Cs11NVVPrTy47QXykrQjZSUncX6Wv+e2OBbOb5WloW Xfaq9qKoLVU+EPDOuKgpQOTxEzhHVpdaKhvToix0cKT96sfAPCPEcaDp9LepOw+p8unX0V6WiDzc 7BcyKtmNGXYrNFytTQuoujRFitC+m/dXc+pOIpeHGodrlOFpVFe2nbpjGVdZR9nHihxIL9XqiSgq F2nZAsgeiU9T9BjSk41S0vcj+SwHxSzHU5a24Z+yXRZlNTJnzXUSo61syo3K0nUg6b+Lsq1xjGqe OyE90YRI6Qc0zan7KlJp1ZoMuBDlS6bcGsvt6daEIUFb6ljY+SEEnzGLQ8Tlc0g7qj6doK1bQfZ7 yGwG7Mthrzv/AC7YtEHu8TlD9I5I2ybwXy7Tl1uY7Tua9OknkIccC7NI+HTp2Tfy/XDkVN2gygul 0qg4qwk5GhwJNDy1RqgJxeammfLMXlrDJUxYaFhYUoeO5TZO9ziJKVrVZs5KzLmOjcMK9SoqGY0S RxjmurhN5Vy+2tC3JzaQp1K2X+kdq/jkKsnTvfthSakLt8N6/m58k1DUadkMvcMX6HNEDM1O+zav 4HUTYrhLbpTazjDth4m+xtfsdscfxB0kDsbLrKLRO3O688Ss312kZHkUZ5PvNcl/2aLV2wQl5tXR wj5Vab6h540OFVjZcHl+fJZlXQljsbfn8pQ8OsmyI1GdcmQwW3vwUKHW3ffDNZVAuwhWNk08n8Nn ajmN+ZQViLU47dw6U3Q3frb18sVbOXCyA4LaFKyw3FosSnzGmJbwR/a9vAonr8X8TiexuFUOsllX +Hgp0h+oZTqH2JKdVdTO62FW8032wm+m0eFMiov4ghyZnOoUMGPm6llqIhO9WYTrjr89QFynBYnP AF0N8bXHuoGrNWobrQqGWKky7Jl7Mx0nU2o+Vr+H8sa8Xms14sknUXvdX3U1aPypck6npXVCvRJ8 sPtAKGgWruMaFLSRpPw2wYLyStbWFrWQnw740Y9kFLufEU/4UvcsH4lYYY+y8UtVZPd5r/uzqVMF xRbI9TfGp7aOaWMK7/cZuJX+iLho89TXwc01j/V2UfDqtJdSSuQQeoZTqcP5Dvj5u2w323Pp/Zwt +OMvNguO8Gh1SvVFNHpqVynn1KJLhKlEqVqcffX1KlqOpR7k4f8AaAwdo788h9E5NGB3RsOX3Tx4 d5ZpWSs6MU5ikIzJJfdjU+RUJCbcypP3dWlp3dKER2ElS9jvYYBUyuqIb307mw/aMZ8yVmX0ydV0 ry/To7UZClxnI+hWlLS06f8AlA63xzjY0256vjQnsvynM1sUpS6O+f8Axg+0VqeZZQnwSENi4WG7 eNKRqtuL2sdWmpy8JSR9k6ZWXqbLyu7LoEpieqcw3IpFYbIdbXYpdbWhQPiSq2NsUbWNvuke3Lii CbmCnMZYfzI0EJiJhqloR02DZct+WHpHDRcIDQdVivSkOIgZbpk2qLbhgRW3577ygkIU4nWrUs2t YqwFjhGy7lYgvdhc5uKPtmftxmSfwh4A5KVnnO9bl/ZlGzRIRaK0Y5uuQL7uJbXcjXZAAKlGxtjQ bRd3tZsN5D/Uf91TtM6W7/JaO4acOaLwnpMrMmasz/txxPzMAc75+lKAedd6+6RUqty2GuiUIA8z 6ZdRUh223IdP76lMxtKIq+DnKE7EqkSPR6IlClwqk9ZMtt8G2pNjYDT+vQ22xj10bZWWctOildG6 7VlplmlZip9Yy+9VVTarl511cJ4jWoLb+IDspKh4hjipWPp33t/a6rW2Vvr+fIoOnZhrOXqc6ZFJ 9/ecGmnqj9FEjYFHUY14WskO9lkPBCKvZ94h5hqcLMoqeR36eaYrUqeghSpLnkEm1gBjVqImRW0O v9Ehm+VpnLed/tqEv7TgJpExKiBGKwoqT2O3niGT9VUtXtVXAt0aSENLHQbjEu3VCUD1sR4lPfdl btKHwEagr0sfPFmiyGSsu5u4ctTEqqlLdOWqqpetjkDS3Y9QpI6E98ORyKBIdiklWahmimTZVPrE QVGnspuJf73nsRbDrDZt1IaxxxhLeXWocthblHnJUnfXCWd/oL/1w7Hv3kCSIgIAlVIPrW0vUw8n q0euHwEvZBs0vz3HIURZbNvvpHZOGGWbkqpXq3TKlGbbZjqccbQPxAtIue/UYkva7JUbLor7SNQl 5ozXUXUanKTkFhmA2Ozcqb9++q3noS2j9cfM56nS9sf7s+4YH1Xc8GpbtL1X8IchIgUVmqvs6ahX 1cwX2UllOyfyPXAKyp1u08glZ97rV9FoFGYcgTX6fHL9LDioT5QNTZWPvFI8iodT1x6K/wAVmyJx 5fyxXKk8zWI8hoMAfeUWQnwqH+BxPiQrz6j6Y1KSkMnJJzTaUz05po1Mb+z8wNKyqpfgaW/YMFR6 aJA8F/IK0n0x0ULmhukiyz3tJNwhzJOSqhk+VmddNrKYmTK6gyqZkVSApMCcsqVIXDd1eBh/ZfJt ZKiSLDbBMub7kPYqmMGlVPKvEHJ9fr66DSKHIf8AeZt20BqnSkonpVrWLaQhxTZ9AcLbYv7vVG35 LmXxz9pziFx+zs3k3g1SZUvh3lV5LslTY5fvykL/AL3JcVswym1kBfbxHe1tSbh0bobVBsSMD3dO ZQ4KkxvvGmT7PmXoXC2bVqXSINOzRxjr4vmR+IbRKVDcVqSiRJIu2hR8SiRzHTslJSL4w+ITvxck MG1+foPwBNxAE4GVteNqgRNUyccwVBw6p851AQ0D0HIZ6NpR0Hcj4iTjDfWW2Tgi6oekZcceqoqV fmregkhLcdSrAX6C3bEai7xo8QtslvmlWSEVGNLoT0dl4raaqBj9SFqKW1a07G9lJ/nhLiFNcagn 6Oe12lJ6lQD9s1OXNfK106Q5GhtXNkIQrr9VfyxnxvHZNATNQLSH83VpNecgyV1SkVBdGqtj/aWv w1+jjfwq/n64agek5RdRXM/0qqpapubWUUWotL1RM0Rb8rmeawLFBPrtjYiZfZZ70dqzTWqHHjzZ 7rM/LieWldYbUF7HYq63V9f4YIxvJBKvos9rMjrU5EptyC2AumRr+JQP+1WO3+H9cWuqWVPmCM2E KO6QPiHUYuAoKzZnRhhznJWorQvZbfkMPROKGFmnM2VIM5hmNFZ5KUqut1KylweoPfGjTy2N1YvN rckmK81VhMXS6Y+1WGYu0kquHmfofPGtThtrux/BQpHXOFRU+siCTFdbeZDSvvkPJ0rP59FYYkh1 ZQwjJmowZLaXmpCSlXrhUsLcLy3BXlOZnpUCKwCuVnTMk6VOBNgoNFLKAT5JQk4+SyPtWPef9LAP qvoVK3RSWHNN+ocNectMil1+p0CdIYba1MOEtt8sAXQ2bAHb+OC0NdYd5oIWHWw9CmXlbLeZUzjA Vm331MkpcimTHStLCG/iCtK0leo277Y0oi15wLLMeC3mtEsy+JNNjIFPTlqoIQLIStuWz+uhTpH/ AC43oHaQkXi6Istyq/m2DUG870WjwnI6yww1T5K5jTiCkFXM57LRHWxQpJGHriVL20LI/tKZlpnA aiM1KkViowpEpTooeVIr6VRhJDSuW62y7rVG0n4uUdBTcacLdg6Z2j33TDX2yuetH4t5s4qzGKdm +tu1dmtlDtUY5y2feBGSoNRl6Ljlj/Lthn2Qxvu3l+XUyvAZ6renCSDwv4KcMoKMwVmkQa1mhZn1 ijtrSqRIfdJ0stR7rfU22nwpun174z6uSSd2tt7DA/Nl6ENYLFS8iuyWmZ1E4R8J3KbTfeXZDqpS DAj8x9XM1rL337hsrroO1h0xmTsdM+8j7ny739fNMMcGjuj6LS2Vcl5xdHvebKvT46VDw0WCwVde ut94kn8kDBGcNxdUdUr2zPkiFVeRWHXpMSoQ2EttzYqyy7cHV4ljZaf8KkkYXkBATMT8pBycm0z7 XpsKFFW2gyitCAtelJdf5zlk3sLq3/h0wnPUEsKbjYA5If8AaGM/mDOvuS7st1aUlje4ISrSf4g4 zKaE9m2/Ratb4/cP4Q9U64+4lTSzyQL6U40Iokm5BqpQcUvmKJB7nGm0JNwRpkOsKnL+yGJn2fTE rulJ8TEhwH4XEXHg8ym18HkxvulXNWmaU5CpjojyqezRpUoAJkoA5D+2wbd7/wCU2I8sAVFWZpcW hl3UNLJHxYuHKpCyvm6chchXKVdKhunGlCLIQSNrk91xb0OB/ewLrd7IB88aETeZUFKWW4uKXY05 XKkSElTQYGp7w9VKXaxxpMF9kEqIZtPnCLDlxPfY8oaRJWkW1AbhXcHFtJbkLyoJmTaBIeK0LcaS BYISoW2+uDsrpAF4xgrZfB7NyqrSMqc1vnzqbMqCHXEi6EmSAQU+oucfK+M0PZ1MnQhvyXa0FTqp B1utY1DiLlpqBPqEF56tpo76GZ8eEjmuNqXsCU7G1/DfzwjSUbw4NOL9cJWqeCCQiCmZxqTZolSp 2XpE16sQ3Vs08rQypO7ahzFO2Cdj9cbUDAL52WNIfJMKBmLizUQkMig5VYO51a57w/O7Tf8AA414 qiMYyfkk3MKzLxd9qDhrw+ZrlKqPEeu8Uc8Nq5ZydTJrkKEXiN0uuwG2QkJ6K8aj2tfG/RcMmlzY NZ1P9pOadrfMrD0ThzmjipmqpVirUlqn1N9j3+bliO843FprLo/srTz0hbjipD4uoIUrVbxKtcY1 pahkcdm+Hrzd/QSjWuLr8/4UDInBrNlb4gV3L+X6WaWKW+xHlvvueBhTrRcQVBJUpSV6SbjbGXX8 TiZEDvfp6/RNwQucV0l4P/ZnD6qUzLfEXJreSZ9QcDcjOiQh2LNWfmFR0ixV+47pI6C+OVdEJ3iz 9TOnMf8Ar9QtG5YNs/ytqO5FzN9pyqtlXOdKpNKn6FRqO7Sg+pICQLmU3JZcXq679O2NZtAy12JI 1JvZytkU7O0BlxUiqUmcpsX18l5HT05iz/HAHtfGite1yhViRWEsRGWac3Ijcm8x3UdQc8kgXP64 RqGXamYsFZszNnQZMy3nfPmYKHJoQydAdeZDxSUrkqSptpDah8Xjta3mMZrKMuNhzwtFr72C5U5O qOa3YH7Tj3x+oVBb6pkMOApUFKCkr5XmSSbjf642ZIYm/wCLFhbP9o75HOdqKOoGdmJB0VeWlEpx zShZSW0A9C0NRv4SOp+mAvoSPCPzqhmRWT7y57pisOFMVP8AfJAP/wAEnzPfEsbpF+aC5FlLdcjo 5TSUo5YHLCU9vTFHC6G5aoyXV265Qvs2qtpfDaRqQ7ulSfpgXol3CyDM4SJtA5iKe8up04j/AMqe Vdxsd+W4fiHorf1weNodvhCcs05krUapPe7UlRXOX/eQrbkDzWO3oO+NKNlt9lAS8nw0QI+iMTqU bvOK3UsnqScNRvuVBCAaiw3LQ41JaC0r7/8AcYea+yHZBUiHNoqlvxkKnU9IBLe2oHp6frhoESYO CqbKNCWy+wHfc3IxUTqZF7A+l8ekFjursKL/AGbeIMV6qzaGHw2lx5uQykHcOIBBSCbdb2xz/wCr eFltpfctDgFYHMMa6rZah5fp8dqdRafHipmp1urQNzzDrVf/AIt8fOHSPcbOOy6AtA2RZUHoqUsy Q6kSWbuNxx8SwB4wB16YeglI3WfNGDsuaPtT+1Jmhc5zhdkSVJpKpG2YBGIMosrGza3EElorHyDx W+Ijpj6Z+neEMLPaJduV9v79VzVbO7Voas+cN8h1mVVadVPs289LracswHk6/wC023deTuNCPjUP 6nD9TxVkeN+vp0+ip7GXDoum2R8s0/L9cyxkaXPkyswVZuTVVJ0aveXEW96lylj5t/m2A8KemOLm qZqlrngYvb06AJ1kTYyAVpSgZBodE4vpq0yM5JGc6LGcTJsW0+806RoOnpe7EkdfLExQh0Qa/kT8 /wDZS9/eu1MiuIXTM9QMuVSmtN5Ur7KV5eqarPNSJbN1SIElCk2Sot+NrsqxHUWwOfhQadbTt+bq 8dVfBTYZy4KS2zJylJNGZdPjoygXIvrpRf7sf5Db0xoay2zmpO4OHL71XNtPppy/T62lcaoZhmtw okVoc4uuqClWRp30hKSpRPwp3OCPqNYtb1UCG1yCpNQTHfQ8ph5DvKKkrKSDYjqFeRwjP5I8JPNc Z/bv44x6zVIHBfLEgzoNGfRLz260oBKpI/BjFXTwX1q9bYb4XS/9U46fU/RaGq3v/hJXK1VdpsCK zVqaafGCUqanNnnNpSroHdI1II8yLeuF5acHwm5+HwTBkznCNatAjVhMWGlKH3bpeXMb0qCW/wB4 n5tXYd8LQPLMqz8qtg5fmicpuRKV9kMEGjwIx5CGx/6tjqWrve+n0w0ZxpwO9zvn4dEsW5TcpbKI pbU9ayxa+EHOuosmdQqsinv6flWLBPT9MBZuqPGEFZ5zC7Le+yqaQ9U3AVuqPwsI/fWR/Ad8acAs LnZK2uUm5+XkoaUpt9yPPO5qI/EUrzV2I9MNNmV9KX06e9CV7vWbNg7NVFP4SvIK7oP129cPxtB8 KC5DsxdrggJv8w6YYCoqJ95KdY1WPli4ClAUqtpEhxEWLJmtNnSX27abjqAT1th5tPjJAQjJ0CQ8 SpqyrUI+YqIFsOxXAqQwDsR3xrzU4qGGN/NZNLUdk/U1dWeD/GibnLJlNZym0xNrYebQ/HeVZKGi fvFf8OPkHFODeyzntMD8su4p63tWd1emdavmGnprdPyZV3J+Z3lrbruf5AJRTm3txGit/O9b4dtu pwzQmM2dKLN5N/dbmegQJonbN369EueHHsyuxnPtKcl2MxOVzZkt0h2oSFK3U4Sf3jjQ4l+pe0wO X/yEKnotH5lbi4c8LaPl9C6oiOgzXEcqnoO/u0frp/8AcWfEtX5dBjlZax0ht8fM/myedHzVzl+m NyeM1YmoVYUWixYGvyTIfXJfA/zBtCfzxuQydnAAOZJ+ix5BqkT/AM2VlllvLdcf8Joc9AUvyalD kL/+wP5YcgeJMc0F405TVrVPgZjpj9LqI5kV4hSVDwrbcQdSHEK6pUg7g4O5yqArLLtSk+5x6TLe bXLZu2JnQOoR8wT526jFIpbjSvPj5r1rGU4LlV/aloIkViHAdhUtEpRLDKXiFOKSE7pU5pSFKG+k Wx6WPSCvRyXwufXtg+2NSOEVFlcOuHbkaRxNrqNVQksp+6hlwaVyF+ajbwDr54a4fw41GThnPzPR EL9PquPuSmpGZMzRkTZDkuTKdVJqcp06lurJ1KWtR6k74064dmzHomoH5WwtHunIjRUBdRnXTGZ7 AJHiWrySgdf0xzF9WTsE5eykR8qy6Q0XKFUQ3Ic8UyE8P7M84eqihO7R8tGw8jjxqw/xj7j7+9VL Oilxqs05JMB5hVNrgTqjQ39krAIBW24m4WkX+vmMedEQNQyPzfoqg5sUZx3JSYaA8+FOkjmKSP5X wDmqmy95tXfWWoFPCHKqtNy4o3Sw2Tbmr+vRI7n0xdkY3OyHdehpyoDSWmXFvuSNSpkhe7riz8yj 3/kMF7W6HZDUoPKQoJJ5aDuk/wDXBA5TZLauICgrmWWhy4UlXT6Y1YClnpQz4s6nFTtKc5sbq5S3 DtYf7pZ+H6Hb6Y0mOa7xfH7oaEPtpvMZdbilxiAz4ZSj4XHD3SnyT5q79sOdj2OTv/CG1+vbZfYq QzZplIbbR8CE9BimSrkgL//Z ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master32.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"
Click to edit Master title style
Click to edit Master text styles
Second level
Third level
Fourth level
Fifth level
‹#›
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master32.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master32_image003.jpg Content-Transfer-Encoding: base64 Content-Type: image/jpeg /9j/4AAQSkZJRgABAgAAZABkAAD/7AARRHVja3kAAQAEAAAAQQAA/+4ADkFkb2JlAGTAAAAAAf/b AIQABQQEBAQEBQQEBQcFBAUHCQYFBQYJCggICQgICg0KCwsLCwoNDAwMDQwMDA8PEREPDxcWFhYX GRkZGRkZGRkZGQEGBgYKCQoTDQ0TFhEOERYZGRkZGRkZGRkZGRkZGRkZGRkZGRkZGRkZGRkZGRkZ GRkZGRkZGRkZGRkZGRkZGRkZ/8AAEQgEsAZAAwERAAIRAQMRAf/EALoAAQEBAQEBAQEBAQAAAAAA AAABAgMEBQYIBwkBAQEBAQEBAQEAAAAAAAAAAAABAgMEBQYHEAABAgQACQkFBAYIAgcIAQUAAQIR AwQFIRLSE5PTFJRVMUFRUpJUZAYWYeEVlVaR0SLUcaEyolNjgUJiI0NERQex4sEzg6MkJRfwcoLC 4zSERsOytDUmNhEBAAIBAwIGAgIDAQEAAwAAAAERAhIDE1FhITGR0RQVoQRBUvCBIgUycWIj/9oA DAMBAAIRAxEAPwD/AGw+U7AHeWmAzKsTMDiwjpKaqJFeckyrpEyLEC4QGEC4QLhAYQLhAY0OYBjA aR6ChrGQgsUAqBQIRQBjIgGc4iFoRZqCgzyCgz7RQmfQUNpOaKFzzOkUGeYKDPMFFqk1nSKGke1e clC4zekCxTpARAAUKAAAAAAAAQIAAAHGZLVcKFiR53NVDQ5OapUclihRAgAAsQpECRAgAAAAsQEQ EQIAAAWICICICICIRIhSIQiAiBYhTGAkQJECxAYwDGAuMAxgKj0AuOgoVHoBpHoQbR6AXGQC4yED GQouMQWICIEiUIoAiBYkFRQKAUAgFAFUIACACACBUIECBQgAgBYAIAIAIAAEAAAAAAAAAAClAABQ AAAAAoAIBVAAAAAAAgBYBAAAAAAAABAokAoAIAAAEQAVUAACIhVAIECCFUAERCqgAIgUCIFQAEQK gRAoEQCAAIFQIgUCIFAiKBAIBCK01IqSR6ESCQMKwrcZ8V5ENX4DqZFQCgXCAw9IFwgIqBYqBUWI GiBBAGKnQUXFQBioQIIUZUDKqUYVxRmKhEioEipQiQIlFiAiQIlCJAiBYgMYC4y9IVcdekUNZx3S ShUmv6RQ0k54oaSe7oFCpP6UJRbSTmii2kmNUUrWMi85BQAAAAAgRFY1eVCjCyWqLHJ1MilscH0y pyFtKcXSnN5jVjKoqBEAAAIFAAAAAAAAAAAAAAAAAIAAAAABABVAAAAAAAAAAgRUC4ygXHUDWcAq TALjkFxwLjAMYBjAXGAuMBpHAXGA0ikFiBSqEFCAAAUAAAAAAAAAAAAAAAKAAQAQKEAEAKAAAAAF ABAKoAAAAAUIAAAUAAAAAAAAAAAAIAAIVQAQAiACqgAiAEKoBCIhVABEQqoACIFAiBUCIFAIEQKB ECoEFCoERQIAAgVAiBQIhFd5bYJHnMTKtkBP1AaQCgVAKQCikAoAANoQUKoQAoVlVKjkqlGFUoyE AAACFUILAIAAAABAAAAACixILEBECxCrEDSKQVFXpA0j1QUOiTCUNo9FIrQAAAAAAJCIGHS0Uto8 8yR0IaiR5nS1Qto5qkCiBAAFQAAAAAAAAAAAAAAAACAAAAAAAIVQAAAAAAAAAAhAAAALFQGMBrGA uMBYgWIFiBYkFxgKjgNI4DSOA0jgLECxIKAKAAAAAoCACACACACACAFAAAAAAAAACgAAoAIBVAAA AFCAAKAAAAAAAoAAAKAAAAIIAAAAgBCqAAIRAAVUAERCqAQiIVQAREKqBACBUCIFAiBUCAVAARAq BECgRAqBECgRFAgG2N51MTKuyGVTlwAaQCoBQKhBSikAClAiilRWgaIqhAAFYepYRwVTQgQAAAAA AAAAAKVQAACAUCAEAAUiqEALEKsQixCrEg0igbR6oBtJnSShtHIpBoKAAEAIAVIgcnyUdyFtHlmS FQ1Eo87mKhqxgIAAIFAAAAAAAAAAAAAAAAQAAAAAABABVAAAAAAAAAACEAAAABACxUC4wVcYCxAs QLECxAuMBpHEFRwGkcBpHAaRwFiBQAFCqEAAAAAAAAAAAAAsAEAEChAAAAAUAAAAUIBQAAAAAKAg AgACKAAAAAACAIFUAAAAEIAAIhVABBAgVUAERCqAQiIVQCEQKqBECgECIFAiBUCIFAiKFQIKBAIo EAKBAqBECu5yVYgVEA0AQgpRSClFIBRSKoQUA0o0hFUIBRQOD1NQjmVAAAAAAAAAFUAACKAAAAAA AAAAQCgAAVQigIhWkUg0jgNI4DaPUg0kwUNI5FINAAAACK1FA4TJCLyFiR45klUNxKOKoqFECAAK gAAAAAAAAAAAAAAAIAAAAAAAgAqgAAAAAAAAAAAhAAAAAQAAALEKqOA1jAWIFiBYgWIFRwGkcQaR wGkcBpHAXGAqKBYgUAAAAALAAAAAUAAAAAAAoAAAFCAUAAAAFAQABFAAAoAAAAAAAAAAAgBABVAA EIAQAhVAIRAqoAIiFUAhEQqgEIgVUCIFAiBUCIFAiKFQAEQKgRAoEZCgRAqBBQOxyaVP1gaQCgVC AUaIBRSClVSIACg0DaEUCAGXOghR51WKmhAgAAAAAAABSqEFCAAAAAAAoAAAAAQAAAAVQARQoBYh FxgrSOINI4DaP9pBtH9IG4xIAAABlzEdylHnmU6LyFiR45klzTUSjkVAAFQAAAAAAAAAAAAAAAAC AAAAAAAIVQAAAAAAAAAAAAIQAAAIAAAAABYgXGCqjgLjAWIFiBqIFxgKjgNI4g0jwNI4DSOAuMBY gUCxAAAKAAAAEAEALABAoAAAAAAAAAKAAoQCgAAAAAAAAAAAAAAAAAABEAFUAAQiAEKoBCIFVABE QqoECCFUCIFQAEQKgRAoEQKgRAoERQqBBQqBEUCARQAVAjtA5NNAVAKBSAUaICFFIKVVIgAKKiQI rQAIw56IWhxc6JqhkIAAJEAVQgoQAAUKAUIAAAAKAAAAABYAIAIAIAIAQABQARQpEChAAFVFA2jy DaPA6I8g0iopBQAADLmNdyoWx45tNzoaiR5HMc1cKGrRkIAQKAAAAAAAAAAAAAAAAgAAAAAACACq AAAAAAAAAAAABCAAABAAAAAAAACxUCo4KqOA1jAWIFiBYgaRwFRwGkeBpHEGkcBrGAqKBqIACgAK AAAAAAAAKAAABQEAARQoAAAAEALAAEAAAAAAAAACBVQAQAAAIgAqgEIARCqAQiBVQAREKqBAKgAi IVUCIFAiBUCIFAiKFQAEZCgRAqBECgRAqBHdDk0oFQCgUgqFFICFFIKVVIiYVKNIkCChUVyIEc3T DVDkrolEiEQC4QACACACBQgoDCQMIFiAiBYgIgAKACgAABQgAAAAAAAAAAAAAABYhVCAUAsQNI5U INo8DojyDaKikFAAAOT5LX/pLY8c2mVuFDUSlPMqKmBTSIBAoAAAAAAAAAAAAAAACAAAAAAAIAKo AAAAAAAAAAAAAAQQAACAAAAAAAAABEC4wGkcFVHAaiBYgWIFRQNI4Co4DaPA0jyDSOA0jgLECxAo AAAAFFgAgAgBQAAAAAAAAFABAAFUAAAAAAACAAAQAACqgAgBEAFUAhACIVQCEQKqBEIBVQIgUAhE CqgRAqBECgRAqBECgRAqBECgRAqBECgR2Q5NKBUAoFIKhVUiKhQIH6CiwIKFFeiFpHNZnQWhhXKp RIOXmA0kp68xLGkkOFjSSF6RYuY9pLFzHtFi5hOkWUZj2iyjMe0WUmzr0lspMw4WM5l/QLEWW5OY tjOKvQoRIAIAIAMICICIFiFAKEAAAAAAAAAAAAAAAAACxCrEABQAFRVQg2jwOrZhKHRFRSKAAgqI vKB55tM1+FDUSPDMkuYvIaiUciogUAAAAAAAAAAAAAAABAAAAAAAACFUAAAAAAAAAAAAAAAEEAAA gAAAAAAAAAAALFQKjgrSOAuMBYgaiBYgXGA0jgNI8DSPA0jwNI4g0jgLECgCixApAAFAAAAAAKAC AVQAAAAAAAAAAAAAAAECAACFUIAAIhVAIQAiFUAhEQqgRAoEQghVCIhVQIgUCIFQIgUCIFQIigQA oEAigQCKACuyHJVAoFApBUKKQIlF/SQIohVFcEZ/EoFzaryrAWKkpvPhFjaManMQaAoVQgFVAARQ oBQgFAKACEE6AqKxq8wsZWQxeYtowtMnMosYWncnJhLYwsp6cqCxnFgUSACAQARCrEIAAAFCgAAA AAAAECAAABQpECgALECopBtrwOzZhKG0VF5AqwIIVGXMa5IKgHknUvO01ElPG5itWCoaRgAAAAAA AAAAAAAAAAABAAAAAAAEAFUAAAAAAAAAAAAAAAAQgACgEAoECAAAAAAAAAiBcYDSOCtYwFRwFRQN RAsQKjgNI4DSPA0jwNo8DSOAuMgGogUAAAAUIBQAAAoAAAAAIAUIAAAACACqACABAAQAhVABACIV QCEAIhVCIhVQAREKqBECgEIiFUCIFQIgUCIFRQiBQIgVAiBUCIFAiBXZDkqgUCgUgpVCIsUQoYQK iAWCEFQKoRQqhAChVCAVQARQoBQgRQooQApFCigAgRQArGryoUYWQxeYWjmtP0KWxhZD05olsc1Y qcqFExQJAIAAAFCgAAAAAAAAABAgAAAWIFiFAKBUcqAbbMVCDs2Yi8pKHSKKQIFVIAc5klj05MIt HgnUzmLFOQ3EpTzqkCiAAAAAAAAAAAAAAAAAQAAAAAAAAhVAAAAAAAAAAAAAAAAAAAAAAAAAAgBI BAAAIAAAAKLECo4K0jiDSOAqOA1ECxAqKBpHAVHAbR4GkeBpHgaRwGsYCxAAUABQAAAAABFAAAAA KAAgAAAQAVQgAQAECqgAiAEKoBCIhVAIREKoEQKBEIIVQiIVUCIFAiBUCIFQIgUCIFQIgUCIFQIg V2Q5KoFAoFIH6Si4V9gFQCkFQKoQCqEUKoQAoVQgFUAEUKAUIEUKKEAqkAooQIoBQBUAKRQCQReV AMrKYvMWxzWn6FLaObpL05olsc1YqATFKJAIBQAAAAAAAAAAAQIAAAACxAsQoBUcqAdWzFQlDs2Y i8pKHQggVFaipBUKPLOpUdhaWJSnhfKcxcKGrRzKAAAAAAAAAAAAsAJAAAAAAAQAAAAEKAUAAAAA AAAAAAAAAAAAAAAAApEAAUKACBAgUSAQgAgBAAFCkQNIoFRxBpHAaRQLECxAsQNRAqOA0jgNI8DS PA0jwNI4C4wFiBYgIgAKAiAiEUAFAAAAAABAAAAgAqhBAARCqACIgAqoAIiFUCIBAoREKqBECgRA qBECgRFCoERQoEQKgRFAgBQIBFCoERQrshyVQKBQH6MKgVE+0DRBUAAUKoQCqEUKoQAoVQgFVAAR QoBQgRQooRSKFFABAiqACBRSKAAECigAgRUVrV5UKMLIavJgFjk6QvNhLaOay1TlSBbGFapRIASA AAAgAAAAAAABAgAAAAAVYhFiFaRyoB1ZNVCUOzXo79JBsgAc3y2vTChbHhnUqtwt5DUSjyK1W8po QAAAAAAAAAA0AgAgAgBIAIAIASAAAAAAAgBAACBVAAAAAAAAAAAAAAAAAiKAABQopEAqgAEAEAJA BACQKEAEAAQCtIpBUUCo4DSOA1ECxAsQLECxA0jgKjgNI4C44FxwLjgXHAuMBcYC4wDGQCxQBEBE CxARARARARABACgQqgAggAIhVCAEQqgEIiFUAhEQqgRAqBBQqAQiBVQIgVAiBRQiBUUIgUCMhQIg VFCIFFCOqHJpQL/wAcvJyAa5CCoVVIioAAoVQgFUIoVQgBUCgRQqoACKFEAoQIqlACkAooQIoBQB UUigAClAIBQgoAAAAkEXlKMLKYvsFjm6QvNhLaOTpaoWxhWqnMBmBQgoEAAIAAAAAAAgQAAAAUAR CLEK0j4Ad2TuZcJKHdFRUihkUCKiLygeedTNfhTlNRI8EyS5i8hq0cSgAAAAAAABpANwIEAECiQA kAEAJABABACQAQAQAQAkAAAAAAAAAAIkApAoQAQAQAAIACIoAAFABRSIoUAAUIBQCwAQAkAEAGKB IAIAIACi4QLEgsQLjAaiBYgWIFiBYgIgXGAuMBcYBjAXGAuMBcYBjAXHAuMAxgLjAMYC4wGsYCxA RAAUABAAQAFVABEQAVUAERCqERCqgRCAVUIiFUIiFVAiBUCIFAiBUCIFAiBUCIFQIgUCOqHJpf0g ESPL9gGgKQVCqpEEAoFCqEAqhFCqACKgUCKFAKEUKAUIBVApAKKACBFUAVFIoAAoAqBFUAAAACgA AoQAkEXlCsOlNX2C0cnSF5sJbHJZaoUYVpRmAAIAQKAAAACBAAAAAQqgQiQaRwHRkxUXAopXoZNR 2BcCmaHUgAYfLa9IKhbHinUqphQ1EjxuYrVNIyAAAAAACoB0RQNQIEAEAJACQAQAQKJABACQAQAk AEAAACAIAIAIAIAIAQAAAAAAAAAAAABQApEUKACikQCgFCKFAACACACACAEgAgAgAgBYAIAUCxAs ShEgsQLECxARAsQESixARARAsQLEBECxILEBEo1EC4xBcYC4wFiBYgIhFiFQoACAEAIVQCERCqAQ iIVQiIVUCIFAiBUCIFAiBUCIFQIgUCIFQIgUCIFQI6ROTSonOoGkAoFIKhVUiCAUChVCAVQihVAB FCgRQoBQgFUCkAooRSKFFCBFAKAKikUAIBSoEVQAAAAApUAAAAAChAKiKiLyoBzdKReQWOLpKoas clYqcqAZVpRAIAAAAAECAAAAAhVAgAiBpHQIO8ucqYFwoSlehrkckUUg0QQDjNp2uwpymokeGZIV q8hq0cVYqFGYAIAIAQABpqwA6osSCgWAEgAAASACAEgAgBIAIFEgAgAgBIAIASACAAAAAAAAEAAI AIAIAIFCBACAAKoAAUUiAUAoRQoAQChAKAUBABABACQAQAAUoERQoUWBAgAgBYACikAIFVQARQAV YgWJBQBRYgWJEIlVYgXGILjFFxgLEgRARCESqAAIAIiFUAhEQqgRAqBECgEUCARQARFCoEQKgRAo ERQqBEUKBECoEdUOTSgVAKBSAVWiIIBQAVoIBVQCgEAoQCqEUKAUIoUApBUKAFIKUAgRVAFRSKAA KVAiqAAAAKECgAIoAAAAAAAAAAZVjVLY4ukdBbRxdLVOVCjmrSjIAAAAgQAAAAAAFQqAEAqKB0a9 UWKLAlK9MuejsDsCkodiABlzEdyoB5306cxbHndIVC2jGaUthmlFjDpSixyVFTlKIBpHQA6I4g1E CxAAAACAEgAgAgBIAIAIASACBRIAIASACACAEgAAQAQAkAEAEAEAEAAAAAAAIAWAAAAAoAIoUAIB QAACoBQgFAAABABABAAAKLECkACgUoERQpAoQIiwKpABABAAECCxKqxARAoAIAWIUiBYgIgXGCLE KRAsSIAQqgAiIBCqERCqgQUKgEIiFUUIgVFCIBFCgRFCoBFCIFFAgRFCoEdUOTSgVAKBSKAaCAFA BVQCgVAKAAoQCqBQAFAoFAEFKKQAKVAigFCKFAAFKBBQAAABSoACKAAAAAAAAAAAoAAAEVqLygcn yEXkLaPO6WqcqFsc1aUZAAAIEAAAAAABUKARIAANI4g7S5ytwLhQkwr1tcjkihBQAGVaigYWWgsT EQowrEA882SiliUeNzVasFNCAANI5UAqPA0j0INI4DUQAAABQEAJABABACQAkAEAEAJAoQAkAEAE AJABABABAABAAAAAAAAKAgAgAgBQAAABQgFAAFAoQCgAAUUiAVQAEAAAKAKKRAKsQKAiBYlACgUi JAKQKEAEAARSAFIlFiAIgAKAFiAiAiFWIQiFWIQiFQAECCFVAgFQCEQKqBECooRAqKEAIoVAIoRA ooRAIoEA6nJpQKgVQioRQIoVQigAKgVQihQIoVQgFVAKAAoFApAKKBSAhRQgRVQAVFIoAApUCKoA ABQgUCKAAAAAAAFAAAAAAAAAAAKiLygcXyUXkLaPO+WreVC2OStgUQABAgAAAAAEChQCAEAIsAOs uYrVin2EpXsZMR6YOXoMq2ACOcx6NA861CGqHNahBQw6eilpHne5HKUYAAAAACxUCo9QNI8DSPIN YwFiBYgMACAFgBIAIASACAEgAgAgBIAIFCAEgAgAgBIAAAAABIAUAAAAAACACAFgAAAAAACoEUKA AAAAUUiAAChQAAKAFIgFAKUCIoUKKRFKqkQKoBYASACAAgBAKFAAAAoACAUBEBEBEBEBEBEAEAIF AiEEKoEQKgRAooRAqKEQKgQCooRAqKEQDqcmlAIFaCCBVIioFUIqAAKFUIBVCKFUABQKBUAAVAKQ UoEFAFFAEFAoAABSgQUAAAoAqBFAAAAAAFFAAAAAAAAAAAEAAACoi8oHB8hFwtLaPM6WqcqFsc1S BQAgQAAAqACgAABACQARgB0Y9UWKcpFe2XMR6e0yNhXlq0VG4yFhJfNVym0ZioAAAAAAAAAAAAAL jKBpHgaR4GkcQaRwFiBQAAAAgBIAIASACACAEgAgUIASACACAEAAIAIAIAAAAAAAoAAAgAgAgAgB QAAAAAAAAAooAiAVQAFCAUApQIihQoAUiBVUABSAUUiAAAAKqAAAAAAAAAAQIAEKEQpEBEBEBEBE IBUCIFAiAQKBECooRAoEQKgRAqKEQK6HJWkAAUCoFUiKgVQggVQihVCAVQKBQAFCKFUCgAKQVCik AooQIoBQKAAAUCgAAAClQIoAAAAKAAFQAAAAAAAAAAAAKQAAQABHNRyQVAPPMkLyt5C2jzOaqGhk CBACFUAAAAAAEAJAByAdGPVFRUIr3S3o9I8/OZkJjMdqtXnCvjzWKx6ovMdIZcwAAAAAAAAAAAAA AAABFQKjlA2jwNI8DSOINRAsQAAKBAAAgBIAIAIASACBRIAAAABACQAQAQAQAsAAAAAAAAAAAAAA AAAAAAACikRQoAAoAClAiKFCikQCgFKAAiKAAFUAoAiAAAAKqAABEAAEARKoAAgAIAIhUiAiEIgI gAIACoEQKBEUCBQIgVAiBUUIgV0OSqgFApBSqpEUKoQCqEArQACoBQKEVAoEUKoRQqgCClFIBRQg RVAFRSKAUABQABAKEAoAAAAKACBQAAAAAAAAAAAAAAAAApAABAMPlNf+kWPJMkq39HSatHFUgUAi AQqgAAAABAAAAnIB3kzMVSTCvcixSKGB46yTjNx2phTlNYyS+YbQAAAAAAAAAAAAAAAAAAAIAWKh VR6gbSYBpHkGkcBYgWIFAAIAIASAABACQAQAQAkChABABABACQAQAAAAAAAgBYAIAIAIAIAQAAAA AAFCAVQKEAqgAihQCwAAAKACKAABQAAAFAABQBEAAACFUAACIhVAAECAAghVAARAAVAAQiAiBIhQ CBECgRAIFFCIFRQiBXQ5KqAUCoRVKikAKoRQKFAKgFAoFAoRQqgAKBQKQCigUgIUUAQUClAgAUAB QABAKAAAAAFABAoAABFUAAAAAAAABABUAAAAAABSAEVEXAoHnmSI4W/YWJR5XMVqmhgIAQqgQAAA AAAAAIsFA9kiZH8KmZV6FRFSC8ikHyKqSsp69VeQ3Eo85QAAAAAAAAAAAAAAAAAAAIAAACIFRyoF aR4G0eBpHkGkcBYgWIAAAAQAQAkAACACAEgUIAIAIAAAAAAAAAAAAAAigQAAAAUCgAKAAoFAAIAU ABYAUAAAAAAAAUAAAAAAAAAAAAAAABEQqgECBBCqAAiAAqAAiBQCBAAFQAEAIFQIgUCIoEA6HJpQ qhFQKoRSKBFCqEVAoBUAoFCKFUIqBVAAUCgUgFFApAQopAAoRQoAApRSAAApUCKAAAFABAoACKoA AAAAAAAAAAAAAACFQAAAAAKQA5vlNemHl6RY8cySrV/6TUSjkVEAhQAAAAAAAAAVjlapB9CU9Ht9 plUnykmsVOfmESPjParHKinRGQAAAAAAAAAAAAAAAAAAAAAgAAAAACKgaR6hW0mAaR4GkcQaxgLE ABQAACAIAIAIAIASAAAAAAIFCACACAEgAAAZAAAAFAoAAgFAoFAAUABQEAKAAAWAAIAAAABAogUA AAAAAAAAAAAiAACFVAgQQqgRAAVAAQAgVAgBAoEAIFQAEIhUAgQCoEdDk0oFABVIilVSIoVQioFA KgFA0AAoFAoFQABQKQUoEFKKAIAFKikUAqFAgoAAgFAAAAFABAoACKoAAAAAAAAAUAAAAAAAAAAC BAAAAARWoqQUK8s2nhhbyGolHlVFTlKiAQoAAAAAAAAAOsmYrHEmFe9FRUinIZV4q2nxkzjUw85r GUl800gAAAAAAAAAAAAAAAAAAAAAEAAAAAAAAEQKjlCtI8DaPA0jwNI4g1EABQACAAAAAAAAEAQA QKIAAEEKIAAkALAABQACAFAAaAAUABQKAAAWAACgAAAAAAAQAEAAAogUAAAAAiAEAFUAgQIIVQCB ECgQAgUCIBAoACIBAoEQKBEABUCAHRDk0AaQKBFIKVVIgFaCKgUA0EArQBAKBQKBUAAVAKQUoEFK KECKoAqKRQCgAKAAoAAAAAUAVACkUAAAAAAAKAAAAAAAAAAAAAAAAAEQAAAAcJshHYW8pYkeNzFa sFNDARCgAAAAAAAAA9VPN/qryGZhXqVEVILyKRXyquQsp8U/ZXkNxLMvKUAAAAAAAAAAAAAAAAAA AAAAgAAAAAAAAAAALFQKj1Cto8DaPA0jiDUQLECxAAAACAEgAgAgAAARSiEEKAAAAAAAKAAAUCgU ABQKAAoACgAACACACAAIQKoAAAQgBAAAKqAAAAgBEAFUAgQIIVQIhBCqBACBUCAVAAQAgVAgBAoE RQqBACBXRDkqgVAqhFQiqVFQiqgFCKFUChFCqBUAAUCgUCgAKBUApAKKECKqAUoEAClRSKAEAoAA AAAUIFFIoAAAAAAClAIAAAAAACgACAAAAAAAAAAECAADEyU16e0o8MyU5imrHIIgAoAAAAAAAIsF iB75E1HtxV5UMTCtzZaTGK1f6BEj402U6U9WqdIlHMAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAA AAAIqBpHhW0eBtHgaRxBpHAWIFiAAAAAACKBFKIBAAAAAAQAoACgUABQAFgBQAFgBQAAABQAAAAA kQhEKAQBEAEIhUKAAAAIARAESqAQAECCFUCIQQqgQIIVUCIFAARAqBACBQIgECgRFABXQ5KoFCqE ArQRSKqAUIoFCqEVAqgVAAFCKFUCgAKBQKQCigCCgUAAKKQUAAQCgAAACgCoEVQAAAAAAUqAAAAA AAAAAAAAAAVAAAAAAAAAACBEcxHpBQPDOkqxYpyGokcCoAQoAAAAAAA0x6sVFQg+jLej2xTl5zMq 41UhJrIp+0hYkfIc1UVUXlQ2iAAAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAAAARUK0jwNo8DS PA2jgKjiDUQLEAAAgGQAAAAKAAgFACgUABQAFQCgAKBQAABEBEBEBECRARARARAgAABIgIgIlABE IBQCAAgAAAAIFAARAAVAARAoEQCBQAEQKgQUCBQIgVAgBAoB0OSqgFAqBRANBFIKgVQKEUKoFQCg UIBWggFUCgUABQKAQCkAClFIAFQoEFAAUoEAABUAFQIqgAAAABQBUAAAAAChAAFQChAKAQAAAAAK gAAAAAAAACKiOSChHinSFbhTkNRI83sUqAEKAAAAAAAOsmarHewkwr6CKjkinIpgeGtpo/3rE/Sh vGSXzlNIgAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAIUIhVRxBpHAbR4GkeBpHAaxgLEgg CAFgUSAAAAAAALACkAooACwApAKKQAKUAAEAQUBBQLigMVQGIoFxFAYigTEAYoEgBIASACBQAgQA ACAAAAQqgAAEQgFVAARAAVAgBAoEQAFQIihQIgECgRFCgECOpyaVAAGkCqgFApEVAqgUIqBVAqAU ChFCqEAqgUCkAooFAoAgAUqKRQClAgoACgAAACgCopFAAAABQBUAAUIAAAAAAAAAAAAAABUAAAAB AoAAAAAACKkUgvIB5J8iH4m8hqJR5OTApUQoAAAAAAAAeqnnQXFdyKZmFexURUguFFIr5NXTrKdj N/YU3EszDyFAAAAAAAAAAAAAAAAAAAAAAAAABAAAAAAAAAAAAAAEAFUARA0ikGkcBtFUDoiAagQU AAAAAIUUgAABRUQAQVCikAoAXCBYKBcRQNJLUDSSlINJJAuaQDWbQBiIAxEKGIgDFAYqARWoBnFQ CYgGVYBlWgRWgZVoEgBIFACBAghVAAAAEQAQQqgQAgUAgQCoACIFQAEQKBEUCBQIgUAgR1OTQgFA 0BUCqBSIqBVAoRQqgUCgUIoVQgFUCgUABSClFAEFQAVFIoBSikAAgFAAAAFCAVQAAABQBUABFAAA AAAAAAAAAAAAAAAAAFQAAAAVAAAAAAcoHjnyP6zeQ1Eo8nJgUqIUAAAAAAAVFhhA9tPOxkxV5eYz MK7TGNmNVruRSK+NPkukvVq8nMp0iWXEAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAAABAB VAKikHVqgdmqBtCAAgBIAAAAAAgUWAAAQUopBYKBUYqgdGylUDokkDaS0QDWKiAWCAAJEBEBECAA AACKUCCKUQCASAEVAM4oEVoGFQCKgEgUSARAAECgAIhAAhVAgQQqgECIFAARAqBACBQIgVAgBAoE QDohyaVANAUCoFUCkRQqoBQioFUChFCqEVAqgAKBQKBQBBSigCCoUUgACikFAAEKKQAAFQAVFIoA AAAKECgRQAAAAAAAAAAAAAAAAAAAAAAAAFQAAAqQAAAADlA8c+R/WbyGolHk5MClRCgAAAAAAK01 ytWKER9CVMSY32pymZaZqJCTmQ/rJyKIlHx3sVjla5MKHRGAAAAAAAAAAAAAAAAAAAAAAAAAAABA AAAAAAAAAAAAAACACq0iwIOrXAdUcQbAAAAAAAAAWACAGkYqgbSUqgdWyOkDokpqAaRrUAuBAGMB lXATGAmMAxgGMAxgGMAxgEQEQEQEQEShECACCFEAgEUCKgGVQDMAJAokAJACBECgRCAVUABEIBVQ IEEKoEAIFQIAQKBECoEFAgVAgQdTm0qAUCgVAqgUiKBUAoFQKoFCKgVQioFUABQKgFAoFIBRQgRV QopAAFFIKAApQIAACgCopFAAACgCoEUAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAQABUgAAAOUDx1Ei H4m8hqJR5OTApUQoAAAAAACukqYstyKhJH0WOR7YoZV5qumSa3Han40/WWJSYfKVFRYLym2WQoAA AAAAAAAAAAAAAAAAAAAAAAAAAIAAAAAAAAAAAAAAAQDSKFdWuA6o4g2igVAKAAQAqIoGklqoHRJK gdEkoB0SW1CKuBAIrkCIryjOMoEioABABABACQAQAAQAAKEQEQEQEQLEBEBECAIgQABAIBAIoGVA ypRIAQIgVAgFQAEQKAQIKFQAEQAFQIKBAoEQKgQUCBUCChXU5KqAUCgUCoFUg0EVAoBUAoGgCAUC gUCoBQCAUCoBSAUUAQUopAAIUUgoACgAAAClRSKAAAAChAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAoBAABAoAVI4FA8VRIh+JvIaiUeX2KVEKAAAAAAUiu0mast3sEwPe1yOSKchgeSqpEmIr2JB3Q aiSny3NVqwXAqG0ZAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAAAEAqLAK7NcB1RSDaA aRIgbRiqB0bJVQOrZKJykV0RGoAVyIBlXgTGVQiQVQGKpRcUguKAxSquKEMUBigIASADFAmKBMUC QAkAJAokABAKJEBEBEBEBEBEABAEQIBFAigZKIBAIEQKgEAERCqBEAgUABECgECIFAiAQKBEUAFQ IBXU5KqAVAqhFAqEVSjREVAoBoABoAgFAoFAqAUABQKgFAAUAQUopAAqFAgoAopAAAVABUUigAAB QBUCKAAAAAAAAAAAAAAACigAIAAoACAAAAAQAAAAAKAQAAArKoipBeQDwz5KsWKchqJR5yohQAAA AACgd5M5WL7CTCvc1yPSKGB5qqlSamM3A81Ej5Lmq1Va5IKhtGQAAAAAAAAAAAAAAAAAAAAAAAAA AAAAQAAAAAAAAAAAAAAAqKFd2RUD0slqpB6WSIcpFdka1oEVyIBMZV5AJBygXEA1ioBYIAgAgAAA AAQAAAAVCgESAEgBIASAEVAMqgEgUSAEAECJQiBIgIgAAADIAIgVkoERkqoBAgFQIgUCIQQqgQAg VAgBAoEQKgAIgUAgRArsclUCoFUI0BUIqlFIioFUChFCqBUAAUCgVAKBQAFAoBAKQCihFIoUUCkA AhRSAAAqAAKAAAAKVAigAAAAAAAAABQBQIECgAAAAAAAAAAAAACAAAAAQAAAAVAABlzUckFA+dOl KxxuJHIIhQAAAAACgdpU1WL7CTCvex6PSKGBwqaVs5IpgeaiR8iZLcxytckFQ2jAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAIAAAAAAAAAAAAAArUioV9CmkRwqSZHva1rUwGVRX9BRIOdygaRiIBcACKAI oAigCICICICICICIEiAiEIgIgCqAAgAAgVAiQAkAMqgEVAMwKIBAAEAgAAAAAQCAQoEGSgREKqER CqBECooEABEABUCIFAIEQKBBQIFQIEEKrsclUCoBQrQRUIqoUUiKFUChFQKoFAAaCAVQKBQAFAoB AKQUoBFIoUUCkAooAgAAKVFIoAAAUIBQAAAAAAAABQAFAFAgAAAAAAAAQoAAAAAAAAAAEAAABAAA CgEYmS0mNgvLzCJHzpktWOWJuBzCIUAAAAAAoHWVNVikmFe9j0ekU/pQyOVRTNnN6H8yiJHx5kt0 tytckFOiMAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAAAAAAAAAHqppKvciklX1WojGwMqzFXLg KNo1EAiv5kAzFy84EwgMICKgIgWIGogIgIgIgIgIgIgSIRYgSJQARAsQEQAVAgAAyBIARUAyqFGQ IBkAAAkQEQAEiBAAEKIQQoBEIIVUUAERQqAAiBUCAECgRFCoACIFAIEAqBHY5NKBUAoVoIpBSqoR SClVSCoBQKEUKoQCqBQKAAoFAoAgpRSAAKKQUAUUgAAKgAqKRQAAAoQCgAAAAAAAFAoAAAAAAAAA AAAAAAABCgAAAAAAAAAAAAACACABzmS0mJBeXmUsSj50yWrFVFNwMBEKAAAAAAUDrLmqxSTCveyY kxIpy86GVc59O2c3D+1zKIlHyJsp0pytchuJRyKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIAAAAAA AAAOsmWr3IFfXky0lt9plWli5YJyAbREahBhVV36CiogCACAEgBIAQCAVALECxABAABApEBECRKh EBEBEBECxAsQAACARQIBlQMqhRFQDKgQCKAAkQIAABECoACIVUIgVUCIFQIgUCIQCqgRAoBAgFQI AQKAQIgUCOxyaUDSBVQChFAqEVSopBSqpBUAoFCKFUIBVAoFAAUCgUIBVQCkAAUUgoAopAAAVCgQ UAAAoAAAAAAAAABQKAAAAAAAAAAAAAAAAAAAAAAAhQAAAAAAAAAAAACAc5spJie3mESPnPYrFgpt GAiFAAAAAAqhHSXMVi8pKV75cxJie3oMzCpOkNnNgvLzKIkfHnSHSXKipg6TcSy4lAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAACAAAAAAaYxXLBAr61NIRjcZeUzMq7KquWCEG8DEAxhcsVA0iAWAEKAEI IUQDIACxAoAAAABEAhVAgBAqBFiAiBYgVHAWIAKgQUDKgQDKlGVAigRQIBkAAAgEAAQoEEUogAiI VUIiFUCIACoEQKBEAgUCIFAIEAqAAjshyaUDQFQKoFCKhFUopEUqqQUIoVQioFUABoABQKBQAFCA VQKQCioAIKAQopAAAUoEFAAAKVAigAAAAAAKBQAAAAAAAAAAAAAAAAAAAAAAAAAAkCgAAAAAAAAA AAAHGdJSYkU/aLEj5zmqxYKaRkIhQAAAAUIKVHRj1YpFe6VNR6e0zMKs2U2a3Fcn6FESPkVFM6S7 kwcym4ll5ygAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABAAAArWq5YIB9OlpoJjOQzMtPWq/wBVCCoi MT2gTC5YryAaRAAAABIFACKBFAyoEAAALEAEAAVCgREKoBAgAAgUiEIgaRQNAACgRQMgQDKgZUoy oEAgAAAAgEAKUQggRCqgECAECgRAqAAiBQIgVAARAoEQCBQIAd0OTSgUCoFVAKEVCKqFFIioFUCh FCqEVAqgVAKAQCgUCgAKAAoFIBRUApAKAFIAAooRSKAAKAAAAAAAAAoFAAAAAAAAAAAAAAAAAAAA AAAAAAAAAFEgAAAAAAAAAAAAHnnyUemMnKWJR89UVqwU0iAQqgQAAAqkFKjTHq1SK90qcj0gvKZm FdHy2zG4rkihB8ippXSlimFvSdIll5SgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABACoiuWCAfRpaX +s5CTLT2qv8AVaZFREYkV5QJhcsV5ANAUCAAAACFAgyUQDIAIBQAAAAAiBQogQAAAAEAAEA6IAAK BlQIoGVAyoEUoyoEIBRAAAABAIBAIEQKilECIFAIEAqBECgRAIFAiKFAIEAIFAiKFehDkqgUCgVA qhGiCoVVCBFUo0QEAoFQCgVAKAQCgVAKAApBSgEUihRSCgCigCABSgQUAAApUCKAAAAABQKAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAEUoAAAAAAAAAIB5aiRH8Tf6SxKPEqQWCmkQCFUCAUAAUgpUa a5WqRXtlTkckHfaZmB2c1rkg5IooV8yqo1bF7MLTUSlPCqKmBTSIAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAqNVywQD6NLS8jnGZlXsVf6rSDSIjEivKBMLlioG0QCgQAFQIAAIoACFGVAigQIAAoAABEC hQAgQAAAAEAAEA6IAAgVFCIBlQIoGVAilGQBAKAEAAAIBAIBFAyEQqoACIoVAgBAoEQKgAIgUAgR AoEAIFehDkqoBQKBUCqBoIqEVSikRSqpBUAAUIoVQKBUAAUCgEAoFAoAABSCgCikAABSgQUAAKKA IAAAAAAaAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAJAoAAAAAAAgHiqJEPxJyGolHkKgBCq AAAACkRSqrXK1cBB65M/mXkJMD1YHJ0opFeGpokdF8tMPOhYlKfMcxzFgqG0ZAAAAAAAAAAAAAAA AAAAAAAAAAAABprVcsEA+jTUqImM4zMq9arH8LSDSIjE9oCCqsVA0iAUAAAgACAACgQCKBlSjKgA AQAAAAEKoBAgAAAAIFAgiRA2iAUAQQoigZVQMqoGVUCACjJAAAABRAAEUCARQIoEAhRkAEQKgRAo EQCBQIgUAgQAgUCIoVAPSclVAKBoCoFUChFIqlFIilVSCgANBAKoFAoACgUCgAKBSAUAKQUoAUgA CihFIoAApQIAAAAAAUCgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACQKEAAAAAAARURyQXk UD58+SrFinJzGolHnKgBCqAAAFIARSqqLDChB6ZU5UwfqJMD1tcjkwGRxn0rJyckHdJYkfKnU75S 4UwG4lHAoAAAAAAAAAAAAAAAAAAAAAAAAHSXKc9YIgH05FM2WmM7lMzKu+FywTkIN4GJ7QIiKuFQ NQAoAAAAAQKgQAKBAIoGSjIAIAAAACACqAQgBABhCkALiqBUYEahAKASIEVSoiqBlVAyqgQDKgAA ACQAQAAQBAogADIBQIBkCARSiERCqgRAoEQKgQAgUCIBAoEAIFQI9JyaVANIBQKgFQKoRQKFUiKg VSikRQqhAKoFAoADQACgAKBSAUVAKQCggFIAFKBBQAAooAgAAAACoBQAAAAAAAAAAAAsAIFAhACw AQAQAgAAAAAAAAAAAAAAAAAAAAAACKUAAAABl7Ee2CgfNmylY5TcI5FQIAVCgAApEAKVVRSI7S5q ouElK9jJqO5eUg09jZiQckUA+bUUKti6XhQ1GRTwuarVgqGkZAAAAAAAAAAAAAAAAAAAAAA9Emmd MXkwEmR9OXKZJT2mbVtEV+FcDQNxRuBOUgiJzrylGyAUAAAAAAgVAgBFAAZAilGQAECKACgABABA BigXFAYoFxUAsEARAkQiK4KyrgMq4qJECRARAgEAgAABYAIAQABFAgEKAEAigQDIEUCKBAIpRAiB UCIFAiBQCBAghVAiBUABHqOTSgVAqgUIqBVAoRQqgUgpRSIqBVAAUCoBQKBQAFAoACgAKgFIBRSA AKKAIKAAIUUgAAAACoBQAAAAAAAAAABYAAAAAAAoAABAAAAAKIQAAAAAAAAAAAAAAAAAABIFAAAA 5zZaTG+3mA+a9isU2jJUQgAQqqRAAAKKFUiNsmK3l5Ar1y539KGaHdHI7kIOE6llzUjCDixI+bOp JkteSKG4lHmVFTlKIAAAAAAAAAAAAAAAAAaaxz1giAe6RR/1nGZlXtTFYmKxMJBprOd3L0EGldzN AI0DQAoAAAAAAAgVCIFEUCKBFAyoEAAABRYAWAFgAgBYECADABFVCjKuAiuAzjKBIhEAFUgAgEIA IASACAEgAgBIAAAACAAMgFKIBFAgEAigRQMqBAIpRFIiFECoACIFAiEEKoEQAFQIAeo5NKBUAoVQ ioBUAoFQiqUUiKVVIioFUCoBQCAUCoBQCAUCgAihQCkFKAFIAAooRSKACihAigAAAAqAUAAAAAAA ABYAAAAABQAAAAAAAAAABAAABAAUQAQAAAAAAAAAAAAAAAJAoAAOE+Uj0inKWJHz3NVqmkQohEAo EAAAClAKpEVrlauAK9Euai+xSUPS2Z0kG/wuTpQivLOomPwtwKaiUp8+bSTJa8mA1Eo86tVOVCiA AAAAAAAAAAABUaruRAPVJpHPwryEmR75cmXKTDhUzaun4n4EwIBtGtYn/SRUirvYgRpEgBQoACBQ AACABAAVCoAQDKgQDIACwKKiEFgBYAUABMZAMq8omMoGcZQJhAQUBABABABigIAIAIAIAQAUAARA qBEAgACAAIBCiAFAyBAIoEUDIEAilEIMqUQAEQKAQIBUABECoACIFes5KoFAqBVA0EVAqhFQKoFI gFUChFCqBQKAAoFAAUCgUABUAEFKCAUgFFAEFAACikAAAAAVAKAAAAAAAAgBQAAABQAAAAAAAAAA AAAAAAABAEChAioVAAQAAAAAAAAAAAAAAAIUeafJimM3+ksSjwqkFNCFEIgAAAAKUAoBSIBXVk1W 4FwoQelj0dhRcJB1R684VYtckFw+xSDjMpJb+RIKW0eKbQOTC3Ca1FPK6Q9vKhbRzVqpyoUQAAAA AAGmsc7kQD0yqRzuVCWPbLp5ctMPKZtXVFVcDEwEGmy05XYVCtK5EwIBIKuFQjUAqgAAAAEAAAAB AqACogEAigZUCAaRoGkQCwAARXIgGVf0AZVylEwgIAXFAQAsAEAEAEAEAEAIAAAQCBACFUCIoECg RAIAUCARQIBABRkCKBFAgEAyBFAgEAyUQAACIQQqgRFABUCCgQK9aHJVA0BUCqBQioBQqhFCqBSI BWggFUCgUABoABQgFVAKAAqAUABQBAKKBSAAKKAIAAABQKAAAAAAAACqEAAFAAAAAAAAAAAAAAAA AAAAAAAAAEKqBAgAAAAAAAAAAAAAAASBR5J8j+snIWJR4lSCwNAUQiAAABSgFABBQgFVFVMKAeiX P5nEoehFa7CikVfxJyYQLnOlAIubfyogHJ1LKdyC0cHUCcyl1FOLqB6chdRTktJMTmLaJsszoFjb aJ68osp6GUTU/aJa07tlymc0VINornYGpBCDSS+dyxCt4Gp0AZVVdycgFRsANAAAAAAAAAgAAgAK hUFAgGVUDKqARANI0DUALyAZV6IBhXKoGcKlFgBYAWBBYAIAQoAAAAAAAigQABAgFQCACiEQKqBE UKBEAgEUCAQABkCKURQIBAMqBFAgEAyUQABCIFVAARAqBACBQI9aHJppAKBQKgVQigUKoRUCqBSI pVUiAVQKBQKBQAFAoACgAKQUoAUgFACgUgACigCAAAAVCikAAAAAAAFAAUAAAAAAAAAAAAAAAAAA AAAAAAAAAEAAIFAKgAIEAAAAAAAAAAAARURUgoHinyIYU5DcSjyKkCgUQiAACgCqAAKRAAFANte5 vIoHpl1CLgUzQ9CK1xFRZaKUZWWqciixITEAY705UAmcXnaBMdeZoRYzF5EgBUlOX9pRY2ktqe0W NYEIrKu5kKJCOFQNIgFAAAAAAAAAAgBAAVAARAMqpRlViBUaBtEAoGVciAc1cqgSCqBYAagBYAAA AAAAAQoAAAAgilEAARQAEABEKoREKqBEIqFRAAEAigQCKBAIoEUogEAyoEUCAQCKBlSgBCIhVAiB UABECgAI9hyaVAKBQKgVQigVAqgUIoVSIqBVAoFAAUCoBQAFAoFAAAKQUoIBSAUUCkAAUUAQAAAC gUAAAAAAACgAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAEKoBCAEAAAAAAAAAAABFRHJBeQDwz5 GKsU5DcSjyqkCgUCCBFChQAAUiAAKAAKB1lzVRSD2MmI4iuhAAAIIAggAAEZV0CqxFXfoA0iQApB SgAAAAAAAAABACBQCBECsqpUZwqBtGgagRUVyIBzc+JUZwqBpEAsAKAAAAAAAAAAAIUABAAilEAA RQAECIFAIBCgREKqKEZVQJEAAUCARQIBAIpRCCFEUDKgQCAZAgQKqKBAiAAqBACBQIgHtOTSoBUC qEaAqAUCoACtBFQihRSIoVQKBQAFAoFAAUCgAKgFAAUAQCigUgFACkAAAAFGiAAAAAAACgUAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAEAoBAAQAAAAAAAAAAI5qOSCgeGfIVq4OQ3Eo80IYFKI AAACgAApEAAUAAAAHeU8kj2MdFCK2QUAAAigYVSjHKoGkA0hBQgVQAAAAAAAAEAIFQAERVCsqpUR EVQNokCKvIBhz+gqMRVQCIBqAFAAAAAAAAAAAAABFAAAAEUogACKAAigQABAIACIVUUiOblKCKBQ AVAiKBAIBFAgEKIoEUDIEAyAUCARSogECoEAIFAgBAr2nJVA0gFCqEVAKFUIqBVApBSikQKqkFKK QUCgAKEUKBFCgFAoACkAooAgoAooAgAABRUApAAAAAFAAUAAAAAAAAAAAAAAKAAAAAEAAAAAAAAA AAAAAAAAAAAAQoBUIAQAAAAAAAAARzUckFA8U6Ri/oNxKPKqQwKUAiFUAAAKRAAFAAAABtiwUD1y 1Mq7oQaAAAMqBhSjPOBpANACIoUAACgAAAAiRCgEAAZVQMqsSoqN6SK3CABXIgHJzlUqJADSIBQA VQAAAAAAAIEAAAABFAAAAGSgQAIUAIoEAKBkAERQoBFCOTiggGgIFAiKBAIBFAgEKMqAUDIEAgEU CARSiBECoEQKAAiBUA95yVQKBUCqEUCoFUIqBVApEUqqRFKqkBAKBQKAQCgUCgAAGgAFQAAAoFIB QApAAAAKUUgAAAAABQKAAAAAAAAAAAAUAAIAAAAAAAAAAAAACAAAAAAAAAAAAAAIAKBFQAAABAAA AAAAEVEckFA8U6TD9BuJR5VRU5SgEQKFACkQABQAAAAVOUD2SjMj0oRVAAAMqBFQDmqFBFA2gFAE RQoAAAAIAKAEAiqBFUDOFQjaNgFa5AjDnwCuaqqlRUQDUAKRSAQKAAAFAAAAACIAAAAIoAABAIAA AQogEUABFAgQAgUAyoHJSoqAaAgUCIoEAgEUCAQCKURQMgQCARQIBFKiEVCiBECgRAIFAj3ocmlA oGgCAUCoFUDQQCqEUiqUUgpRSABQKBQAFAoACoBQAFIBRQBBSgAApAAACjQAgAAAACgUAAAAAAAA ACgAChAAAAAAAAAAAAQKAAAAAAABAAAAAAAAAAAAQAACoAABAAAAAAAEVEckFA8c6TD9BqJR5VRU U0IEQKAUIAAoAAAAK3lA90luAzKu5BQAACKBAMqhRjkAqKBqIFAEQCkQAAoAQBECRAyqhBGqoG0S AVVVECOTnx5ArMIlRpEINQCgRQAAAAKAEgQCqACCACoAAAEAAAIoEAAFAyUCCKUAIoECAECooGHK Uc+cI2gFAhFCogVAiKBAIBAMqUFAyBAIoEUCARQIBCiBECoEAqBAD3nJppAKBQKgFCqEUKoFIilV SIFVSClFIKUUgAUIoVQAADQAAgFAAUCkAoAUgAABRUApAAAAAFAoAAAAAAAAKAUIAAAAAAAAAAAA AAAAAABACBQAAAAAgAAAAAAAAAAAIACoAAAAAQAAAAEVEVIKB5J0mGFOQ1Eo8jmq1TQgAIAAAUAA AAHSU2KkkfQYkEMq2AAAAAGVAigZVCjIFRQKigUAAAAIgSIEiBIgTCoRpGhW4EEc5EKOSuVQgiFG kQirACgAAAAAAAAiAAAVAAAIFAABAAEAKBAABQMgAIpQAgEABECsqoHJyxKggG0IAEChUQioVECo oRAIBlQBRkghRFAigQCKBAIUQiIVUUIgUCAH0Dk0oFQCgUChVCKBQqhFIqlRSKpQQgoFAoFQABUA oACoBQAFAAAKBQAFQAQABRQKQAAAABQKAAAAAAAFAKEAAAAAAAAAAAAAAAAAAAAAAAACBQAAAAAA QAAAAAAAAAQAFQAAAAAgAAAAIqIqQUDyTpMOTkNRKPK5qoaGQgACgAAAAAeqQ0kj2JyGVUAAAAAI BAIqAYVCiAIgWICICICIEiBIgMIRUaFbRoGuQgw5/QUcsKhGkQDUAqgAAAAAAAAAACBAAFQAAKgA AgACAAAEAARQIAAilEIIUCABCjk5wGOUqNtQitAQCFAIhFQqIFRQiAQDKgAMgQoigRQIBFAgEKIQ QogRAoEQK+iclUCgVAKBpAoBoIqBQIoFCqQUopBSikAChAKoRQoBQKAQCgAKBQAACkAABSikAAAA AUopAAAAAAAFAKEAAAAAAAAAAAAAAAAAAAAAAAAAAAAQKAAAAAACAAAAAAAAACAAqAAAAAACAACK iKkFA8s2TDCnIaiR5XMgaRgAAAAAKATlA9ckzI9SEVQAAAAAAQghRIARUAyrSiQAQAkAEALAC4oF RoGoEBVgBzc/oKMcoRtECtAAACAFgBAKBAAAAAAgQCoAAACoEACBUKgAABUCAEUCAAIBFKIQAIpR hzgOKrEo01ANkFAigQoEEUIgEKqKEQCARQIBkCFEUCAQCKBAIoEAhRCIhVRQAH0ExuhPt9xyVfxd Cfb7gNfi6E+33AVMboT7fcBfxdCfb7gq/i6E+33BFTG6E+33BVw9CfaBcPQn2hFw9CfaFXD0J9oR cPQn2hVw9CfaBcPQQXD0AMPQBcIFSPQBcIDCBcIFwgEiBcIDCBrCAwgMIFwgXCAAuEgAABRUApAA AAKAAAAAACgAoBQgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQKAAAAAAABEAAAAAAAAAAqAAAAAAC AEVIpBQPLNlKmFEwGokeVzHcyJ9pUc/xdCfb7ih+LoT7fcA/F0J9vuAfi6E+33AX8XQn2+4B+LoT 7fcB6pKr0IZketOQitBQAEQAAAACCQKGECQAkFAQXoAQAQAQXoAsAKBlXQA5Oc5SiIirzAbRFA1h IEFAuEBhAYShhAYQGECYQJFQESBH9BRMb9AExv0f+39ADG/R/wC39AExv0f+39ADH/R/7f0ATH9i fb7gGc9ifb7gUmc9ifb7ghnfYn2+4KznfYn2+4BnvYn2+4CZ72J9vuAmf9n6/cETP+z9fuCptH9n 9fuAbR/Z/X7gMrU/2f1+4oi1SdX9fuAi1adX9fuCMrWJ1f1+4DO2p1P1+4CbanU/X7gMrXon9T9f uA4zLo1v9T9fuKPM68Nj/wBX+97i0g26tX/C/e9wV2S5t/h/r9xBfijf4f6/cBPirf4f6/cBlbs3 +F+97iifF2fwv1+4DK3ln8Je17hQyt6Z/CXte4UMrfJf8Fe17hQyt9lp/gr2vcKGFv8AL/gr2vcW hlfMMpP8Be17hSML5jlJ/gL2vcKGF8yyk/wF7XuLQwvmeT3d3a9woYXzVJT/AC7u17hpGF82SE/y 7u17hpGF83SO7O7XuLpGV84U6f5Z3aT7hpGF85U6f5V/aT7hpRlfOlN3V/aT7hpGF87Uyf5V/aT7 i6C2F88Uqf5R/aT7hoLZXz1SJ/lJnaT7hoLYXz7SJ/lJnaT7i6C2V8/0af5OZ2k+4aC2F/3Bok/y cztJ9w0FsL/uHRJ/kpvaT7hxlsL/ALjUKf5Kb2k+4vGW/wBLPM0qAUCgUKoRQKFUIqBVAqAUCkAo pBQKEAqhFCgFAoBAKAAoFAAAKQAKUAKQAAAoqAUgAAAAAACqEAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAQKAAAAAAABAAAAAQAAAAAqAAAAAACAEVEVIKB53y4GrHB0uJbRxcxUAyUUABAPTKUkj2 N5DKtBQAAAhEAAAAAAQAQKIAAAAAGHPhyAc1VVKCIBtEA1AgAAAAAAAAQABCiEEAigQCAQABFAgV nnCIpRFAgEUKyERQMqBkCAZUDmqlGQMgYVYAeebMREKjwzHqqmhzRqqoHpYyBBtecisqUZUiMqUZ UDmoHNQOalHNwHNxRyUDm4I4uKOSgcnFHJwRyUo5OA5OKObgOTiji4Dm4qOTgOLijk4Dk4qOLgP6 VPE6NAVAKBQKFUIqAUKoQCqEUKoFIKBQAFAoACoBQAFAAUCgAAFIAAooFIAAAUAKQUAAAAAqhAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAIFAAAAAABAABAAAAAABUAAAAAAACIqIvKBydL6 CjkrSjk6UiltHJZaoBAiFV3lkkexnIZVsihQIAACBAAAAAAAAAAAyrkQo5ufEoxyhGkQK2iEFAAA AAAAAAAIAAyAAgEUCAQCAAIoGQqBEUCKBCqhBkIi85RlQMgRQMKoHNQIUYVQPPNmoiFiB4HzFdH9 JpGEaqgdmMJI6wghFRecDKgRQMqBhQOalHNQjmoHNxRzcByUo5OCOTijkoHJxRxcBzUo5OCOTijm 4Dk4o5OA5OCOTiji4o5uA4uA4uKj+ljxOigUCgUCgUKoRUCqBUAoFQABSCgUIoVQgFANAAKgAABQ KAAoAgFFAIBSAAKLAAQUAAAAAKAAAAAAAAAAAAAAACqAAAAAAABAAQAAAAAAAAAAAAAAAAAAECgA AAAAAARAAAAAAAQKAAAAAAABGHMRSjkrYAZVqFGFloosZzQtG2sgFehqQINkAKAAAAAEQAAAAAAB VgUc3P6AOaqqlEgBtEA0iEFAAAAAAAAAAAEAAZAAQCKBAIBAAGVCoBAIoRFCoBkCBGV5wIoVlQMK pUYUDKgZVYAeabNhyFHgmPVymkYa1V+0o7sZgINwghFAIqcoEAyoGVAwoHNSjmoRhQOTijm4DkvK BzcUcXAcnFRxcBycUc1A5KVHJQObijk4QOTijm4I5OA4u5yjk4o5OA4uKj+lUPE6KgGgKgFAoFQK oFCAVQihVApBQKAAoFAAUCgAKAAqAUABQBAKKAgBSAAKAFIKAAAAEAKAAAAAAAAAAAAVQAABAIAA AAAAAAIBQAAAAAIACAAAAAAAAAAAAAQKAAAAAAAEEKgAAAAAAKgAAAAAAAEVIhGFYUYVqoBANpAD SAUgoUAAAAAAEQAAAkUAyryjmr1UoyBUQDSIQbRIAAAAAAAAAAAAAAgADKgAIBFAgVF5QiAAMqFQ CARQiKFQDIECMrzgZUKwqlGVIjKlHNzkQDzTZsC0PE96uU0jCNiB2YyCEHSEECooCBAVOUDKgZUD ClGFA5qBzUDmpRzcEc3FHJQOTiji5QOTio5OA5OKOagcnFHJQMOCOLiwOTijm4Dk4Di7nKjmoHFx RxcB/Sx421QCgUCoBQqhFQKoRUCqBQgFUiKVVIilVSIBVAoACgAKBQAACgAKAApAAFACkFAAABRQ BAAAAAAAAAAUKQCAFAAAAAAAAAAAAABAAUAAAAAABAgAAAAAAAAAAAIFAAAAAAACCFQAAAAAABAo AAAAAAABFQIyrCjCoqAMaAGkcBcYCxIKFAAEiAiETGQoyr0AyrwMK4ozhUDSIBpEINIgFAAUCAAA AAAAAAAACAAMgAIBFIIVUCIAAyoVCCFEUIihWQIBFCMKoVlQMKBFUI5PeiIUeObONUPK5yuKg1kQ OrWQIrUIACBACwAyvOBlQMKBhQMKBzUo5qBzUDm4qOTijkqgcXKUcXAc1CObijk4DmpRzcByUo5u A5OKji4Dm7nKOTgOTijk4I5OA4uKP6VPG20BUAoFAqBVCKACtBAKoFAoFIAFAoAopBQCAUABQKAA oFAAAKQCgAApBQAAoAWAAgAAAAAAAsAEAAFAAAAAAAAAAAAAAAAAAAABAAAKAAAACAAgAAAAAAAA AgUAAAAAAQABRAgAAAAAAKgAAAAAAAAIkAMqwDKsUozBUAmMqAMdQLnFAmcFCLMUCY6lExgJEABU QDaNINIgFgBYAAoAAAQIAAAAAAAAAIAAyAUCAQKhBCohFQIihUAhRFIIoGSiKBhVCMqBlQrKrADg +ZAtI8cyaqmohHnWKqUbbLIOqMgRSACAFxQECCKgVlecIwpRhQMKBhQOalHNQOagcnKVHFylVyVQ jk5Sji4DmoRzcUcnAYUo5uA5KBzdyFHJwRycUcnAc3FHFwHNxUcXAcnFH9KoeNtQKBUAoVQioBQq oEUKoRQqgAKEUKpECqpBQBRSABQKAAoACgAKQCgAApBQAAoAUgAAAAAAAAWAFAAAAAAAAAAAAAAA AAAAAAAAAAAABAAAKAAAEAEAqAAAAAAAAECgAAAIAAAAKIEAAAAACoAAAAAAAQCoAQAqAYViKUYV gGFapRmCgTCAwgIAaRoGkaQbRoFAoFIAEKAUAAAiAAAAAAAACCFAgyUIASCkEgpVSCkEgUCCQUIy sQqQUCQUCKBFiBlYlGViBlUXoCMrHoA5uWAV5pkxcOBS0jzOVy8ymhjEcvMoRpspegWrojFTmICt XoIGIvQoDEXoAYq9AVIL0ARUXoAwqLhwAYVF6AMKi9BUYVF6AOaovQBzVF6FA5qi9ClHJUXoUDk5 F6FKOLkd0KVHJUd0KBycjuhSjm5ruhQOatd0KBzc1ehQObmu6FKjmrXdCgc3Nd0KUcla7oX7AObm u6FKOTmu6FA5ua7oX7AOTmu6FKjk5ruhfsA5OY7qr9hRyc13Qv2AcnNd0L9hUcnMd1V+wD+lDyNq gFAoFAoFAoVQKgACoBQKRFKoRFKqgCClFQgAUCgAKAAoACgAAACkFAFAABSAAVUTlAwsxicrkLQZ 6X1kFDSPavIqKBSCwAoAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAgAKAAAEAEAAVAAAAAAAACBQAQ AIAAAAIAAgAgBUARUBh6QJEBFQJFSBFQEV6QJFekBFekKkV6RYRXpFoysekWrDkVedRZTk5i9Zft LaU5LLd1l+0WUziP6y/aWyhGv6y/aSxtMbrL9osaRXdZftJamM7rKLFxndZRYYzuspLDGd1l+0WJ ju6y/aLKTHd1l+0WUmO/rL9osMd/WX7RYY7+sv2ixMd/WX7SWJjv6y/aW1pMd/WX7SWGO/rL9osp M4/rL9osozj+sv2iyjOP6y/aLKTOP66/aLKTOP66/aLKM5M66/aWymc5M67vtFlIsyZ11+0WMrMm dd32ixM5M67vtFjKzJnXd9osTOTOu77RYys2Z13faLKTOTOu77RYmdmdd32iykWbM67vtFjKzZnX d9oGVmzOu77RZTCzpnXd9osYWdN/iO+0ows6b/Ed9osYdOm/xHfaVHJ9TMT/ABHfaB5JtfNRME13 2mohHz51fULyTn/apqIR5HVNU5V/vpnaU0NsfUryzpnaUllO7X1Cf4z+0pLWnRJs9P8AFf8AapLD PT/4r/tUWKkyf/Ff9qksaSbPT/Ff9qi1oz0/+K/7VJYys+f/ABX/AGgYWfP/AIr/ALVKObqif/Ff 9qgc1qJ/8Z/2qBzdUT/4z+0pUcnVFR/Gf2lA5Oqaj+M/tKUcnVNR/Gf2lA4vqqj+NM7SlHnfV1P8 eZ2lKjzvrKn+PM7SlHndWVX8eZ2lKjg6rqu8TO0pRxdWVfeJnaUo4urKvvE3tKEcXVlX3ib2lKOT qyr7xN7SgcnVtZ3mb2lKOTqys7zN7SgcXVtZ3mb21Kji6trO8ze2oHJ1bW95m9tSji6ure8ze2oH F1dW96m9tSo4urq3vU7tqUcXV1d3qd21A4Orq7vU7tqUcXV9d3qd21COD6+u71O7alHB1fX97ndt Sji6vr+9zu2oof3YeBtQKgFCqEVAKFUIoVQKBQKAApBSgBSClFQgAUCgACAUCgAKAAAAKQUAUAEA KQAAHkqpitTAagl8mZOeq8pumXPHf1lKKk6YnI5RQ9EuvnMXCsUMzitvfJuMt8Ef+FTM4lva1zXJ FqxQitEAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAgAKAAAEAEAAVAAAAAAAACBQgAQCgQCKAAEEAB UAKQQoACCBQIAQCEUAAQCAAMqgGFQDmpRmKAIgIgSJBYgSIAgRKrMQJEBEgRAkQAEAgACYAADABM AEUDIEUCAZUCKBlQIBlQIoGFUDKqUZVQMKBhVKObnoiAeWZPRCxCPDNnqpqIR5HOc40jKSVcotXZ lOSx2SUiEtVVpBMQWNYgsMUgKgVhQjClHNQObgObijkqgcnKUcnKBwepUed7ijzvcVHnepRwcpUc nFHB6gcXFHJwRxcUclKOTgOLgOLio5OKOLgOLiji4I4OKOLgOLyjg8qODgODyj+9kPC2pBQKBUAo FCqBQihVCAVQihVCAVSClACkFKKQAAFAoACwAAAKAIKUAAFQAQAAAo8tYyLYlgl8N6Qcp0ZQAAAA dpVTNkr+F2DoJMD6lPcGTINf+FxicVt7kVHJFFihlVAAAAUAAAAAAAAAAAAAAAAAAAIAAAAAAAAQ AFAAEIAAAAKgAAAAAAioAKIQUCAFCoAIiAPuCoBSCAQAAAgAgi84VAAACAQAoEUg5uWCFHmmPgVH FZpaEzooXOigzqEpWs6goVJiAXOIQMdAqY6AZxwGMgDHAmOQXGAiuQBjAFUBEikQEQIAUohEZUqo pBkDKhEXlKrKqBlVAyoGFCIqgYVSjk56IB55k6BqIHlmTVUtI87lc4qOeaVwsdG0/ShLWnZslE5h YuIiEDFFqmILDFIJACKgGFKOa84GFA5uKOShHNwHJylHFylHF6hHmmPNDzOdEqOL1A4OUo5uA4PK ji4o5OQo5uA4uQI5KUcnFHFwHFyFHJwRxehRxcnKBxchRxcgHFyFRwehRwegHF6FHnegR/ep4W2g KgADQAK0EAqgUIoVQihVCAVQKAApBSgRFCgFAoACgAAACgUAAApAAACgBYAcahIsUQPhT0g86Qy5 FAAAAAAPVT1sySqIqxaSYW32JFTLnJFq4eg5zFK7kFgFIBAAAAAAAAAAgFAIAAAAAAgACgEAAAAA AAAIACoQAAAAAAFQAAABBAoUQgoEAKRUAAAiBUApBAAEAARQBBF5woAAgEAgFIMgeea6CGoHzpsz CaiEeZZntNUiZ32koFm+0UGeFBn/AGilNo9ooXafaSizafaKLXaU6RRZtKdJKLXaE6RRZtCdIpU2 hOklBtCdIoXaE6RQqTvaSldUmRA6IpBoigACKoEUDKgRVAzEDKgZVcJRlQMqoGVUDDnIEc3TEQo4 PmFHFzlUo5OaqhGc0qixpJAsbSUiEtVxEQWGKQZxSiQIJACKgGFAwpRzUDClHNQObgOSlRycoHBz iji5xRwe4qPJMcUcVUqMPA4OKObgOLijk4I5qUcnAcXFHJQjk4o4uQDk5Cjk5AOLkKOTkCOLkKOD kA4uQo4PQqOD0A4vQo870A/vRDxNKBQKgFAoFCqEUKoFQIoUCKFANBAKpBSgRFCgFAoACwAAALAC gAAACkAAUAAFgBSDjP8A2FLA+FUftHSGXEoAAAAAAA3LmPluxmrAUPr0le2YiNesHHOcViX0EWOF DKgAAAAAAAAAAAAAAAAFQAAAEAAAKAQAAAAACACKgAAAAAAAAqAAggUKIQUCEBQqAAAAgyUUggBQ IFAChEIIoUAAQCAACkVhVgEeCpebhHypszCpuIR5nTfaapGM97RQZ72ihFm+0lKys0tIys0UMrOF DOfXpFCZ9ekUJtC9IotdpXpJS2m1L0iizal6RRapUr0ii3Rs9VJSvRLmKpmYHrY8zKw9DXmVdEcg VcYgRARCJEKiqBlVAyqgZVQMqpRhXAYVwHNXqVHNyqoGFaqgTNiwzQsXNoLDERAIqEEVAqQAzACQ KMqhBlSjDlA5qEYUowoHNQOblA5OUo5OUDzzHmkeZzolHNVA4zFKjzOKOa85Uc3gcXFHNQObkA5O KOShHJyFHJwHJUKOTkA5OQDk5Co5OTlA4uQo4uQDi9Cjg9AOL0Kjg5Cjg5AOD0Kjg9AP7zPG0qAU CgUKoRQKFUIoUCKgVQAFCKFUCgCCgAKBQAFAAALACgAAFgAIBQAAWAFIAADnOSLFLA+FUp+I6Qy8 5QAAAAHRjUUg2sqIscnS3NKMoqtWKYFA+nSV6pBjzE4rb6rXtekWrEwrQAAAAAAAAAAAAAAAABAo AAEAAAAACgEAAACEAKAQAAAAAAAoEQCoBAKAIIoVAAAAQQKBEAKACoQFKIQFAgACEACARQrjOejU LCPj1M3lwnSIZl8ifOwqdIhHifP9pqkcdo9ootdp9ootdo9oosz/ALSUJnvaKEWb7RQys0UMrMLQ znACzCUJjqBUcqhXZiKpB65bVMSsPXLaZlXpakDMq6oqoRW0coGkcpBpHAWICJBFUKyqgYVVKIsQ M4QMwUIzihUxBYYiAMUCYpBIAZVCiQIJADKoBIAZUDClGFUDCqBzUowoRhQrmqlRzcoHNygcXOKP PMeVHle40OSqBlQOLyo4OKOS84GHFHJwRzVAObkKOTkA5qhRycgHJUA5qhUc3NA5OaBychRxcgHF yAcXIVHF6FHB6AcXIUedyFRwcgHB5R53lH95IeNWgKACtBFCgGggFUIoVQgFUIoVUAAUgoACgUAU UgAALACgAAFAAAAACwApAAAAMvSLVQo+LVtgqm4R4jSAAAAA6S1IPU1IkVpWIoHCZI50LaPOqK1f aUeymrHS1RFXAZmFt9iVObNbFFwmJhXUgAAAAAAAAAAAAAAAAAVAAAgAAAAAAKAQAAQgAQKAAAAA AAoEAKBkCgCAoGQoAIL9wGQoEAIACoQAIAUCAAIQAIBlywQK+ZVTuXCbiGZfFqZ3KdYhl8mfMwqb iEeJ71NI5KqlEVygXHUg0j16QLjqQTGUCY3tCpjAIqEVIqRXRrFUD0y5KqZmVe2VI9hiZWHqZKgZ mVd2sMyrpAitQA0iAaRCDSIBqAUgQFQDKoBlUAkAJACQAQAkCDKoBIFEgQSBRlUAyqEEUoyoVhQj CqBhVKOaqBhVAwqgYVSjk5wRyc4o5OcByc4o4vcVHnepRwcUZUDDgOLio5OQDkqFGHIBzcgHNUKj m5AObmgc1aLHNWlHNWgc1aByc0Di5Cjk5Aji5Cq4vQI4uQo4PQo4PQI4OQo4PQo87yjg8sI8zyj+ 8zyKqEFAoFCqEUChVCKFUIBVCKACqBSCgCikFAFFIAACgUAAgBQAAABYAUgAAAAoQAKmAD5FYnKb hJfNNIAAAADTFwgeyWplXZCAqRA4vko4tjzPkubyFtHWnqHSnIi8gmB9uTObNanSc5hp2IoAAgAA ACAAAAAAAAAAAAgUIAAAAAAABQCIQAAVAAAAAAAUCAFAgAAQFAihUAEF+4CAQKBEAEVAAACKBAAE IAEA81RMxUUsQS+HUzeU6xDMvkVEzl/SdIZfNmuiqm4R51KjIEUDEQKjgq4xBYgIgERVIOjWKpLV 6pchVMzK09sql5MBmZWnsl0yJzGJlaelsmBm1dElksaRgtVxCCo0K0jQNI0gsALABAgKBlQIBIAS GECQCpACQAyqASAEVAMqBlQMqBhVCMKpVYVQjCqBzVSjCqBzVwGHOKOTnAcXOKjirijmrgOblKOT lCOTijm5AOagc3FGFQDCtA5q0Iw5pVc3MFo5qwWMKwWOasLY5q0g5uaUcnIBycgHJyFHByFRxcgH FyFHF6FHByBHF6FHnfzlHFwR53mh5ngcHlhHneaH9+JX1/e5+kd955+TLrJULt9f3qdpHfeOTLrJ ULt9d3qdpHfeOTLrJULt9d3qdpHfeTky6ytQu313ep2kd945MuspULt1d3qdpHfeOTLrK1Bt1d3q dpHfeOTLrJULt1b3qdpHfeOTLrKVC7dW95naR33jky6ytQu3VveZ3bd945MuspUG3VveZ3bd945M usrULttb3md23feOTLrJUG21veZ3bd945MuspULttb3mb23feOTLrK1C7bWd5m9t33jky6yVC7ZW d5m9t33jkz6yVBtlZ3mb23feOTLrJULtlZ3mb23feOXLrJUG2VneJvbd95OTPrJULtlZ3ib23feX kz6yVBtlZ3ib23feOXLrJULtlX3ib23feTlz6yVBtlX3ib23feOTPrJUG2VfeJvbd95eTLrJULtl X3ib23feTlz6yVBtlX3ib23feOXPrJUG11feJvbd945M+slQu11feJvbd945cuslQu11feJvbd94 5c+slQbXV94m9t33jlz6yVBtdX3ib23feOXPrJUG11feJvbd945c+slQu11XeJvbd945c+slQbXV fx5vbd945c+slQbXVfx5vbd945M+slQbXVfx5vbd945M+slQbXVfx5vbd945M+slQu1VX8eZ23fe OXPrJUG1VX8eZ23feOXPrJUG11X8eZ23feOXPrJUC1dV/Hmdt33jlz6yVD5tXXV7Y4tVOT9Exyf9 JqNzLrKTEPmrdLnH/wC9qNK/7zfJl1lKhPilz77UaV/3jky6yVB8UuffajSv+8cmXWSoPilz77Ua V/3jky6yVB8UuffajSv+8cmXWSoabdLlHDW1Glf95OTLrJUPSy5XBeWsn6R/3k5MusrUOzbhX97n aR33k5MuslQ3t9d3qdpHfeOTLrJUG3V3ep2kd945MuslQLW1y/5ufpH/AHjky6yVDzzKy5JhSsqN K/7y8uXWSoSTdbgx0H1U5f0zHL/0idzLrJUPrSbhUzG/9fMj/wC+77zE7mfWVqHXaqr+PM7bvvJy 59ZXTBtVV/Hmdt33jlz6yaYNqqv48ztu+8cufWTTBtVV/Hmdt33jlz6yVBtdV/Hmdt33jlz6yaYN rqv48ztu+8cufWTTBtdV/Hmdt33jlz6yaYNrqv48ztu+8cufWTTBtVV/Hmdt33jlz6yaYNqqv48z tu+8cufWTTCbVVfx5nbd945c+sppg2uq/jzO277xy59ZKg2uq/jzO277xy59ZKg2uq/jzO277xy5 9ZKg2uq/jzO277xy59ZKg2uq/jzO277xy59ZKg2uq/jzO277xy59ZKg2qq/jzO277xy59ZKhNrqv 48ztu+8cufWV0wbXVfx5nbd945c+smmDa6r+PM7bvvHLn1k0wbXVfx5nbd945c+smmDa6r+PM7bv vHLn1k0wbXVfx5nbd945c+smmDa6r+PM7bvvHLn1k0wbXVfx5nbd945c+smmDa6r+PN7bvvHLn1k 0wbXVfx5vbd95OXPrPqlQbXVfx5vbd945c+s+pUJtdX3ib23feXlz6ytQbXV94m9t33jlz6yaYNr q+8Te277xy59ZNMG11feJvbd945c+smmDa6vvE3tu+8cufWTTBtdX3ib23feOXPrJpg2ur7xN7bv vHLn1k0wbXV94m9t33k5c+s+pphFq6vvE3tu+8vLn1k0wbZV94m9t33k5c+s+ppg2yr7xN7bvvHL n1n1NMG11feJvbd945c+s+pphNsq+8Te277xy59Z9TTBtlX3ib23feTlz6z6mmE2yr7xN7bvvLy5 9Z9TTBtlX3ib23feTlz6z6mmDbKvvE3tu+8cufWfVdMG2VfeJvbd945c+s+pphFrKvvE3tu+8nLn 1n1NMG2VfeJvbd945c+s+ppg2ys7xN7bvvHLn1n1NMJtlZ3ib23feOXPrPqaYNsrO8Te277xy59Z 9TTHRNtrO8ze277xy59Z9TTBttZ3mb23feTlz6z6mmEWtrO8ze277y8ufWfVdMdDbazvM3tu+8nN n1n1NMdDbazvM3tu+8c2fWfU0x0TbazvM3tu+8c2fWfU0x0Ntre8ze277xzZ9Z9TTHRh1fWon/3M 7tu+8cufWfU0x0fMqrtcGquLWT0/RMen/Sbjcz6z6pMQ+PPvl2SMLhUp+idM+86RuZdZZqHzp1/v Sclzq0/RPmZRuM8uss1DyO8wX2OC61u8Tco1ry6lQz6gv3Fq3eJuUNeXUqGfUF/4tW7xNyhry6lQ i+Yb/wAWrt4m5Q15dSoYXzD5g4vXbxNyi68upUM+ovMHF67eZuUNeXUqF9ReYOL128zcomvLqVDS eYfMC/6tXbxNyhry6lQ22/eYF/1au3iblE5Muq1D0S71f1/1Wu3iblGZ3Mupph65V1vq8t0rN4m5 Rmd3LrK6Ye2Xc7zz3KrX/t5mUYney6yumHrZcrtz3CqX/tpn3mebPrPq1ph2S5XTv1TpX/eTmz6z 6mmOjaXK59+qNK/7yc2fWfVdMdF+JXPv1RpX/eTmz6z6mmOi/Ebl32o0r/vHNn1n1NMdF+I3LvtR pX/eObP+0+ppjofEbl32o0r/ALyc2f8AafVdMdF+I3LvtRpX/eObP+0+ppjofErl32o0r/vHNn/a fU0x0PiVy77UaV/3jmz/ALT6mmOh8SuXfajSv+8c2f8AafU0x0T4lcu+1Glf945s/wC0+ppjoi3K 5d9qNK/7xzZ/2n1NMdE+J3LvtRpX/eObP+0+ppjonxO599qNK/7yc2f9p9TTHRPidz77UaV/3l5s /wC0+ppjonxS59+qNK/7xzZ/2n1NMdE+KXPv1RpX/eTmz/tPqaY6J8VuffqjSv8AvLzZ/wBp9TTH RPitz79U6V/3jmz/ALT6miOjK3a6d+qdK/7yc2f9p9TTHRFu107/AFOlf95ebP8AtPqaY6Mrd7r3 +p0z/vHNn/afU0x0ZW73Xv8AU6Z/3jmz/tPqaY6MreLrxCp00z7xzZ/2n1NMdGFvF24hVaaZ945s /wC0+ppjoyt5u+H/AMwqtNM+8c2f9p9TTHRhb1d0/wBRqtNMyi82f9p9TTHRzdfLxxGq00zKHLn/ AGn1NMdHNb7eeJVenmZReXP+0+ppjowt9vPE6vTzMocufWfVNMdGFv164nV6eZlDlz6z6mmOjmt/ vfFKzTzMovLn1n1NMdGHeYL5xSs083KHLn1n1NMdHJ3mG+8Vrd4m5ReXPrPqaY6Oa+Yb9xat3ibl Dlz6z6ppjowvmG/8Xrt4m5Q5c+s+ppjowvmLzBxeu3mblF5c+s+ppjowvmLzDxeu3mblDlz6z6mm OjC+Y/MXGK/eZ2UOXPrPqaY6Mr5j8x8Zr95nZQ5c+smmOjC+Y/MfGa/eZ2UXlz6yaY6ML5k8ycau G9TsocufWTTHRlfMnmXjVw3qdlDlz6yaY6Mr5l8y8auG9TsocufWTTHRhfM3mXjdw3qdlDlz6yaY 6ML5n8zcbuO9TsscufWTTHRlfM/mfjlx3qdljlz6yaYYXzR5n45cd7nZY5c+smmHNfNPmjjty3uf ljlz6yaY6ML5q808duW9z8svLn1k0x0c3ea/NXHrlvc/LHLn1k0x0c182ea+P3Pe5+WOXLrKaYcn ebvNnH7nvk/LLy5dZNMOTvN/m36gum+T8scmXWTTDkvnDzd9Q3TfKjLLyZdZNMOTvOPm/wCorrvt Rljky6yaYcnec/OCf/sd132oyy8mXWTTDi7zp5x+pLtvtRljky6ymmHJ3nbznh//ANlu2/VGWXky 6yaYcXed/On1Nd9+qcscmXWTTDi7zz51T/8AZ7vv1Tll5MusmmHF/nvzun/7ReN/qdYXXl1lKh53 +ffPCf8A7Ted/qdYXXl1Khxd5+89fVV53+q1hdeXVKhxd/uB58+q718wqtYXXl1Khwf/ALg+fU5P Nl7+YVWsGvLqVDi//cLz/wA3m29/MarWF1z1SocXf7h/7g/V18+Y1esGuepT+yzyNKgFIKBQqhFA oVQgFUAEUCoFUCgCCgUoEFAAWAFAAAKAAAALACkAoAALAAQAAAAB4axkUU1CPiPSDlOiIAAAACco HqlqSR6WmVdEAoFRALiRIOL6ZVwohbHWQj5awEj6LVihhpQAAAAAEAAAAAAIAKgAAAABBAoAAAAA AAAAAQIBUAAAAFAAQCAABFFAgACEF+4CAFAgAggUAgAghQIoEQCBXmnvxULCPiVUzlOsQzL409+F TpDL50xYqbhHFSowBArKhGF5wqIkQjqyUqkmVeqXTKpmZWntlUfIYnJae6VR+wxOTVPbLpUTmMzk tPQ2RDmM2OiS4EtVRhLVpGgXFICIBVQAFAECBACQAgEUCKBkDKgTnAzEDKqBlVAyqgZVQMqpRhVA wrgMK4Dk5/KVHF0wo5K8DOMUYVwHNXAYVSowqgYUDCgYVAMqhRnFAmISxnEFjKsFjKsFjCsFjCtA 5uaUcnNAw5AOTkKOaoBzcgRxcmEo5qBxcUcXAcVKOLio4uA4OKOL15So873FHnc4qPO9SjzvKOTi o4OKPO9AMKgscHoB/W6efnL/AKcmm/5Dyam9Lonnty/6emm/5BqNLonnhy/6eml/5BqNLonnVy/5 BNL/AMhNZpbTzk5f8iml/wCQazQ6J5vVf8l/3v8AyDWaW082qv8Ak/8AvP8AlGs0Np5qVf8AJ/8A ef8AKNa6G080Kv8AlP8AvP8AlJrNDSeZl7p/3n/KNZoX1Mvdf+8/5RrNCp5lVf8AK/8Aef8AKNZo dW+YHL/lf3/+UchodUvir/l/3/8AlJyGhtL0q/4H7/uHIaGkvCr/AIH73uHIaG0uyr/g/ve4choa S6qv+D+97icpoaS5r/C/e9w5V0NJcV/hfve4cvY0NJXr/D/e9w5exoaSuX+H+v3Dl7GhpK1f4f6/ cTl7HG0lWvU/X7hy9jjXav7H6/cObscbSVP9j9Y5uxxqlQvV/WObscbSTv7P6xzdjjXO/wBn9ZOb sca5z2Dm7HGuc9g5uxxrj+wc3Y41xvYObsvGsRzdjjVCc3Y41HN2ONYDn7HGsBz9jjMUc/Y41xPa OfscZie0nP2ON8S/177bTrObJz0IYMbF5f6FOmG7cpO3T/Er1/vRMtlSslbCkz+1tWL+rMqe7Dbu HGfB8v8A9e3/AE8m+f8A0DfD3Sz/ANe3/Tyb5/8AQHD3LP8A17f9PJvn/wBAcPcs/wDXt/08m+f/ AEBw9yxP9+3x/wD+eTfP/oDh7lvu23/eV1ZD/wAkRkfFR/8A4kOeW3Sw/UUv+4T56IvwzFj/AD4/ /wAZxnwbiH1ZXm+bM5LfD/tf+QxOS6XulX+pmwhQf95/yGZ3F0PpSK2rmw/8HD/4/wDlMzvQvG+p JbOd+3KRv/xR/wCgxP7HZeJ7GyUVMOAz8nsvF3YmS2twpBR8jscXdxZUNjirg/pLz9k4u71sRHpF FJ8jsvF3azftJ8nscXczftHyexxd0zftHyexxdzN+0fJ7LxdzN+0fJ7HF3TE9o+T2OLuYntHyexx dzE9pPk9ji7mKPk9ji7pij5PY4u5AfJ7HF3SA+T2OLuQHyexxdwfJ7HD3QfK7HD3B8rscPdIk+V2 OHuRL8nscPdIk+V2OHuY3sL8rscPdMb2E+V2OHuY/sHyuxw90x/YPldjh7mc9g+V2OHuZz2D5XY4 e6Zz2D5XY4e6Z32D5XZeHuZ32D5XZOHumd/s/rHyuxw90z39n9Y+V2Xh7me/s/rHyuxw9zPf2f1j 5XY4e6Z/+z+sfK7HD3NoXq/rHyuxw902j+z+snyuxw9zaP7P6x8rscPdNo/sfrHyuxw902n+x+sf K7HD3Np/sfrHyuxw9zav7H6x8rscPdNq/sfrHyuxw902r+x+v3D5XY4e5tX9j9fuHyuxw902v+x+ v3D5XY4e6bX/AGP1+4nyuxw9za/7H6/cPk9jh7ptf9j9fuL8nscPc2z+x+v3E+T2Xh7ptn8v9fuH yexw902z+x+v3D5PY4e5tn8v9fuHyexxd023+X+v3D5PY4e6bb/L/X7h8nscPc23+X+v3E+T2OLu m2/y/wBfuL8nscXdFrf5f6/cT5PY4u7D7jiNV2b5Pb7i/I7HF3fmbr5qSmjClR8P7ap/8qnbDcv+ GJwfirj/ALirIVU+GI6H85U/+Q9WPi5zD83Vf7rqxV/8mRf/AMhdWdoxYl8ub/u8rV//AMI1f/yV 1Z0jbZedf94l4G3el1ReMtn/ANYV4G3eV1ReMtP/AFgXgjd5XVE4y0/9X1X/AERu8rqhxlu0r/dS bOWCWRMPiV1ZJwofWpfP8+dD/wAmakfELqznNQ1EPvUnm2dNh/5UiR/nqv8A8hxyziG4wfepr/Mf CNAif9qq/wDynGd1qMH1pN3csP8AwaJ/2i5Jznea430Jd0Vf8sif/H7jE7/Zrjehtz/kJ2vcZ5+y 8baXP+T+97ic3Y4z4l/J/e9w5+xxnxP+T+97hzdjjPiX8n973Dm7HGfE/wCT+97hzdl40+J/yf3v cObscZ8T/k/ve4nN2ONPif8AJ/e9w5uxxnxP+T+97hzdjjPin8n973Dm7HGnxT+T+97hzdjjT4r/ ACf3vcObscbK3X+T+97hzdjjZW7fyf3vcObsaGFu/wDJ/e9xeXsaGFu/8n973Dl7GhFvH8n973Dl 7JoZW8fyE7XuLy9jQyt4/kfve4cvY0MLef5H73uHL2NDK3n+Qna9xeQ0Oa3tP4H73uHIaHN19T+B +/7i600Oa37+Qnb9w1mlzdf/AOQnb9xdZpcneYPD/v8AuLrTS5O8weH/AH/cXUaXJ3mBV/y/7/uG o0ua35e7J2/cXUaWVvy92Tt+4ak0srfvD/v+4ajSyt+8Mnb9xdRpZW+L3ZO37hqNLK3xe7J2/cNR pZW+L3b9/wBw1GlPjSr/AJb9/wBw1GlPjK93Tt+4ajSi3he7p2/cNRpZW7r3f9/3DUaT4uvd/wB/ 3DUaT4v4dO17hqXSyt38Ona9w1JpYW8fyE7XuGophbx/I/e9w1FMLeP5Cdr3DUU5reP5Cdr3F1FO brx/I/e9wspydeP5Cdr3Fspzdef5Cdr3CynJ14/kfve4tpTm68/yE7XuFlOLrz/I/e9xbKcnXn+R +97i2lOLrz/ITte4FOLrz/ITte4pTi69fyP3vcVKcXXr+R+97ijg69fyP3vcUcH3r+R+97io4PvX 8j973Foed14Vf8D973FRyddlX/A/e9xRxddV/g/ve4o4uuq/wf3vcEcnXSP+D+97ijk65r/B/e9w HJ1x/k/ve4o4vuX8r973BHF1z/lfve4tDi65fyv3vcKH9JtaeJ1d2tCuzWkHZrQOzWkHZrQOzWgd WtIro1oGwAR1Y0K9UthB3a0g6o0K6I0g6I0DojQNo0g6I0DaNA2iEVtEA2iAbRCDSNA2iAaRCDSI BpECtIhBpEAqIBpEAsCDUALACwCrAgsALAg+H5mkZ23PREjhT/ih0258UyfyB57krLuCovN96n2d nyeTN+OOzAAAAd6Wlm1U1suU1XKq8xJmlf6p5Y8o1s3N/wB07D7Dybm7Dpji/wBes/kic1jVmNxU 9p4s952jF+upPK9PJRMZIqhxncluMX1pVspZKYGIYnKVp3XMy0wQQiuL6yUzkVBpLcHXFvMXSluM 2tVWrARBb57J7nTOXnNUj9BSKqtSJzlp7YGVSAAgkAEAIAAkCKAQCQAkAIAgQQABkAFQCBEAhFQC AAIBIAQABkCAQgAQCAQCBUCIAAgVCCFEAhAgUQCAQghRCCAQAURSDKgeGvmYkpYG8YSX+dXufjOd /Se3bhxyfgLmuMqnrwcpfk61mFT0YsS+PPlrE6xLEvE6U6PIasRJL15EFlOsuhnTFgjVJOUFPr0V gmzVRXNU55bsNRi/XWzyuuCLf1Hmz3nSMH6+h8uNbD8KfYebLddIxfoqWytZD8Jxy3G4xfXk0DWQ wHKcmqexlMjeYza07tlohm1ptGgWBBYASACACAEAgEAigZiBlVAyqgZVSjmqgYVSowqgZVSjmrij CvCObpiFHF00tI4vmlocXTVNUjksxSjCuUDCqpUYUCKBlSjKgZVChiqpLFxFFjOILFSWLGklksM2 LGcQWJiFsRWksZVpRzVoGFQo5qgRzchRzcBycVHJxRxcpRyc4qOLnFHFzyo4ueUcHTC0jg55aHFz yo4ucpRydFSjk5qqEc1YWxhWgcnIUcXIVHJWixhWCxychRwepYRwdhNI4uQo5OQD+qGtPC6uzWhX drSDs1oHZrSDs1oHVrQOrWkG4QCopUbY2IHqlsIr1NaZHRrQOrWhXRGkG0aB0RoHRGkG0aBtGgbR pFbRoG0QDaIQaRANIgG0Qg0iBWkQCwINIgGkQCwINIgFgBYBVgQWAFgBYAeO4yEnUzmQjhT/AIlx nxSX8o/7m2iZLqpkxG/sqv8A/Up9b9fLwebOH+VHrcgDTJb5jkZLar3ryNakV/UB+18tf7aeYvME xipTPk07sKucmGBw3P2McW8cJl/vnlX/AGct9rly31kHTEgqp7f0nzt39qZ8nfHbp/pdJabbb2I2 TKa2HPA8s5TLrEQ7TKynlJCKJAlDxzLqxP2cJrSW8cy5TXfs4C6Ut5Xz5r+VylotyVXLzlRWxVSK 75tVaQYp5CrNSKc4mR+mp5eK1DlMtO8CKQIIAgBIAAJAipAABIAQBACEEgBAJAABIBUAhBAJACAA MqgACAQghRCCBUAgQCoBAIEQioBCiACCKBAIBAIoEUCAAIBFAgEAigZUD411eqS3Ih1wZl/nV3ir lPZg5ZPyFbKc5T04y5y+FUUiuXkOsZMU8D7c539U3GaUy20Ocv7MRrNL6VL5edMVIswGMt1Yxfo6 HywxIRZ+o4ZbzpGD9PQ+XpbIfgOGW63GL9HS2mXLRINOGWbcQ+pKpGN5jnOTVPU2U1OYzMrTojEQ guKgCBBYBQCAQAEZiBlVKMq4CK4DKvAyrwMK8oyrwMq4DCuKjkrwMLMKObppaHJ00tI5Om+0tDi6 aWkcXPKMK4qMKBCiQAkAJiixFaLGVYpbEzaiwSWosbSWpLFzYsXNksXNixMQWMq0WMq0DKoWxhUA yqAc1QqOTijm4Dm4o5OKjk4Dg9TSPM9yFHne9DSOLnlpHBzlKOLoqVHNWOUtjKylFjCyhZTCy0Fj m5iILHJyFRychRxchRychUclaBhyAcXqiFHmepqEcXJEqOaoLHFyFHFyFR/VjWnidXZrQrs1pB3a 0Ds1pB1a0Dq1oHREAiqBGpFQPVKlkHsYyCEV2a0g6o0DojQrojSDaNA6I0DaNIOiNA2jQNo0ito0 DSNA2jSDSNA2iAaRCDSNA0iBVRCDSIBqAFgBYEFgBYBVgQWAFgBYAZezGSCgf5R568oPuOcfLl4y OReROlyqevZ3acs8X+H1H+1d5nVTm0st0FXowHuj9nGnHjl+psf+w1VPVsy6VCsZzsTAcc/3I/hu Np/qdi/2y8p2BGuWUybNTCquguE8mf7GeTpGEQ/Yy6y30TEl0strWokERqIhxqZbtymXaa/BLbAa S3mdNqpvKqwLUDOYev7Si0MyiC1YVEQI5qUVGK7mIPXJplVUwEmVfQbSpi8hi1cmSEZOQsyPsy0g 1DnLTRAgBIAIASAEIJAKASAEAEEAkCiEEgAAgEIIFQCAAMwAgEIAEAioBAIBAIFQCBEIoBAMqAAg EAgACKBlQAEAgECoRBSjKgQigRlQMOKPlV8lZjVOmMpMPx1xtrnOVYHpwzc5h+dqLU5VX8J2jNin hfZ1WP4TXImlltjc5cDS8hpe+l8vJFItMZbqxi+7S2VjET8Jxy3G4xfWk25jeY5zmtPoSqZreYxO TVPU2WiGbVtGkGkQgoEjAKkQEQiYwVMYCYwEVwGVcBzVxUYV4GFmFGFmIBhZqdJaRhZwoc1nFoYW eKGFnloc3TvaKRxdNLQ5LNUtIyswo5q8oyqgZAQKiQAYosXEFi4hLUxBYqShY0kollLmRYuaFhmx YziCxMUWGKLEVosYVoGFaUYVAOaoVHNQObijg9yIVHnfNRDVDzuqELSW4uqC0luLpzl5i0OLnvXm KOTmzFLaMLJcpbKZWQo1FMrIGopFkoLKYWWiCxzc1BY4uQqOLyjg4qOSoUclaUc3NFo4uQo4vWBU ed7ug1A4ORVKjmrRY5uQo5OQDk5Co4uaLH9XNaeR0dmtCuzWkHZrQOzWgdmtIOiIBFWAHOMVKPRK YQe+VLhhIr0NaQdWtA6I0g6I0K6I0g2jQOiNA2jSDojQNo0DaNIrSNA2jQNI0g2iAaRoGkaQaRAr SNAqIBpEILADUCCwAsALAKsCBACwAQALBEi5YJ7QPlV90t0hFbMe17uhMJqMZSZfn5t8lucuzSUT 2wOmhm2Eqq6o51ROhBUQO0uiqJixeqktae2XbUT9ozOS09CUstnMSxHIxoHnfMROQtDzOeqlpGER XKB2l06uXkJa098mk5IoYmVp75chG8xmZV3SVgIrx1CJLejlLCPdJcjpaKhmVdCBACQAASBFSAEg BAEAIBIEEAQAzACBQCEEAkAIBAIAIJAoyQQAFQIgEUKgEUggEAgEAAQDIAgilEUCEVAiAQKARQMq AAgEAgEAioBlUA5vlo7lLY8FRQsfGKGoyZmHy5toRy4EwHSNxNLillZzoXkTS2lqlt5kJrXS6Nom N5iainZJDU5iWtNoxEJY0iIAiBcZCBjBTGQDKuA5ufAqMLNQUMLOQtDKzxQmfTpFBn0FCLOQUObp qChxdO9paRzdP9paLcnTi0jms4UMrNLQ5rM9ooc1mKVGFmKBlXlGVcoEiBMIFgpbDFILiiwxFFi5 sWNJLJatZsWLmxY0koljSSxY1iEsMUWqYgsTEFoyrC2IrBYyrRYwqAc3FHJylRyc9EKOL5rU5yxC PM+oanIaot531CryIWktwc97uQ0jkst7uUWCU8eUail2dCaikWQ3oFlMrKb0CymFlp0FsYcxBY5O aWxzcgRxchRxcUcHFRxcimhxc0WjCsLY5uZAWOTkKPO9UQsI8r3GoRwciqaRhWCxlzSWOLkKOLkK OTmlRycgHJyAf1g1p5m3ZrQru1pB2a0Dq1oHVGkFXAhRwe7mKNSmK5QPpSZRmR7GtMq6taB0RoHR GkHRGhXRGgdEaQbRoG0aQdEaBpGgbRpFbRoGkaBtGkGkaBpGgaRANI0itIgFRANIhBYAWAFgQWAV YAWBBYAeeoraWlarp01rYc3OWImUt+frPNkmXFtLLx3dZ3J9h0jbScn56qu9zr1VHTFaxf6rcCG4 xiGbcpVBNmrF6qv6SzJT69LbWNgqoYnJYh9eVJlS05EMTLTskyW1MBBh1Q1OQUPNMqY8haHmfOVe ctI54XAdGSVcLV7pNJ0oYmVe+XTI3mMzKvQ2VAg6o2BFawER8q6qrZLnJzG8SXms1zbNVZD1/EnI XPFIl945tECCAAJAigEgBIASAEIIFIBEgBAJAioBAIBAIqASAEIIAAgVkCBEIoBAMgAIBAIBFAgA gyBAoEZCoAAigQCAQggEUogBSCAQCAQCKgGFQo5PagHFyIVHF6oUcHOQqMLMQo5rNLQws72ihM/7 RQys/wBooZWp9opLTaU6RS2LUp0ihydPiWktxdO9paHNZ3tLSMrO9ooZWd7RQmf9paDP+0lCLPjz ihydNLQ5rMUtDCvUDKuUImMpRlVAgCADFILiCxcQWrSSlFjaSiWLmhZS5oWNJKJY0koWrWbJYubF i4gsXEJYYgsMQWpigRUCMqhRhQMKUc3KBxc5Co4PmIhqIR5Zk7oLEDyvmOU3SOStc4IJKQWU1mUF rSZtEJYisRBYyrQMqhRhUCOaoUc1QDm5Cjk5Ajk5Cji5pRycwto4uYWxzcwWOTmlRxcqIUeZ70Q1 EI8syZHkNRCPO5HOKjObLYyrIEscnIBychRxchUcnIUcnIBxchRxchUf1o1p5m3drQrs1pB2a0Dq 1oGoQA5THwKOLUVzio+jTyuTAZlX0WS4JAyrs1pB1a0DojQOiNIOiNCto0DojSDaNA6I0DaNINo0 DSNIraNA0jQNI0g2jQNI0Co0g0jQrSIBUaBqBBFVreVUQDGfkxgjkVRQ6tVHcgGodJBHTGN/aciA eGpu1NIRYLjO6ENRjJb4NbfaqbFsn8DfZym4whmZfCm56e6MxyuVelTaIymYmFRY9LElM5kIru2p Y3kJQ6JWw5yUW1t3tGktnbFXnFFs7SqihWuVwV3ZLVxkeyVSqvMSZV9CTSonMYmVexkpEM2rsjEI NQBaKBhVA8VdLzslzelCxJL8BPnTbbXI9FVERx6Yi4c/J/oFqr5dfTNmNVFdD8SHmyxqXSJe+BgQ AFQAQSAVCBACQAgECoBIAQiJAKkAIBIEEAkAIoVAiBUIiBUKIQQABkCBQiMlAggGQoERQqKBAIpB CiACDIACAQCARQIBAoEZAgUCMuUDzvcUeZ74GkeWZN9pqIR5XzfaWhwdP9paRxdP9paHJZ5aRhag tFsrPUUW5rOXpFCZ5ektBnlFBnvaShhZhaGFmBGccCK4CYylDGUgRUKmEImEBAKmKBcUWGIpLFzY sVJYsbSWS1bSUSx0ST7BZTokmBLVrNoSwzYsM2LFzYsXEFi5sli5sWGIgsMUCKgGVQoyoGFAwpRz cpUcXOKOD5iIWkeWZONRCPM96qaRzVqqWwSWSxpJYtVxCWIrQMq0DCoUYVAjCoUc1QDm5AOaoVHN yFHJyAc3IUcnIEcnFHF0Cjzve1DUQjyTJycxqIS3mc57jSOSy1XlLaM5tBa0yrEQWObkCOTijg4o 4uQqObkA5OQDk5Co4uQo4uQo/rhrTztOzWhXdrQOrWkG0QDExyNQo8bnYzio9dNKVVjAkj7EmVip EzKvS1pFdGtIOrWgdEaB0RpBtGhXRGgdEaQbRoG0aBtGkG0aBpGhW0aQaRoGkaBpGkGkaBpGgVcV vKqIRXmnXGip0VZs5qQ9pdMpb4tZ5ztNKiokxHKntNxtTKan5yq/3DWYqso2Y3Miokf18h0jZ6s6 3z0vt2rnxfNzTF5oxU1oiEuX6K11cqTB01zpr+lynPKGofd+NJCDGnPS1bg+6Tn8iwGkt5ZlTOfy uU1SPHMiuFSjzvSBUcHugBxdNVCjk6aooYzyloXPKShps5VFDuxyqQeuUxVMyr6MiQmAzMq+nIp0 wYDEyr6EuUiJyGJV6GtIroiBFgRCAGVQKw5ArhMhBYgfgvNUpqNc9uBUPRtSxk+B5a81pbqxJM5/ 92qwVFOm5tXDOOVP9gpqmTVyWz5LkcxyRRUPFMU6O0CKkAIFCCAAqEEAioBAqQAhBIAQCARUAhBA IBAqAQIhFQCAQCAQABlSCBUUIgADIVABBCjJAAgEAgEUCAFAyQQqhEQKyUCCKBAMqsCjhMmIVHim 1DW85qIR8+bVp0m4xS3imVZqMUt5JlUaiEtwWoiWkthZ0ectDKzfaKGc4BMcCK4CYwDGARUBFQGE CQUCwILAKqNA0jCWGbFhiCxUlksVJYtWklksaSVEWOiSfYS1ptJJLKaSSSym0lewWraS4EsXEFhi CwxBYubFhiEsXFQWEAIqAZAyqFEUDClGFCMOVCji56IUeeZNRDUQjyTJ3QaiEedz3OKjGIq8pbGk loSxrEQWGKRUgBlUAyqFRhUAwqFGFQDmqAYVCo5KgHNxRycqFHFzkQqOLpjU5y0PO+e1C0lvNMqO g1GKW8z5kx3IaqEclludyqWxMyiCykViISxzc0o5OQDk5Co4uKODio5KhRzVoscnIUcnIEcXIUcn IUcXIVH9eNYcGnZrQrs1oHRGwII5URCjwzpkVghqIQkS1c5BI+5SyIIhiVe9rTKurWgdEaB1RpB0 RoHRGkG0aFdEaBtGkG0aBtGgbRpBtGgaRoVtGkGkaBqCJy4AOE6spKdIzZrWw6VFTJb4tb5wtNIi /wB4jlToNxtzKTlD8rcf9z6eXFsiEeaGFTrGwzOb8nXf7h3SqiknGRF51wIdI2Yhmc3wJ97ulWsZ 1QrUXmb96nSMIhm3OW5HOjMcsx3S5YgfWpnrghgMyr7VLGKRU5yr9BRrgQxLUPry1wGFehqEV0xF VCDmslVFjC0rlwwFjyTqVycxbR5HU7o8hqxhaV3QLHF0hyCxEkuFjq2QvQSx6pUpSK98liJAzI+n IRMBiWn0ZUDMq9bFQyrqhBtAy1AIQAikWHF6oiBp8ysq2S2rhNRBMv8APvM1wY6U/DzHp28XPKX+ E3+9TKOpWZLcqQXmPoYYXDhMv9A/24/3XZKmMoq6Z/duVEVHKeb9j9X+YdMNx/Q1HWU1fIZU0sxJ kp6RRUPmTEx5uz0EEIqQAgVABBAqAIEVmAEAgACASBBlQIBAqEEAgEAgEAgEIqKEQCKBFCoBFIIB FAigQCKBAIBFAAQggVkoERAqAQCKBAIBFAw56JzgeSdUtYixU1EJb49VckSKIp1jBmZfHnXBzlWC nSMWZl431L3c5qktxWa5ectDKvVecIzjFDGUBEiqAwgWCkGkaBcUDSMJatIwWGISxcQWKksljSSl Fq6NkksbSUSyjNewWKkolq0kkWU0kn2EsppJBLWnVsgllNpKJarmxYZsWKjCWLiiwxRYYosMUBAo igZgBAMqgEUqMKBhSjm5yIBxfNRDVI8syo6DUQlvK+e5TVI87nuU0MBBIAaSBFWKAMZAIrkAyrkA wr29IGVe3pAwr2lHN0xvSKRydOYnOWhwdUtNaUtxdVIXSW5Oqi6UtxdVL0F0luD573chaS3ByzHF HNZb15VLaUysnpUWUzmkQWUisQWMqgHNyAcnIUcnIUcnIEcXNKOTmltHJzS2OTmixychRycgRxch RxchUcXFHFyFH9gtYcldmtIrq1oFXAB46icjYohqIR42Ir3FR9mip+RYGJlX2ZcvFREMq7NaRXVr QOjWgdEaQdEaB0RpBtGhXRGgbRpBtGgbRoG0aQaRoBz5ctIvejU9qgfNqvMNqo0XOT2qqcyKajCZ Lfmbj/uRbqaKSYKqciqp0jZmWZzfj7j/ALlVtRFtOjoc0MCHWNiGZzfl6vzHd6xVV83ERfbFTpGE QzcvlzJkyasZ01z19q4DSOcWN5EQoysxeYAjlVQPbTrhQzI+xTPRIGJafZppvIZmFfoKF8YHOWn3 6dsUQ5yr6EqTEyr2y6WKchm1ellCnQSynZKFsOQlq80+2o5MCFiUp5PhKx5C6ih1qRE5BqKfPn29 G8xYlKeRaVG8xbEWUiAEREA7y1gRXukv5DMq+hKVTMq9suJkd2kVtCMtooRFUFOUyYjcKqRqIfJr bjLlNXDhNxiTL8Zdr02DvxHbHBmZf5vfbwj2PRHdJ6sMHKZf455gnrOeqxj+JT24Q5ZPgy5j5T0f LcrXtwoqHRh/rP8At9/u1XeX58uluD1fSrBqqq4Ie08e/wDqxl4w7YblP6isHmS2eYqVlTQTmuVU i6XHCh8jPbnGal6Im32TCoQIBWYACKgECoQArMAIBCABAIBlUCoBCCAQCARQIQRQIBAqAQCAZUAQ QCAQDIACBUIiAQKgEAgEAigCCFEIMgYdMRCjxzqtjOc1GKW+XUXNEijVNxgzMvjVNe96rhOsYszL 5kyc5y8p0plyVVKMgIAIEEgUVGkVtGEsaRgsaSWSxtJZLVpJYsbSUSym0lEtWs0LDNCylSSSx0bJ jzEtadm069BNRTqlPAzqWlzAspMwLKaSQS1ppJKCxrNJ0EsppJZLVcRBYYqARUAkCBAoQAkAJACA QCKhUZgBFAypRhQMOcUcXOUqODoqVHnc1ymrHF0pyltHNZCl1FMrTr0F1FMLIUWlMLJcLKc1Y5C2 MKjijCq4IwquKMK5wHNcYowuOgRhXPKObleoGc053KWwWnJqKZWQnQLKYdIQuophadOgakphZLU5 hZTm5iJzFsc1anQBzchRycVHJSjmoGFQDmrSo5uaBychRxcVHFyoUcXKhUcnKhRxcqAcXKVHJylH BylRxcpRycUf2O1hyV2a0itwgEeefMRjVLED5Ex6vcbR76GnV7kwGZH6OnkoxqYDEtPW1pB1a0iu jWgdGtA6o0g6I0DaNA6I0ito0DaNINo0DjPrKSmarp85rETpUsRMlvz9w882ahRUbMSY5OhTcbUy zOUPyNx/3Omui2jlqnQqJ/0qdY2GZzfkq7zfea1Vxp2I1faqnSNuIZnKXwp1XUTljOnvfH2w/wCB uIR5lexORMPSUTOdAEx1UoYVILiqAxFA01gHolYFIPoyHQgZlX16V+FDEq/U2z8UDlk1D9ZSy/wo cpbfVkS0iZlX1ZUtIIYHoRhEmW0aGbFYgIlyVqBuJc3twEV8url8pqB8iazCbR51YqlREku6BY7M kr0EtXqlS1SGAzI+jJbyGZV7GJAyrrjIhFRZrU5wiLUM6RQ886vlsRcIofnbjfGsRURyHTHBJl+L uXmDC78R3xwYmX4e6X6KP/FzHfHBiZfhLneEdFMbpPRjg5zL8VV1Gecv/vKd4hh5SiAfpvLHnS8+ V6pk6jnuWU1cMuP/AAOW5s45x4tY5TD+nvI/+79m8xypdPXTG09byLjYEVfah8ne/Uyw8npx3Il/ qDHsmNR7HI5jkijkWKKh5G1IAVFQggVAIFQgBUVAMkECgRkiigZAgEAgEAhBAqAZABGQqEADIEAi gQCKQArIEUIBUUCKBCCKBAIBAIBAMq5EA8s6paxFwmogt8mpuEIwU6RizMviVNa5yrhOsYsTL575 znc5ukcHOVSjBUIECACAVcUgqMiLHVssljokslq2kollNpKXoJaurZK9BLKdG069BLWnRKdegmop 0SnJa0uzk1FNJTewainRtMnQSclp1bIROYllNpLRCWq4hLExBYmbFi5sWLiISwxQqQAyqARQjMAq FAiJAoASAGYAQoigZUDKlGFiEZVFKMK0WMqwtjCy0FoystBYwstC2MLLToFjCy0LYwsv2C0YWWWx ydK9hbHB8ktpTi6Spq0pzWSospzWQpbKZWSosplZMeUWUysguopzWRhFpTSSoEtaRzBY5uaW0c1a Uc1QDm5pRwe0to4uaWxzcwWjm6WWxycwtjmrRY5uRCo4uVEKOLnIWkcHvQtDzveaiEed7zVI4uVS jk5VKjk5VA5OiVHJ0Sjk6IHJ0So4uKP7Qa04tOiNIMzHI1FUo+NVTsZYIbiEc6eUr3IJH6igpcVq KqHOZWH1WsMq6tYFdWsIOjWgdEaB0RpB0RoHRGgVVYxIvcjU9qkV8+qv1qo0VZtQ2KcyLE1GEylv zlb/ALhUcqLaSWsxeZeY6Rsyzqflrh59utRFJTkktXkhy/qOkbUJOT8nWXmuqlVZ9S90eVEWB0jG IZmXy3T0jHlXpXCpqkcnT1UtI5q9ygZwqAgoFRoG0aFbRhBtGgbRhBcUDbUwgeiW6ECK+nSv/Ehi Vfs7OsVacsmofsqdURiHGW3vkTExjMwr7MhUVqfoMEvQgYVAgoIcXRI6QxiKoW3GbTYyAt86bQOV eQ1ZTDbeq8wsp0S3KnMTUU2lDDmJZTaUkOYlrTo2XigVXYpB55tTiopaHzJ9erY4TUYpb58y6Kkf xGtKW+TWXdYL+I1GKTL8ZdLyqY34jvjgxMvxFyvSxd+L9Z3xwYmX4y5XhVVyYx2xwYmX5qfVPnLy 4DtEMvOUCAAA6SZ86nmNmyHulzGrFrmrBUExY/1/yH/vTc7I6XRXdyz6OKNxnYYJ/wBB4d/9OMvG HbDdrzf0nYPNtl8xU7J1BUsV70istVSJ8rc2ssJ8XeJifJ985qhFSAECoBCKgAiooEAyFRSCARUA gEAhBFAgGQqACDIEUCKBAIBCCAQKgRAqAQCEEAgEAgEAAQgw5yN5VKPPMqWt5yxBb51TXo1FgpuM UmXxamuVyrhOsYsTL502eq85uIS3je5VU0jnFSiBCAUgQaRoGkYqksdGylUlq6tkqSyndsheglrT o2nXoM2tOzKZegk5FPQyl9hmclp2bTInMSclp0SQicxLKaSUhLVc0gspc0SxpJfsJYubFquISwxR YmKLExQEAIqARUAyoGVAyBFAyUAJACAAiFGQIqAZAkAMqhRIARUAzAoioEZVAMqgGFaUYVoGVaWx hWgYVpbRhWCxzViFsc1YW0c1YLGFYWxhWCxhWFtGFaLHNWlsYVoGFaByc0to5K0owrRYwrC2OTmo W0cXNQo4ughUcHuQo4PmNQsQjzPnIaiEt53zlNUluDpjlNUOLsZSo5Oa4DCsUtjmssWjk5qFsc3N QDk5EKjk5Cjk5AOLkKjk5Cji5Cj+1GtOSquBAPl1k+CKiKaiEfKSL3mkfdtlLjKiqhmZWH6aVKRr URDm09DWEHRrArq1gHRGEG4NbhcqJ+kDhOuNDTJGbOakOaJdMlvkVXnC2yIpKjNcnM01G3Kanwaz zxVuRUp2JLTpcbjahnU/M13mSvqI52pdDobgQ6RhCTL4M+4YyxVVcvS5Y/8AE3EM28MyscvOWh5X znO5y0jiquUokFUBiqBpGEGkYBtGAaRhFaRgGkaBpGkFgBYAWAG2cpFe+ld+JCSP2VnmfiQ45Nw/ X0878LTjLT2yJmEkq+5STfww9iHOYV9BqxIzLoiBiZaxQls5sLqVJZDUubQJqZWSga1pmUIazNID UysoLqZWWRdTk+UG4yeKexUiWFfIqXKkTUI+HVvVInSGX5+qqHNjhNxCW/O19c5EdhOmMMzL8Tda 90VwnfHFiZfh7jXOVXQU9GOLEy/OzZizHKqqdIZcygAAEAAAA+tZvMV1sU5s6gqHMxVjiRWBjPbj LzWMph/vfkz/AH2bMSXSXtPxcmOuBftPm736X8w9GO7fm/261eYbTeZLZtFUsfjJHFikTwZbc4+b rHi+qc1SAECoQQKgAioBCKyBFQCARUAhFRQIBkCERFKqEEUCARQMhQiIFRQiKFZIIpQIIoGQAEUC AQgilVlVRCDzzqlrE5TUQj5VRX9Cm4xZmXzZ1a5ec6RilvnT6hXc5uIS3je9VU0jkuEqM4osTEFh iKBUlr0EsbSUq8xLV1bIVeYllPQylVeYk5LT0spPYYnJaehtL7Calp2bS+wzqWnZtMnQScinVshE 5jNrToktEJYuILUxCWGILFxBYuKhLDFCoqBCAVlUCJAKigQDKgZAihGVAyUZUghQgBAIoEgUSAEA kAJACQCIqFVFQIioBlUAyqAZVCjKoBlUAyqFGFQIyqFGFQDCoUc1QIwqFHNUKMKgGFQqMKgHNUA5 uQowqFRzVAOaoUc1QDm5UQqOD3onOWh53zmoaiEt5Xz+g1EJbzPmuU1SOKpMdyIXwGdmmO5RqhKR aNedRrWmFpWpyjUU5uky2luUp53pLQsWOD3sQ1SPO+Y0tJbi56KaoclWIRhUKMKxVFjCyiWU5ulI WynJ0tospxc1pblHFzWluR/aKIZHkqp6S2rhwmogfnamox3LhNxDKU8xuMkVEwP1lpmS1REikTnl DUP0TERUSCmFdURE5VQDMypppCRmzWth0qKHy6vzVaqRF/vEcqdBqMJlNT4VT59xotpJUehTcbSa nxarzLc6qONOzbV5m8pqMIhLfKm1rn4Zj3TF/tKapHlfWOhBuAtDxTal7uctI8b3uUo4ORVKjOIo EzYDNgaRgGs2BUYFaRhBUagGoAWCAWBAgBYAIAIAaagHtpU/EhmVfq7W7Fgcsmofp6WdHB7DnMNP sUiK6BiVfcpUVEMS1D60tDLOT0taHGZbgEsgCyBAgBIECAEgFSBC0xQtsuZELGTyzpOMi4COuOT4 dbTKkYIaiWn5utkrhOkSkvzNdJdhOsSxL8pcZTvxHXFmX4e6yXfiO+MsS/FXCU7GXlO+MsS+M5IK dEQAAAACAAAAOTCgH37L5uvNke11LUPxG/1VVTlntY5ebUZTD/a/KX++UxcSnuf48MFV3LCHSeDd /S6O+O71f7VZPNtovkpjqae1JjkjiKp8/Payx83WJiX38C4UOaoRUAhFQCBUIIFQCKBCCKgVkCKB CCARQMqAAgEUgyFQCAQggEAgEAhBCiEEUKirADm6Y1OctI5OqGpzii3gqK5GosFNxilvjVFY58cJ 0jFmZfPfOVTdI4OeqmkcXRUDOKUEYQaSWLGklRJY6Np1UlrTsykVeYk5FPSyiToMzktPSykROYxO S07tpkTmJqWnZshDNrTokpCWNJLQWrWISxcUguKLDFCmKAgQSAEAigRQIBkCARQMgZUCKBlSiKQZ KIoEgBIARQiASBQgFIBEgBAJADMCiQAioBmAGVQqMqgVFQIypRhQMKgGVKOahGFKOalGFCMqgGFQ oyqAYVpRhWgcnIVHNyAcnFHJywKjzTJqNNRCPHMnqvIbiEt51SY/pL4IbNMdyjUUux9JNa0uzS28 sCapKcJs+lkp+N7U/pNREyXD5lRfrfJimcRVQ647GUsTnD5c7zTSxgxUOsfqyzO5DxP8xZz9lfsN x+vScjit1mP6TXFEJqZWsmOGiC2FnuUaS2c45RQ01XKSRuC9BlUVHdBFYXGCObld0gcXKvSUcXfp NI5OA5ORego/s6onNlMVykiB+SuVzTGVEU6RizMvgzLi2MYm6ZtwW8Nlr+0XSW+nQeZXMVMRVX9B mcFt9j1hWMb+FrjPHC6nhn+b7rMijVVqe1fuLG3Cany51zr6lYzqh0F5mmtMJbgjkjFfxL0rhKOi TXcxKG0VzgGbcoGXSXAcnSVKOTpK9AGFk+wCZr2AXNATNATNgMQC4oDFAQAQAQAsAECCwAQAsAK1 MIV9Ckb+IzI/RUKwOctQ/Q0DsZ0DnKw/U26XjQOWTcP0MiRBDErb6EthHHKXeBacwUAoCAAIAEIp ACQIJAKy5sQsS8k+mR6KioR1xzfnbhblSKomA3GTb8vW0K4cB1iWZh+Zr7djIuA6Y5MzD8bc7Sq4 34TtjkxMPxVys64fwnfHJiYflKy2TGKqoinaMmafLfKexYKhq0YKAAAAIAAAAAIqosUWCpzgfp/L 3my42iczFmuxG8mFTjubUZN45U/oHyj/ALpOnS2S6p2OkWpFfbgPmbv6teT0Y7j/AFe33yhuLMaV MRF5IKp4ssJh1jxfSwLhQwBBAqBUIIFRSCBUAigZUCEEAigQCKRWQIoRAqAQCKQQCKBAIpBlSgRU UDKqiBHGZPa3nLQ8E6tROc1GKW8MyuVY4TelLeWZWOXnNRilvDNnudzmohHlc5VNI5LEomKQMQCp LFq6NkqpLHVtOpm1p6GU3sJORT1MpvYYnJaehtP7DM5K7NkohLWnRJaEtW0YSxcQli4otVxSCwAk AEAECDKgQCKBAIBAMqBFAigZUCAZUohBlSiKBkCAQBACQAQAkCiAIASAGVQokAJAIioBkCKgGSjK gZUDKlGFCMKUYUDCoUYVoRlWlsZxRYitAwqAYVCjCoBycVHJylHB7kQqPLMnNaaiEt45k5zsCG4h Lc0kzJi4eQtxBTq2ka3C4zORTlPq6GkaqzZrGonSqFjHLLyJmIfn67ztZqWLWPzrk5m4T0Yfp55O c7uMPzVZ/uHNdFKWRBOZzj1YfoR/Muc7/R8Cq823ipVf73EReZD0Y/q4Q5zu5S+VNuVdOWMye9Y+ 07Rt4x/DE5S8znvcv4nKv6VN0jbHYq4VJMD2yahuBDlli1EvpyEnzYZuW5fbA45VDcPqSbXWTIK5 uKhxy3cYbjGXsZZ1b/1jjlO81odNippf7SxM65ldMIrZDcDGxHieDk5Hr+zLgntKOSy5jkjgh7MP /AXA5rTvXDFV/Rg/4l1JTDqb+n9KjWtObqdEXmh+j3jUU5ukt/R9g1JTk6W0WU5OYhbH9UXiockt YKd8Yc5f51caicr1gp2iGJfHe+odzwNoyyUqui9YqB9ejdiwgZlX0VeqoZVyVFVSo02W5Qrq2Qqk HoZTKvMSx7JdKvQS1eptEsOQlgtEvQLHJ1J7C2PO+mhHALHmdJQqMZtAMKyBRhUAwqARUAkAIqAS ACAFgAgBYECAFgAgBW8oHupnYqmZV9qjmYUMSr9LbXfiQ55NQ/Z2tUihxybh+nktRUMMZy9TWwK5 TLRUAIAIBKAAQABBCAFCCK2JFt5p1O17VSAdMc352vtvKqJgNRk6+b87VWxXIuA6RklPz1bZMZF/ CdIzZmH5ev8ALyrH8B1xzZnF+Tr/AC4uH8B1x3GJxfl6zy46K/gU6xuMzi+LP8vzUjBqnSM00vnT bRUy+RqwNRnCU8b6adL/AGmKatHJUVOVCiEAAAAAERV5APRIpZs1yQavSSZKfuLBR1cpWKkYRauD 9J5tyYdMYf7B5bm1srFwu/b5cJ4dyId8X+vWuomTZLc5GME5TwZQ7Q+mYQCoQQKgEIqBUAhBlQIo EUCAZCopERQqAQCKQQCKBkABkCEEWAVhXogHCZUtahYhLfPn1yJyKbjFLfOnVjljhNxilvDMnKq8 pqIZcVepRhXKpRhUiBjEAubFipKJY6NkKvMS1p3ZSr0EnIp6WUnsMTktPQ2lToM6lp2bIROYlrTs kpE5iWtNowliowljWKRVxRYYpAgAVAIBAqBEAgVFCIoVAIoGVAhBCiAZAigZUCKBlQIoGVQCBACQ AQAgCBRIASAEAioBIFEgBFQDKgZUoyqBGVQDKoUYUDClGVQIzAomKQZVpRlWixlUAwqAc1KOblgV HFzijzPmonOaiEeSZUJzG4hLeV85zsCGohlG00yZhdgQTlRSzdko2K+omNYiYYuUkXl5L4Q/K3bz 9a6HGl0n/iJqYPw8kT17X6WeXn4OWW9EeT8RcfPF4rVVstySJa8zeU92H6eGPdwy3pl+dn1lVUqq z5z5ir1lWH2HpxxiPKHOZmXmNoAQCAeqkttfXORtLTvmx50TB9pjPcxx85WMZnyfpaLyHXTYPrZj ZDeqmFx5M/3sY8vF1x2J/l+ipfLVnoESKZ16cqrhPJn+zuZOsbeMPotZLlpCRTwTmWEDjMzPnLbD s87na1OdEwr+ovgOTqdzo4yucv2INSUzszU5k/4qNS0yspESHu/4CynNZbUWKIkekWOTkKji5AOL kKOLkKji5Cji5Co4OQo/pm8OixT14uMvwdakXqdYZeFWlRhEwlH0qNiqqGZV9hspMXCZVlWsReVA OstrOkD1S2MIPZKlswEV75UlmAyPWyS2BFV8loHkmS2pEo8E5GpEqPnzIGkcFgBzcUcnAc1AkAEA IqASAFgAgBYECAAAAAoHaW6CkV9OjmKjkMyr9Tbp3IcphqH7G2TkimE5ZNQ/ZUbsZiKc2Nx7TUQ5 BaQFASlCABCAAIBAIIAIBFAOE2S16chHTHOngm0DHRwC3WMoeKbaJb0XANS+D5dT5da9Fg1DUZlP gV3leKL+D9R0jcScX5ms8rJh/B+o6xuMzi+LP8q4f2DcbjOl82d5TjH8H6jUbqaXyqjyZjR/u/1G 43k0PkT/ACKrowlr9huN5ND58zyHNwwlqa500PI/yJU8zVLzwmhxXyNV8yKXmg0I3yNWKuFqjmg0 PbI8hT1VMZir/QZnfXQ+5Rf7eOc5Iyo4eg55fsNRg/W27/bdVRv9zzdHtOGX7Lcbb9pbf9vEloiq yHIefL9huNt+yt/lampUbFMKLE8+W7MtxEQ/QSpDJTcVqQQ5TK26QIAGQqKQArJBFCoFRSCAQCKQ ZCooRAqARSDKgQCAQgigZVUQK5umNTnKOD6lqc4pLeWZWonOajFLeSZWrzKa0pbxTalzuc1EFvG+ aqmqRwc5VKjCgSADFAuIS1aSWLHVsmJLHdlP7DMytPSymToM6lp6GyETmMzK06pKROYlrTaMQljW KSxcUitYoCCEsWAEgFAiKRUAigRQIBFAkAIBAIBlQIBFAyBFAkAIoGQIoGQMqgEAASACACAEKJAW EAJACQAkAJAqJAKyqBEgBlUKMwAyqAZVCjKoEZVoGVaUZgLEVAMqgGFQow4I4uciFHF74GohHlmT 2onKaiEt45tT0G4xS3kVz5iwQ15I2yje7C7AhJyKca24Wq0y1mVc9jIcyqkS44Z5+UE5RD8Jef8A cpPxSbTKjzZ12BP6D6G1/wCf/OThlv8AR+BuF6uVzerquoc9F/qIsG/YfQw2ccPKHnyymXz0a53I ir+g6MiscmFUVBYyBAPRS0NZWvzdJTzJzlwfgaq/avIZyzxx85WMZnyfp6HyDcpyI+vmy6OWuFWq uM+H6EwHkz/ewj/58XWNif5fpqDylY6GC5p1bOT+vMwpH9HIePc/a3Mv5p2x2sYfcRjpTUZLZLp2 czURI/Yh57vu6MrJxv2lc/8AT+FBZSZmHIiN/Qn3kspl0pOfD+kWUwrUTmFjk5Co5OQo4uQo5OQq OLkA4uQqOLkKOLkKODkKji5Cji5Co/om6Tvwqe2IcZfjKuamMp1hl4XTUKjLHOe6DUiB+ltNtqZ6 twQRTGUrD9jS+WJkxqK5qqc5zap9FnlLnzf6jOtadm+VYf4f6hrKdm+WUT+oTWU7N8utb/U/UNS0 6JZGt/qk1FI62IxOQWU+fUU2JE1CPjVH4YmoR8yc/lKPG9So5KUYUDk5AMQAQAQAigSACACAFAhB ALhAASIHRi4SK99O5UVCSPv0U6EDnMNQ/WWyowphOeUNQ/f2qbjsQ4ymfk+sahwU0BBABAIAUIIQ ABAIBBCARQDKtRSLbCy0IupFlooXU5Pp2OTCiKRuM3hnWuRM5WoW5bjOHgm+X5DuRE+wuuVuHkf5 Zlr/AFULyHg87vK7Oqg5CoZTypKXlag5VqGvR9MvK1ByylQz6MpV5k+wnLJUInkqj52oOaSodW+S 7cnK1PsJyyeDq3yjbmrFG/qQnLK+D2SfL9DJ5GIsDM5yXD6EukkykgxiJAzMmp1xUTkIWQIIBCKg VFIIFQKikECooEIqARSCKBlQqAZAikEAigQKihHN0xreVSUPPMqmt5zVFvHNrkw4TUYpbxTKxV5z UYpbyvqHLzlpLed01VLQwr1Uo5rhA5qgExVAmILFzYsaSWSxtJUSWruyR7DMyr0skewkyU7tlQ5j MytOyMgZtW0aSxpGi1aRpLFxSC4oCBFQCKAAigZUCAFAhBIAZUABFAyoEAgEgFRQjIEUCBUUIyFR QjIVlQiAIAIASBQAASACAEgBIFEgBAIqAZgBIARUKMqgRFQDKoBlUKMwAyqAZVAMqhRzcpUcXvRC wPLMnonOaiEt45lV0G4xZt5JlSq8hqMUtwhMmLgNeCOzKNYY0xYJzxMzmtPm3PzDZbKxVnTmumJ/ UasVOm3sZ7nkzlnji/zu9f7kV1UrpNtZmZa4Eev7R9La/QxjxyefPfmfJ+SWRebvNx3MnVD1XldG B7NWGEdHKpyfpLT/ALdXKsRJlYuZZ1ec8u7+/jj5OmOxM+b9XT/7dW2QyL0x3onK7CePL9/KXaNi IfEuFsoLc2Y1rG4ydB3w3MsnPLGIfjZtLV10x0ulkOfFcCNSJ7YyjGPGXGYmX1aHyFdqiD6xzKOU vXWLofoQ5Z/u4R5eLcbMz5v1Nu8k2WlgrpUy4Tk5XTMEv7OQ8e5+5nP/AOrrjs4x3fpGUqU7Elsz dLLTklympH9R5Jyvu61SpIbypLV69aYv/QTUtNZp64HOgnQ38KfqwkspM01vIgsplzQOTkKOTkA5 OQqOTkKOLkKOTkKji5AOLkKji5Cji5Cji5Co4OQo4uQqODkKP6GudOuKuA98PPL8lUUqq5cB0iUc W0OMsIC0fctNjWdMb+CMVM5ZNRD/AFny/wCWWS2Nc9h58sm4h+ykW2VLRERqHO2npSkZ0EGtkZ0I EtlaRnVQK5vpWdBR4p8lrUXAWEfDrFRsTUI/OVj1wm4R+fq3LhNQj5E12E0jzq4oxjIBlVA5uVAM xQoRQgkUAmAABIgRVAmMBUwgWAFIIBI+wDbV9gHtkLyGZV9imWEDMq+/QT1a5MJzmGofvrHWIuKi rynHKGvN+tasURRi88w0bQAEAUIQCAQAoQQgEAgEEAEUIBBCCQCpAisq1AtorUIWyrUC2mKnQRbI AtIEW0gBIEVArIEIqEVAIFQioBCKihUAyRQCKRWQqARSCBUUCKQZUCKBlVRAObprU5xQ4vqmN5y0 W8c2vRORTUYpbwTa1y8imoxS3kfUOXnNUjg6YqloYVwGFiBIAIEFxQLmxYZolqqSvYLG2yFXmJZT s2mM6lp2ZTEmVp3bJRDNlOiS4EtW0YS1aRhLGkYSxrFAQIqAAIBCCAQohBAAGQIFAjIVAIBAIpBF AgGVAgEUCAZUCAZUCAZUokAEAEAEAEAJABACAAiQAkAJAokAIqAZgUSBBlUKJADKoBlUAyqFRlQM KUcJkxGliEeGbVNSOE6RilvDNrFWMFNxizbxvmucpuIRGypkxcAmaKehtG1iY81yNROWJic1p8a6 +bLNZ2uTOJMnJ/VbhO+3+tnmxluRi/z65ec75fJi09tluZLcsExEWJ9Db/U29vxyefLdyy8nW2f7 dXi6OSpuk1ZTHLFcdYuUm5+/hh4YrjsTPm/c27yDYLe1MaRn5icrn8n2Hg3P3dzL+XfHZxh9+XQ0 khqNkyGS0TkRrUQ805zPnLpUQTXy5SRcsE5kERY+ZU1M+axzZLUltXBnH4EOmOMR5szL898GpJ01 XzsesmqsVa3A37T080xHh4OeiH1JNt2dkGtlUcvoYiY32nHLcvu3GNOraeSixZLdOd15nJ+szOUr TosqY5IOdit6rMCfeZuFoSQxnIgspFaBzcgHJyFRychRychRzcgRxchRychRychUcXIUcXIEcXIU cXIVHFyFHByFHFyFRxchRxchUf1JdaCDVwHuiXCX5KdRfjXAbtHoo7Ws16Ji8omSn+keW/LzWo2Y 9mA45ZNxD95JkNltRqJCByV3RoS20aGbaxQlorAsS5uYGol82slwRcAhp+arZaqqm4Zfn6qQqxNw j4VXTrhwGoR8WfTuiuA0jwvlPQ0OCtegGVV4Rxc5wGUepRccimOEaRQNRCsqoGFAqIB0QgsQCqBm IGYgbauHlIPoUqRVDMq+3Il4ImJV9CSuKqElX6iz1Ssc3Ccsoah/olDPSbKTpOceDG5H8vYdYcgt ASgIBAFCEAgEAioQABAIIQCKEAghBCKgEIqBUVCDIVAqEVCCKgVkKhBAqEVFAyRUCopBFCoFRSKg EIqARSKgVhXInOBzdOYnOKHN1SxBSW4urGpzl0luLq5vSXSW80yu6FLpLeOZWuXkUsYpbyvnvdzm qRyc9VKOaqoGVAkAGKQMUBiCxUYS1bRhLG0lksbbKJauzZCdBLV3bJROYzY2ktCWraMJY0jCWraM JYuKLFgRUAAQggEAgADIACEVlSgQRQIBAIoEAgGQAGQIBFAgEUDIEUgioUZUggEKJABABABABAWJ ABACQAkAEAJACQKJACARUAzAqJADKoBIAZVIFHNygclUqPPOnNYixU1EJMvkVFWqqqNU7Y4szLwO c96m2W5dLMmcxJyWnp2aTTtx570aicsTOqZ8lp+fu3nO1WxrmSFSbNTmbhwno2/1c8/Nzy3Yh+Er PMHmTzHNzFDLe2W5YIjEU9+Gxt7UXLhOeWXk+nZ/9squqclReZqtRcKs5XHLd/8AQiPDFvHYmfN/ olt8v2u0y0ZSU7WuT+uqRd9p83c38s58ZejHCI8n0VQ5NMKhR46msp6fA96Y/M1MK/YhrHCZSZp8 9Vq6pcaVJzbF/wAWby/0IdPCPNnxllaOQjo1Ex1TN6icn2INc/x4FOyNmQxZbWyWdCJh+4zcKJTt RcZ34ndZ2FRqKVWohLGFQDm5Cjm5Co5OQDm5Cjk5Cjk5Ajk5Cjk5Co4uQo5OQo4uQqOLkKOLkCOL mlHFzSo4uaUcXNKOLmlRwchR/Yt3pUxFwHsxcZfkH0mNNVIc50tl+msNmzj2uVuAxlKxD/RaWmbI lo1qQghyWZepGhmZbRoZttGhLWCFpLMVBRbKsJSxLx1MnGapHXGXwaqkiq4DUSr4tTRwjgNRKPhV dLy4DUSj4s+lSK4DVo+fNpk6DVjxvp/YVHmmSEQDxTJRUcc0pRlWKgGFA0igXHIJGIFTCB0RpFWA GVAgFxYgXEINsYseQD6dG3ChmVfoKdkUMS09CMgpB9S3uVrkMSsP3tnqfwtSJxyhqYuH6NqxSKGs ZeeYaOrIBCKEAgEAghAAEUIIQCAZEIoQCCEEVUIqRABUIIFZUioBCKgVCDKoFQioFQggVlSKgEIq BUIIoVhVROUK5unMbyqKVydWSk5xQ4ur5ac40lvNMuScxdJbxTLg9eQ1GJbzuq3rzlpLc3VL15xQ 5LNcvOWkZWY4KwrlUDKgSACBAxQJiCwxCCowKubJYubFjSSyWraS16CWOrZRLV1bLMzI6tYS1bRp BcUitI0g0jQLAihBAJACAQABAIRUAigQCKBAIBFAgBSCAZAKFQIyoEUKgRAqQAigQDKgQDKgSAEA QAAIAIASACAAIkAJABAokAJACQAkAJACQAyqFEgBlUA5uKji5UQo8NRUtYi4cJ0xxZmXyZ0981YI dYimZlmXRvmLFUE5UU7PSko2Y897Uh0ki8vI8Ifl7v55o6NHS6NM4/kRU5D1bX6eWXm55bsR5PyL qrzP5nnZunY9JTl5ookD2adrajxcbyzfqLP/ALayJatn3aYs2ZyrLTk/pU8m7+/M+GLrjsdX7ekt lDQMRlJIZKROdEw/aeDLcyy85d4xiPJ6FQyrDoNRVcqIicqqUfNnXOSjs3TNdUzeiWmD+lTpG3P8 +DOpwdJr6lMapmpTSeeXL/ah7VLeMeXilTKSpNLI/wDtpWcfzzXYf1r/ANAmZnzIiHRZUyZ/1rsH UbgQlxC0qSWsSDURE9hLBWgc1QDCoUc1QDm5Co5OQo5uQDk5Co5OQo5OQo5OQI5OQo5OQqOTkKOL kKOTkCOLkKOLkKOLmlRxchRxchUcXIUcHNKj+07vK/Ae2HGXwqO3Onz0gkcJqZR/oFrt7aWUmDCc p8SZp9RGBiZbRopm2oFpFNUBaAtBAk4jDmI5DEwsTTwz6ZFjgMu0Tb4dZIRImoV+cq5XKahl8afK TCaHzZ0tOgqPFMl+wo8M6XylR4HylVSjGZKOMyXAI8jm4SjMAEAEANsQg7ohFVWgZxAKjEAqMA1i kFaiRA+hSrBUMyr9BSLFEMS096S4mR66ditchJV+ptc1Wq05ZNQ/YU0zGYhmJctyHoOsS5qbQIAE IoQCAQQgGQJKoZsCWMq5EMzKxDks1Oky3pTOp0hdAs1OkhoYdPanOGowclqm9JGtAlS1ecGhrPt6 Qmg2hvSQ0MrUN6Qug2hvSQ0ItQ3pIug2hvSDQueaQ0GdaE0os1vSF0yws5vSRdBnWhdKZ1vSQ0os 1vSF0s55nSQ0mdb0hdLCz2JzhdLm6qlpzkpac3VjOktDhMrmpyKNKvHNuC8yljFLeGZVvcvKapLc FmvXnLQwr3dIGVVV5QMqBIBUgQSADFAYhAxAGIQXEFq0jCWLmyWGbFquaJZTSSxZTaSiWNpJJaui Sk6CWNJLJatowlq0jCDSMJY1ikVYAQCACDIACKBCKgEUCAFAgEAhBAIBAqQCIBAqERAqFEIIBFAi gQDIEgBFAgGVAgAAAAkAEAEABRCBABACQKJACQAkAJACQCJAoioBhQOblKPNNmtYkVU1EI+XUVsY tYdccGJl5GyJ1QsV5DczEJVtTplDbmK+omNRU5lUkRll5LNQ/J3bz1Ll40qgZjO5EU9e3+nM+MuO W90fCp6LzJ5nmRg9shVwudgaiHfLPb2oYiMsn661f7eW6lxZtcq1E5MKp/VPJufvZT4R4O2OzEeb 9dIo6aklpLppTZTEwQakDxZZzPm6xFOioRXGdNlSWq+a9GNTncsCxEz5JL5rrjNqFVlvkLN/mv8A wsQ66Ij/AOpZ1X5OL6FX/wB5c6hX9Epv4WfZzljP+sFdXVi4rcSkkpLZ1lSH6jM91TZ8Zcaa5Xu9 vJ9g1FOmIiciEsZVAMKgHNUKMKEc1KOaoUc1QDmqFRycgHNyFHJyFRzchRyc0Dk5Co5OQo5OQDi5 Co5OQo4uQo4uQqOTkKOLkKjg5Cji5pUcXNKP7hrqN01IIkYnthwey1WpshEe9v4hM2kzT7aNRCU5 TLUC0imqAtCmqQLQFoBQhiYHOaiYqnLKG8Z8Xwa9OUkOz83VNiqm4R8eezlNI+bOllR4JrIFHgms iVHldLQo4TEggHimu5So8jsKlGYAWAFRqqQdmMCuqJAgQAuKAxSC4oDFAqIFeuRgUzI+7RP5DEq+ 5IRHIhiWnvlySK+tRIrVQxKw/V0Mz8KHNM4uH0kWJvGXnaOsSgUABBDKhAIIZmRDEyqKsDMyMOmI hlqMXNZxG4weeZPhzh0jB4ZlTBeUU257ZDnFAtb7RQ802rXpFFvM6qWPKWhErVTnFFrt69JKLRa5 ekUWwtc7pGktnb3dJNK2be7pGks29yc5NJbSXJ3SNJbolyd0k0rbD7i/pGktx+IPjyjSW2lwd1ia S1+IO6SaS2HVz15xpLZ21/SNK2LXPhyjSW4urJi840pbntD15xQZ5684pWVe5ecDKxUDMFAQIEAG KQTFAmKFMUgYgGkYQaxCWpmxYuILDEIrSMJY2jCWNIwlqqSxY0kslq2jCWNIwgqNIrWKBUaSxYEV YARSABAIBCCKVUIIoEAKBFAhBAIBAIFSBBAiBQCKBIAQCKBCCKUQggEAkAMqBAIoEgFZUIgCAUgA gAgLCAtCAUgLCAtEgBIFCAEIECiQAzABADKoUZUDi96NLCPnVNaxkURYqdMcGZl8xz59U6DUWB18 IZ8ybsVvlrOrZrWwwwVRGrLwg8I835C7+fGoq01rZjO5Ech7Nr9P+cnHLe6Pk0Vi8xeZZmdnq+XJ dhxn4EO2e9t7XkzGGWT9tafIdroER9Qm0TuVVdyRPBu/u55eXg747MQ/Uy5MuSxJcpiMYmBGtSCH lmZl1pVQg81RU09M3GnzEYnMi8q/oQ1jjM+STNPnLWVtZgoZOblL/jzsH2IdNOOPnLNzPkxsFNKd na6atTP5kdhT+hpdcz5eBUfy6rMnPTFlNSTLTk6f6E5jNRHmI2nai4zvxP6zsKjUU2qEVhUAypRh QjmqFGFQDCoUc1QDmqFRhUA5q0o5uQDm5pUcnIUc3IByc0qOTmlHJzQOTmlRychRxchRxc0qOTkK OLkKji5AOLkKjg5Cji5pR/0A2dqrFT308et2RqIkELEMTKmqFNUgWgLQpqgLSBaAUIc5hXKcsGqc Mm8PN8CtWKqSHZ8KobymkfJnomEqPmTkTCaR82eqFHzpipEqPM9yIUeCe8o8D1ipUYgAgBpGxA7s YRXRGohBcUCYoGkaAgQIAIIBUQK9MlMJJH16RYQMSr79I/kMS0+7TtxkQxKvpyJcFRTMq+zRuVsD Eq+rLmRTCRxyxdkU3GTm0dIkDVoEsQxKoZsDMyMq5E5TEysQ5OnInIZdIwcXTyNxg80yf7Q3EPM+ pXpFK8syojzloeKbOXDhLQ8yzljyloM8qkoYdNUUODnqUc1e4CZxSC46gZVygZioCLiCKrgCK4iu iYxBVRQrGKoFRriDaNcQaRikVrNqBFlqpLDNCxc2S1M2Bc2SxFYBMQBiEUxAGIQTEAYhAxBatYhB cQC4hFaRhAxALiEVUaQaRoG0aZVUaBqBBYEVYAVGkGoEUgAIIBFAgEUCEEUKgACKQQCAQCEEKIFC CAQCKBAIQRQIAUDIAKigZCCkVlSiEEUCARQIBlQEAEChAgQAQAQAAAEAJABACQKJACQAQAkAIqBH NzkQo8VRVy5aLFcJvHG0mXyJ1ZNnuxZSL/QdoxiGJlzdKk07Fn101JbUwrjKW5nwgqvN+Wu/nmRT 41LaZecmciPPVtfpzPjk5ZbvR8WjsPmTzTNz9W50qnVf2n4Eh7DvnvbezFR5sRhlm/c2byLabVCZ MZtE/lxnckf0Hg3f3M8+zvjsxD9Q2WxjUaxqNamBERIIeW3QVArzVNVT0rcac9G9Cc6/oQ1jjM+S TNPmrVXCvwUUrMSV/wAeZy/0IdNOOPmxcz5I2ho6Rc9VOWoqF/rTMOH2INeU+EeELUQ26dPnYJaZ qX085KiC0ZIY3DyuXlcuFRORTaoRWVCMKgGVKMKgGVQDCoUYVAMKhUYVAOaoBhWlHNUCOaoUc3IU c3NA5OQqOTkKOTmgcnNKjk5pRyc0o4uaVHJzQOLmlRxc0o4uaVHFzSjg5pRxc0qP+gZ9SIfPU1QG qFLQFpFNUBaAtAWgMzAinLJXjqpiNSB55dcIfAqpiLHCIbfGqH8ppHyKh6YSj5U+YiRNI+VPmcpU eGY4o8c15R4JrolRwgAgBUYqgd2SyDsjYEVYAIAMUC4pAVAJABiqBUbhA9UluEyr61M3kMyr7NIm FDEq/R0SYEMS0+xKQxKvoSMEDMq97HQIzMO7XhznF2R0TUZMTCxNxKAsQzMiKpiZVh0xEMzLUYvL Nm+0jrji8b5+HlJTo5LOjzihwmTCjyPepR53PUI4vioHFUUokFIGKoVhWAZzSiwzKksaSSpLFzCi wzBLVttOvQLGtlXoJZSpSr0EtaaSnhzEsNnFhs3sJatJTw5hYuZ9hLFzRLDNi1M0Sxc0LEzZLUzY sRWEGcQBmxYZsliYgVMQBiEDNiwzZLFzYtVxCWLiEsXFCmKQVGEsVGC1aRpBcUguKFMUg1ikFxQq wIBBAIAUDJFQCKBACkEAgEAkAIBAoQQCARQIQQAoEAgECoBCCAAIBmAADIADKgQCKQSAGQEAKAKA AAAgAgRUgAgAgVEAQAkAJADKqiAeadUMlosVgbjG0mXx6i4ueqtlYVO2ODE5PMshzmrOq5iS5aYV VywNX/EJT4dw81UlIq01ql5+fyY/KkTvh+tOXjl4MTuRHk+VK8v+ZPMr89XPdIpnYfxYMHsQ7Tv7 W14R5sRhll5v1ln8j2i1QmOZtE9MKvfyR/QePd/czz7O2O1EP0zZbWNRrGo1qYERMCHlt0RYJhXA gHnm1EmU1XvciNTnXkNRjMlvlvr6utcsq3y4N5Fnv5E/QdYwjH/6YuZ8mpdtp6dc/WPz8/lVz8KJ +hCTuTPhBprzZm1r5n4JCYrOTG+4RhXmW4tYiLjOXGcvOvKamR0j0GRQqkGVQoioBlUAyqAYVAjK oUYVoGFQDCoUYVoHNWlRzVAOaoUc3IBzchUclaUc3NA5OQqOTkKOTkKOLmhHJzSji5Co5OQo4uaU cXNKji5Cjg5pUcHtKP8AoCfap84LSKaoDVAWhS0gWgLQCYEU55K5THo1Inl3Mm8Yt8WsnxjhOcOz 4dTO5cJpHx6idy4Sj5U+by4TSPk1E3lKj5018SjxzHwKPBNmFR5oKoFxFA22UqgdmSkQiuqMINYo EVoDFAsAJAgQAYoDFAqIRXolKiEH06d6YDMq+1RvRVQzKv09CiKiHOWofVYkDCvXIfBUJKvoMdgM pLaOgEp0a+AZnF2a9FFucw1FC2lMOeZaiHJzyNxi5OeRuIeWa4NvE9ViUc4qBh2EDg9AjmrAMrLi FYWUASSSxrMEsVJEeYWrsyjV3MSynVLevQZ1LTSW9U5hqKFoV6CWUraDpQmop2SiRE5CWqpSJ0Es a2VIcgtXF1NDmFlMpTx5hY2lMkOQljLpEOYljksotiZslhmhaqkklgsoWM5sljKyxasrLAmbILmx YisIJmxYmbFqubJYYgsMQgYhLVMQC4hAxALiEVcUgYoFxQpikDFINYoCBFWBBFAyAAyAIrIACAQg gEAAZIoBAJACEEUCAFAgEIIVUIAEUCARQIQQoikEAigQKgRAqARQiBUIAACgIFCACACACACACAEg AgBIARcAHGZObLSKqaiLS3yKq6IkWy8KnXHbYnJ4El1FV+OYuJL5VVcCHS4hnxl82uvtvtkZVK3a arkSGFEU64bOWfn4Qk5xD5su0eYvMz85VvWlo15EXBg9iHSd3b2vLxljTlk/W2nypa7SiOly0nT+ ebMSKx9h4939nPN2x24h9yEDg2w9zWNV71RrGpFXLgRELA/LVfmts2pWis0layeiwdN/w2/0nqx/ WqLymnKdzxqGkn1UUSoftNW7klS/2Gr/AEcpKj+PCC5euVa5k5UnXB8YYUlJyIZnciPDFqMer1TZ 8qnZiSWoiJyIhiImfNbp8ifNfNdFy4Og7YxTEsNUDokVIrq1qmR0RpFXFIJigRUAyqFGVQDCoBlW gYVpRhUAwrQjCtKOatAwrSjm5AOStKjmrSjm5oHJyFRychRycgHJzSo5OaUcXIVHJyFHFzSji5pU cXIUcXNKji5pRwc0qP79P0FPmqWgNUgWhS0BqgLQEoQxIy5YIebcyaiHy6yohFInmd8Yp8Gpn8uE 1Q+LUz+XCWh8ifO5YqaR8qoqEw4So+VNnRXlKPJMmlR4Zs1VwIpRwRiuWKgdElgdElkHRJaIBtGh VgQIASACACADFIEAEAqQAQA2xcJB7JToEV9ajmqiphMSr9dbZyKiHOYah95kFRDmrvKRUUivfLXA ZHQIRIro1wYmHTHDNMOcRqIclUNQwpGoeeZhCvK9MJUc8UKYhBhZYEzQGkkewljbaZV5iWrs2hVS WNpQIS0uHVlC1OYWmqHobTNTmIk5t5lCJrM0hDUiyk6AupM2hDUisBaYhF1IrAtsKwjUSzmwalxC FsOYgaiXJZSEVMygsazSELTEQKw5gHNWEGFYBlWBTEAYhBMQCYhBMQBikVMUBikDFAmKFIEDFAQI ECBAKsCBABAiqBFIIBFAhFQCAQCAQggEIIVUgQAjIUIIpQIIoEAhFQCAAIoEAikEAkAAECoEQKkC CAQCAQCQAigQAAgAgQWACAAoAIAIAIAIASAADm97WpFSxA+ZV3KXLRUasVOuO3bE5PjunVNY/FZH FU7VGLNzLM+ZR2uXnKl2cnczE6RjGWfkk1D5H/nfmOZmqdq09Ei4XciQO3/G1Hj4yz/1k/TWrytb rbCY5iT6nnmPSMF9iHl3P2cs+0OmO3EPuYsDg6JACKgH5i/yZ1wVKZ85aa3t/wCsxf25i9Cew9Wx MY+NXLlnFsW+2I2UkigkpTUv9aZ/Xd+lS57njc+MmOPR9qTS09E2DEi/ncvKpwnKcm4inGdOc7k5 CxCTL5832nSEeR6RU2yrGEmR6GMMzKuzWGbVrFIpigRUAmKBlUAyqAZVpRhWgYVoRlWgYVpRzVoG FQo5qgRzVpRzc0o5uQI5OQo5OaUcnNA5OaVHJzSjk5pUcXNKOTmlHFzQji5pRxc0qOLmlHFzSo4u aUf3yfpqfLU1QGqFLSBaAtABDEqyqnn3M6WHiqqhGNVInjym3XHF+dq6nlwiIbfDqanlwmqR8mfU cuEtD5FTU8uE1SPkT58V5SjxPmFR5ZkyOBAMMlqqxUDukuAGkYQbRoG8UKQIEAEAJigIAIEEgAAg VFQCAbaQeiWQe6mcqKhJV+nt06EDnMNQ/S005FRMJzmFfUkLjGJV7m8hFaIIFVFIkukQyighhSNM qRXNzYhXB0oDKSl6ANJKILmSK7MpkUMzlT0NpG9BGJ3HVtO1OYUxO5LpmmoKTVJm0JSalxUBZioQ sxQWyrSLaYpFtFaFtlWkW0xSFsq0LbCtI1aYoLRWkW2VQjUSxihbMUhZAFsqhGolhUC2yrSKyrAr OIAxCCYoVlWkEVoGVQCQIJACQIqQAQIJABAKQIEAECCwIEAqAQgigQCKRUAigQCEEAgEChEQKgEA hBAIoAKhBAAEAhBAIBAAECoQQCQAARQIBFIIUSBBFAgEUCQCkALAIsAEApABABABABABABACLgA8 lTVsktVVXCbxxtmZfnqy5vmKrWLgPRjt05zk5U1HMqHYz4wNZZ0RFvrbLMZLxKdv4l5zjq6t04yf Lcl8zP1zlnPjHF5iz+xNVCRt9X25cmXJYkuUxGMTka1IIcJmZbpqAEgBIAfLuNybTKlNITO1b+Ri f1Y9J129u/GfJnLKnCltb3u2m4Ox5i4UZzIXLc/jFIx6ve+Y1iYstIInQYiGnkeqrymoR534DUI8 U1xuGXFGxU1Y7slmZlXoawxMq6I0li4pFSAGVaURWgZVAMq0IyrQMq0owrQMK0DCtKMKgRzVpRhW gc3IUcnIEc3IUcnNKObmgcnNKjk5pRyc0qOLmlHJzQOLmlRyc0o4uaVHFzSji5pUcHNKOLmlR/e5 +sp8oLQFAAAAEkZVThnnSw8tRPbLauHCeLPK3XHF+erayMcJIh0fn6qp5cJaR8SpqeXCapHyZ9Su HCWh8moqFWOE1SPnvmxUo5KrncgGmSVXCpB6Wy4AaxSCowC4oVYAIECAEgAgBIARQMgMBBMAECkA KkSD0MIPZI5UJKvu0ToQMSr9BTTYQMS0+7RzIwOcq+uzCiGVaIJAAiEHRAyKgGVQi2mKFtMUhaKw LaZshbSSwmp1ZIReUUxOb0NY1vIhacpymWoFpAUBKAlCEoBShmhCUBKEgRbTFItpigtlUI1EsK0i 2mKC2VQjVsqhFtMULaYpC2VQKyqEaYVAtpAi2kAtpAhbKoRUVArKoRWYARUAioRWYAIASBBIAIEV AIQWAEgRSAAgigZUKhBAIoEAikEAgAgyBAoBAIQRQAEUioEQKAZAEEUKgQAhFAMgSAACKBCABkBA CBUAgRCKkAIAgAgBYAIAWACACAFgAgAgBIAFA+fW1bZDVw4TphjbMy/K1la+a5cJ68cKcplmklo9 6K4ZSQ/U0cpmKkDy5y6xD6CNREwIcraWAEgBIFEgB8y7XDY5bZMlMasnYJTeWHtU6bWGrxnyZyyp zttsSlYtRUfjqpn4nvdhhEu5uavCPJMcaembMVVgnIZiFeZxpHJ+Ao8c1xuGXlVFcptHVkszMq9D JZmZV2Rpm1axSCYoEVoEVAMqgGVaURWgYVoGVaBlWlGFaBzVAjCtKMK0DmqFHNUCOStKObmlHNzQ jk5Cjk5pRyc0qOTmgcnNKOLmlRyc0o4uaVHFzSji5pUcXNKOLmlHFzSo/vI/XvkgAAAAEmRlVOG5 uLEPJUVLZSLhwnjyymXXHF+era+KrhMxDo+DU1UY4TVI+JVVKYcJqkfGqKjlwlofJqKnlwlpHge9 z1KDZSqB3ZJRCDsjIAaxQGKQXFCkAEAECCQAQAyoGFAgEgAIMqBAKiBW0RSDqxAPZI5UMyr7VKsI GJV9mndhQzKvv0LuQxLUPuyli05q7QDKQItiIC3REDMioRLRUC2QIWQBZiqQtpstVCTk6tlogpic m0Q1EMqaoBQEoBQhKAlAQQzIEUIIZAghFRUIrMCCKgVhUI0kCLaQAyqEVlUDTCoRbSAW0gRbZVCK yqBUgRWVQKyqEVIASBFQKypBAqAZIIBABAChAIIBFAhBlQqRAiqBmJBFAACKgEAhBAIFQCKAIIoE AEEAgEUARUAgEAARSCAAIBIBUIIoEAKBAJACAQggFgAAsApAIsAEApABACwAQAQA4z3oxiqXGEl+ QuVU6Y92HAe3bxpxyl8dVWMTsw7Sp6s5DMwtvu2use97WdJw3MHTGX6dEwIeR0IBSARIFHCqqJdJ IfUTVgxiRh0rzIhccZymiZp8a1UsyrnPutWn43r/AHTV5k5jtu5VGmGMYvxl9Se/mQ5RDUvKptHJ xUeaa6BqEeJ6xU3CKyWJkepksxMq7Iwzat4pFMUWGKBnFAitAzigRWgZVoGVaBlWlGFaEYVoGFaU YVoHNWlHNWhHNWlHNzSjk5Ajm5pRyc0o5uaVHJzQOTmlHFzSo5OaUcnNKji5pRxc0o4uaEcXNKOL mmkcHNKP7uP2D5AAAAFUzOUQMOdA825utRDxVNY2WiwXCeaZt1xxfm664Y0cJIhp8CpreXCapHxq mtTDhLQ+NUVkY4TVI+XOqVdgRS0POjHPWKgdWyYAdWy4EHRGAaxQGKQMUBAKkAEAJABAgyoGFAyB IAIARSDKgZA2gV1ahB2a0g9cluEkq+xTNwIZlX1ZCchiVfcoVgqGJWH6GnWKIYlXqRCM2YoSyALa RCJbWKEtMUi2YoLVGkS20aKZttENxigWkBQpqgFCEoCAZVCAQDIhFCAZEIBBDKpAgyqBWVQjSQAy qEVlUI1DKhUIrKkVFAyRplUCpAgyqBWSNMhUUiskVFAyFZwgQggCBBYEVFAgEiQRVAhFZAKBkCEE gAChBAIQQCARQBBFCoBAIpBAAEChBFAgAggEAAQKgEIIoACAQBAgyBAoEQCBSBAAsALABACwAQAs AEAEAEAIuBAPk3GdBionOdtuGMpflZ6K5ynrxcpeVWG7RlG4YAfp7DRKq55yYE5Dy72f8OmEP0sD yuqQAQAkAPzlS515uCUstf8AwVMsZjk5HOQ9OP8Axjf8y5z/ANS+2/Fky0YxIIiQRE6DhHjLbxOW KxOjLDgPPMWBqEeKa6JuEc2sipZlHplyzMy09LWQMTKto0guKAgRUxQIqFGVaETFCorQMq0IyrQM K0DCoUZVoGFaUc1aEc1Qo5qgHNzSjm5oRzc0o5uaUcnNKjk5oHJzSjk5pUcnNKOTmlRxc0Di5pRy c0qOLmlHFzSo4uaUcHNKj+6T9k+QAAIqwOeWcQtOb5iNSKqeTPctqMXzKuvRiKiKcfN1iKfmq24x jhNRCvz9VXKscJaR8WpreXCapHxairVVWCloeJz3vUqNMkquFSD0tlInMFdEYQVGgXFAQAYpAgFZ UCAP0gIAZUgwoGFAyAgBIARUAigZINoB1YRXpYQe2Q2KklX2KZmBDEq+nKbCBlX1qPAqGZV+gpVw Ic5V9BqBzlqAZtMUi20iBLWBESAVUQiNIgRTUCnSEBQFoAAkDIhAIBlUJIGRCAZUIIQDIEVCDKkV FIrKhWSKikVkKyRUUisqFZIrIVCKypFYUNMqRWQqEVFAypFQDIAgpFAIQZAgVFAhBkAQSAAgigRQ qAZIAEAhBAoBFAhBFAAQggVIAAIoEIAEUKgQIqAAIoEIJAABAqARQBBAIBIAIAWAFIKUIEFgAgBY AIBVgAgEcJ70a1TWMEvzddOxlVD04Q5TL5L0O0MPO81A70FK6pntaicqmc8qhcYt+7pqdtPKbLan ImE8GWVy7xFO0DIkAJAD5N6rXyZbaOnw1dR+FqJytauBVO21hc3PlDOc14O9uoWW+lRnLMX8Ux3S pncz1SuMVDM5+M4sQkuKoUcnrAsI8c1xuEeaGMptHeXLMzKvUyWYmVdUaZtWsUgYoExQJigTFAmK LEVoGcUCK0DCtKMqgGFaBhUKMKgRzVCjCoBzVpRzVpUc1aByc0o5uaVHJzQObmlHJzSo5OaUcnNC OLmlHJzSji5pUcnNKOLmlRxc0o4OaVHFzSj+5D9m+OAZV0Dhnu0sQ802oaxOXCeTLOZdIxfIq7gi RgpmnR+brrhy4TUQj83V16qq4TVI+NPrFWOEtD5k2e56wQqObZSuwqB6GSU6CK7JLgBpGkFxQLig MUCQAigZAkCCQCkAEAMKBzUDMAGKQIASAGVQCQAkANI1SK6taQemWhB7qdMJJV9ylbGBiVfTlsMq +jTNgqGZV9yl5jEq+nLI5ZOsAxaQBawIEAIpFEINFQLCKdIAoFFKiEUIBmRDIElUMgQDMiEUMyIQ DIEkQiopBlSKypGkUKypFZUKhFZIIRWVCsEaRQrKkVhQ0ypFZCoRUUgihWQECBAigEIIBlQIRUUC AIEEUKhBAIoEIIBAqAQgAZAEEUKgQUioAAyAICgZAEECgEgBAIRQIgAKhBFAAQCASBAAigSAGoAI AWAVYACCwAsAEALABADLlgkQPk106CKiHbCGJl+fnOxlVT0w5y8jzcI4I1XuRE5yo/Y2S3pIlJOe n43ch497cuadsMX2YHBtIAIAcKqol0kh9RNWDGJH9K8yGscdU1CTNPkWilmVM591q0/vJi/3TV/q tO27lERphjGL8X06iZ/VQ5Yw3LxKbZYcUeWa41EI8bouU2y6S5ZJlXqZLMTKu7WGbVtGktVxQJig MUCYoExRYitAzigRWgZVoGVaBlWlGFQIwrQOatKMK0o5q0I5q0o5q0Dm5pUc3NKObmgcnNKObmlR yc0Dk5pUcnNKOLmlHJzSo4uaUcXNKOTmlRxc0qODmlHFzSj+3z9pM0+M5TJrWJFVPHubrcY2+bU3 BGxRFOE+LpGNPiVVwjHCKV8GsuHLhNUPzlZXqscJqIR8SfVK5VgpaR5oPmL7AO8unROYDu2VAito wDWKAxSBigIASAGVQDKoBkBAgQCkAMqBzUDMAJABAgQAkAMq0BigEaQdWsiFd2SiDs2XAg9chsFQ kq+5RpyGJV9mSxFRDEq+jJl8hmVfVp2QRDMq+jLDjk7FphCUBAIMqRYZDTSKRlo1Ap0hFNAVAoEE MyoQDIhJAyqGQIIZAkqGRCAZEIopBlSKypFZCsqRUUisqFZUioRWVCsKRpFCsqRWFI0yoVlSKihU IJAKQIAEIIpFQCAQipACARSKgRAqKQQCKBCCAQggUIIBIAQCBUICgQAQZAAFIqAQAoEIAEAhFAiB UgAgBCCQKBBFAgUIiBSAFAsALAgsCiwAQAsCBACwAQA81RMxUU3jCS+BVzMZVPRjDnL5kw6wy8kx TcI+nZbetROR7k/A3Cpy3s6hrDG37NrUaiNRIInIeF2WAEgAgB+eqVW83BKSWv8A4KmWM1ycjnHp x/8A543/ADLnP/UvtPxZMtGNSCIkET2HCPF0eB64yxU6Qy5qVHCY6BYHjmOip0hlljIiZHqlyzEy r0tYYmWnRGksXFAYoUxSCYoDFAmKBMUWJigZVoGVQqMq0DCtAwrSjCtAwrSjmrQjCtKOatA5q0qO atKObmgcnNKObmlRyc0Dk5pRzc0qOLmlHJzSo5OaBxc0o5OaVHFzSji5pUcHNKOLmlR/bD1g1VP2 O9lWL48Q/O19cqOVEXAeKnd8Cprlw4S0Pi1VfCOEtI/P1lfGKRNUj5L3zJq85RplPHlIPUySiAdU YRWsQC4oDFAQAypBkCQAioBlUAyqAIACKihGFCpADKoAgAxSBigTFAioiAZVUQgmOic4HRkxI8oV 7JbkWBkelIQIrpLVEUD69HMTAYlX3JExMBiVfWp3IsDMtPrSoQQyS9ksOOTqaYBMCGQIMqplqHNV DVKjiEw2ixDMw2dIlkNimkCgAMiEUMyIZAioZkDIhAMyoQQyBBDKhBlSKikVlQrKkVlSKyoVFIrK kVlQrKkaZUisqFYUjTKhUIqQAQIIQArJFRQIpFAIRUAikEUDKhUIiBUUCEEUCEECoBABBAIQQKAR QIQAIBCKAQCACCKBAoERSKgACKAIAECoRACBUgAgBCCwAsALACwAsALACwCkCCwAQAy9YIWB8urm cqHXGGJfGnLFTvDEvnzVOkMy5SJLqiajGpGKlmahIh+6t9G2lkNZD8SpFx4M87l3xinsgYaIASAH yrzWOkSm0tPhq6n8LETlRF5VO21hc3PlDGUu9uoWW+lbL5Xr+KY7pcpncz1SuMVDnPernQLEEuCo VHF6moR5JrjcI4o2KlR6ZcszMq9TJZiZadUaZtW8UBAgQAmKAxRYmKAxQJigZVoGVaBFaBhWlGFa BlWgc1QqMK0DCtKOatKOatCMK0o5q0Dk5pUc3NKObmgcnNKOTmlRyc0o5OaEcnNKOTmlHFzSo5Oa UcXNKji5pRxc0qODmlH9lV85JVO90eY/Wb+VzT5GEPwFwrfxuwnKIdHwKmt5cJaHw6mrc5VRq4TV I8rZLnrFwHpZJROYg7JLA6IwKuKQMUBABADKoBhUAQIJACKBhQJABACKhBlUAzBQpACQAI0DWKQZ VUQDi96IB53zkQDg6eUc8+vSB1lTVVSD6Ep6pAivcx8WmR1avORX0aSZgQzKvs082KGZV9ilm8mE xKvtSJuAzKvoS3kc8oehFiaiXKVNAYmBFMyrm4jUOTlI3EMo4i06NcGZh2a6JYlzmGjpEoGokU0g UCCGZUIIZAzIEVDIGZEJKhkQkgZEMqEEUisqRWVCsqRWSKikVlQrKkVlQsMqRplSKwoVkjSQIEAq EECopBCKkAIRUUCKRUCoQRQIpBArIEAikEAgVCCAQggACEVAiBQgigQApBAqBBQqEACACKgEAACC BUCEAIRQCQAgAggUCAFRAqwIKUWBBYAWAFgBSBABADy1EyCKbxhJfHnviqneIYl86cqJE6QzL50z 8SwQ6wy/R2G3QTaJif8AuxPLvbn8OmGL9HA8zoQAQA5VE6XTSXz5qwYxIr9xcYuaJ8HyLTTzKue+ 7VSfimYJDF/qtO+7lGMaYYxi/F9GpmIn4UOWMNS8K4Toy5uUDzTXG4hHlWLlNI7S5ZJkeuXLMTLT u1hm1dEaZFxQqQAYoDFAYpBMUBiixMUDKtAzigZVpRlWgYVpUYVoGFaUYVoHNWlGFaEc1aUc1aBz VpUc1aUc3NA5uaUcnNKjk5oHJzSo5uaUcXNKOTmlRxc0o5OaVHFzSji5oRxc00ODmlH9VeYK7ElK 1OQ/UXcvlRFP80rq/wDGuE1ED48yfMnLBpRqXTc7sKgepsqHMQdEYBpGgXFCmKQRUAyBIAZVAMgA IpBhUAkAEALigZVAMKhAxQpigMUBiwIOb3IiAeWbOhEo8Uyd7So8r5qqBzi5wG2scoHqlNVDKvez kQg9LHLCBFehjsBB65E1WoSVfSkVMDMwr6lNWokMJmYV9mmr29JiYW32KesY6GExMK+lKmI7kUOW WLubhzCSIpiVc3EahweR0hxV0CN0qTCFOrZsFDE4u7ZiKW3OcXRFNxkwp0iRTSAAioZAyISQMqhk CSIZAyqEkDIEVDMiKQZUisqRplQqKRWSKyoVlSKypFhlQ0ypFZIqBUIIoVFIqEEUKikEUKypFRQq KQQioBFIrKgQCEEUCBUUCEEUCEEUKgEUgARQIQAIFQgKBABBAoBCIgUAEEUCACCKFAIAAhAAgEAB SBBUQCwAsCCwKKQWAFgBYBVgBYAc5joIWEfMqHxOuLMvmzl5TrDEvl1D8KnXGGZdLbROq57Uh+GO FSbmemDGLfuJUlsmW2W1IIiHgmbl3puBFIAIAfArFdd69tBKX/wlOuNUOTkV3QejD/jG/wCZc58Z p9p+LIlI1qQREgiJ0HCPGW3zJjle6J1hlzUqOEx0DUDyPWKm4ZWXLEyPXLlmJlp6msMTKuiNM2rW KAxQGKAxSBigMUKmKAxQMqgExRYyrQMKhUZVoGFaUYVoGFaBhWlRhWgc1aUYVoHNWlRzVpRzVoHN zSo5uaUcnNA5OaVHNzSjk5pRxc0I5OaUcnNKOLmlRxc0o4uaVHFzSji5pUf0B5iq3Yi4eY/VxD5c vwbpb5z1VeQ0j0y6dG8wHoSXAg0jEA1igMUKQIiKgVhUAioBhUAkAMwAkAIqASADFIKjQCtAwqAZ gQIBSABYIBymTERAPnzp3LhKjwTJqqsEA5YjncoG2yQOrZSEHVsoK9DJaIQdmtIrs1CDs0g6tWAV 2bMVCDuyoVOclK9cquc1eUzRb6NNdHNhhMzC2/Q0F3isHKYnFX6emqGTmoqLhJjLlnjT0QOum3NF Qxlgrm5pymGol55iEdcXkmLBSOjjnFQDSTiUOrJ8ATFvXKqEXlJbllg9LXIvIdMcnKYaOkSgWwFg AMyIZAioZkDMiGQIqGZAgGVQzIikEUisqRWVDTKkVlSKyoVkisqRYZUisqGkUggVCKikGVCopFRS KyoEUiooVCKigRSKgGSKgEUggEUCEVAIBFIIBAqEEAARSCBRSCAQApBAAEChBAJAgQABUAEEAAQg QAgAKhAAigACIBogsALAgsCq1ABAgsANQAQALgQDyznG4SXzpuE6Qw+bUuRqKdcWZfKVqzZiNTDF Tt5Mv2VooEpZCOcn43YTw7udy7YxT6kDk0QAQA+bd611LISVIw1c9cSU1OVI8qnXawubnyhnKadL bQtoKVGrhmu/FNdzq5SbmeqVxioc6marnQQuMJLyKaRzcpqEeWY43CObWRUTI9UuWYmVetksxMq7 I0lq3ikVcUCYpBcUWGKLDFAYpAxQMq0CYpbEVoGFaLGVaBhWlGVaBhWlRhWgYVpRhWgc1aVGFaBz VpRzVoHNzSo5uaUc3NA5OaVHNzSjk5oHJzSo5OaUcXNKOTmlRxc0o5OaVHFzSji5pUcHNKP9vvaO mri83OfrYfKfDbIxeYqOqSwLiEDFAQAkAIoVhQIBFQgwqAZgAxQJigZVAIjcIFRpBrFAyqAZVsQJ iEEVoVhyo0DyzZ0Ajwzp/tKPGuPMX2FHRsgg6JKROYDaSyK0jANtaQdGoB0QitosCDojoAaxyC44 VpHqQba5YgeqU50TMq+pSzntWMTMq/UWy4OlqiKuA5zCv1dNUsnNRUXCawzrzcc8KenAp6PCXNlU OWe2tuMyXHkPPljTpjk8E9kDDvE28D1VFKrljwAqTSDbKhUXlJSvbJq+SJGZxiX0GT2uLGTjlhTq ixNRmxSm7RS2AEIBmVQzIGZEIBmVDMiEAyISVDIypFZUisqGmVIrKkVlSKyFRSKyqEVlQqKRUUis gQisqRUUKyRUUKikEUishUIIoVFIqAQCKQQggVFAhBAIBCCBUAEEAhBAoBAIQABBAoBFIIAAEECg EIAEABQiIFQAQAIAAsANIhFWAFgBpEAsALAgsALACwA5zFghYHimLE3DLxTlREVVOkJL4dXNxlVE PRjDnL6Fkt6zpueen4G4TnvblRTWEP1iJBIJyHjdVgAgEYmzGSJb5sxcVjExnL7EERc0W+PbJL66 pfdqhIIv4aZi8zU5zvuTpjTDMePi+lVTUY2CcpyxhqXzFwrE6ssOwFHnmONQjzwVymkeiXLMTKvZ LlmJlp6GsM2raNINYpAxQpigMUC4oDFIGKBMUCYoEVoGVaBlUKMK0DKtCMK0owrQMq0owrQOatKj CtAwrSjmrQOatKjmrSjmrQObmlRyc0o5uaByc0qOTmlHJzSjk5pUcXNA5OaVHFzSji5pUcXNKOLm lH+/3GixUVVQ/XQ+S/PzJUHFRzxYAZxQJigZVAMqgGVQDCoAxQJAKioQSAEgBIIBlUAI0g0jQCtA xACo0CKiIRXCY9GgeGdOKj58yarlg0ow2Srli4D0NlQ5iDaMA1iEUxQGKQaxQEIAWJFXGAK8C4xB 1bFSDs1qkV6JctVUg90mThJKvdLl4plXslTcQzI+tSXN0qH4jMwr71LeJb0RHr/SSJmGZwiX1Zc5 k1ItWJ1x3erlljMOipE1ljEsvNOk4yLA82WNOuGb5FRKVqqZd3hfFAOSugBnHA6y5qpzkoeyVUq3 nM0r2y6z2mWZwiXtlz2vLGTjlhTvE6RkwGrQFgRQkiGQMiGZUJIhkDMiEUMjKkVlSKypFZUNIpBh SNIoVlSKypFZUiooVkioRUAyRUCskVCKgEUiopFZCoBFIqKQQDKgRSKgEIAGQopBAIpBAAEIqBEC hBFAEVAIoAAQRQIRQABAoREAEEKoQAAEgQABFQCogFA0iEFgBYAWAGkQCkVYAWARFwIUeaYsTUI8 sxcBuEfIrJ0EVEO2EMS+fTSH1U9rEwxU65ZaYZiLft6WmbTSWy2pyJhPBllcuvk7wMqoQgB8Ouc6 51jbbJX/AMPKVH1T09n9U74f8Y6p8/4SfHwfXVGSJSNamK1qQaidCHHzlqHy5z845VOsRSS4qaRy e7AWB5nfiU2jpLlkmR7Jcs5zLUPS1hiZV1RpFaxSC4oFxQGKAxSC4otTFAYpBMUoioBlWgZVBYyr SoyrQMK0DKtKMK0DCtCMK0owrQMK0o5q0owrQjmrSjmrQOatKjm5pRzc0Dk5pUcnNKObmgcXNKjk 5pRyc0qOLmlHJzSji5pUcHNKOLmlR/Sl3lJirgP10Pkvx89kHKaR5lQoxAggGFQDKoBlWgTFAK0D CpADMAqYpAxQJigVGAaRhBcQCYgGVYBlcAHmmzERAPnT58Oco8LlfNXByAdJciHKmEDukuBBpGAX FIpigMUBikDFAkAMqhBIAIBWmtipB7JMuMCD2sk8hlXpZLRCK9kuCEGnTUQiuefFDSVEOclDvLrX MVMJKV9ihvL5ap+IxOKv1dFcpVS1EVURxcc5xcstvo+jgVDt4ZQ5PJU06PRVRMJ5s8KdcM3w6iSr VXAZd3ic0o5KQEWAHRsxSDsyasTMq9kqoVOczMK9sushzkYnbiXqZUtdyljJznbl3RyLyKajJzmF iXUgWwIBkQzKhJEMgZkQkqGRlSKikVhSKyoVFIrKkaZUisqRWVCsqRUCskVCKypBA0yQQKhFQisg RSKgVCCBUUgyBCKigQggEUKhBABBFAgEIqACCAAIFQgAQAQAqKQQAAIEABBAoAIIACoAIgBApAg1 ACogGgKiBWoEFRALACwAoQAw9SwPO5DUDxVLsVqm8WZfnah6zHwTnU9WMU5y/R2SgzMvPPT8buSJ 5d7O5pvGKfbgcVIAIBHhudZsciEv8VTNXEkt/tLz/wBBvbw1T2JlbZRJRU8H4Z8z8c5/S5RuZ6pI hirnRXFQuMNS8JtGHLAqPM9YmoQYyImR65UsxMtQ9jGQMTKuyNM2raNILigMUKuKQXFAQAuKAgQS ADFAyrQIrSjKtAyrQMK0DKtKMK0IyrSjCtAwrSjCtAwrSo5q0DCtKOatA5q0qOatKOatA5uaVHJz QObmlHJzSo5OaUcnNKOLmlRyc0o4uaVHFzQOLmmkcXNKP6Vu6JiKfsIfIfjalPxKVHlVCjCoBhUA yqEEgBFaBnFAioBlWxAmIFXEIJiIARgGkYBrEIJiqAxQOb8CAeKdMgB8yfPhHpKPKkt01YryAelk mBB1RgFxCC4oUxQGKBIEGcUCKgExQJikExQrSMiB6JcmK8hB7ZTESBlXqaqIhBHTUQipnwMunxFD nnQNZ0gudXpA6MnqiphJSvrUNyfKci4xiYWJftbXd2T2tY9cPMpiJnGWcsLfbRUckUPRExnDh5PF V0qTGq5qYTzZ46ZdsM/4l8KdKVjlRUMuzzOYBhWATFUgqKqEV1a9SDo2aqc5KV6Jc9U5zND1y6pe kiTjEvUyqXnwktznaehk5rvYXU5zhMOkTWpkFoEUJIhkDMiElQyIpFZUisKRWVIrKhUUjTCkVFIr KhWVIqEVkKikVlSKyFQioQZCoRUIIFZUioFQggVFIIBAIpFQIhFRQIQQCACKgAggVAIRAKhAUCBQ gACCAQAFCABABAAARSKAQAQAKiAaRCKsANIgFgBpEIKBYBACwCChYcVNDm+CIWB8O4z0SLUU9G3D nlLhaqJ1VPRzk/A1Yqa3c6hMYfsGsRrUaiQRMCHiatYAWAGXubLY6Y9cVjUVXKvMiFjxHyKCW64V TrnOSEpv4KVi9Cf1jrnOmNMf7Tu+lUzUltVOc54xbUPkuVXLFTqMKsCjg9xqEc0bFS2j1SpfsMTL T2S5ZiZWnoawzauiNIqohBYAWAQgQtYAsgEsgCyACAW0gBIBUgBlUCsq0DKtCMq0owrQMq0DCtKM K0DCtKjCtAwrSjmrQOatKjCtA5q0o5q0qOTmgc3NKOTmlRyc0o5OaByc0qOTmlHFzSo5OaUcXNKO LmlRxc0o/pC7J+BT9k+O/HVCfiU0jyqgEVAMK0DKoBIEExQJigZVoBGAaxApikEVoERoG0YQFaBF QDm5YAeOfNRIgfJqJ3KiYVUo87JLnrjOA9TJUAOqMILiBVxCCYoDFAioQZVAMwAmKAxSCYoUxQOz GIQehsGoRVWaichBlZ/tAws6IGc77QJncJAzgFSYRW0eBtriD0S5ipzkV9KkrnynNWJiYWJftLRe 2vRJc139JjxxTLHU/Rtc17YosUU7xMZw4TFPBW0aPRXNTCebPHTLtt5/xL4cxisWCmXVGtRwFWSS 1YWSosTNqhAxVQiiRQDq16oZHZs1UJKvQyf7TJVvVLqVTnI5ztvQ2oavKW3OduXVHtXkUWxMLEWg LAyISVDIimVZUKwpFZUisqRplQrKkVFIrKkVlQrJFRSKypFRQrKkVFCsqQRSKihUUioQZUKikVAI RUAigZIIFRSABlSABAqEEUAQRQIFCCACCAABBAoQAIoEChAAEECgAgAABBAABCK0iAaAqIBqBBYA WAFCKEWAADLirDmpVeGrnJLYqxN4xbMy/PLj1U9Gphip6fKHPzfrqCkbSyGtRPxLhcp488rlp64G UWAFgEfHuD3V1S22SV/u0g+qenMicjTthGmNUq+ojWSJSMYiNYxINROhDl5yR4vlVE1ZjvYdcYpu XnU0jm9SwjlBVUo7S5ZmZV7JcsxMq9TWGJV1RpBqALIES1gBYBCALWALIBCBAgFSAEgFSAEgFSAE VArKoFZVoGVaUYVoGVaEYVpRhWgYVpRhWhHNWlGFaBzVpRzVpUc1aBzc0o5OaVHNzQOTmlHJzSo5 OaUcnNKOLmlRyc0o4uaVHFzSjg5pUf0jdWxYv6D9m+NHk/G1DPxqaHmVgGFaBlWgYVoDFIGKBmAD EAuIFXFIIrQJiAaSWBrEIMq0DjMWAHhnzYFHyqieqrBMKgcpchXLjOwqB6mykTmA6pLILiAMUimK BFQDKoBnFIJigTFAYoDFIpigIEDGgBlXqBhXKBhVUgYyhWVcBMZQCOINo4g6NcFdWuIOrX4CK6JN IPZS1rpT0VF5DMwr9tZL6joSprop7Tn44zcGWMZP1bHtmtRzViinWJjOHnmJiXzq+ix0V7Ewnnyx nGXfDO/CXxIrKfB2Ajo98lGvQzKuy06KQtzdTewlq5Op16BY5Okqgsc1YqECChViqEGkmqhKV2bP UzQ9DKj2kScYd21PtI5ztu7Z7VDE7bokxFJbGlYoLSlIIplWVCsKRYZUisqRplSKyoVlSKikVlQr KkVlSKikVlQqKRWVIqKFQgypFRQqKRUAyRRQrKkEAhFRQIQQCEEAihUIAEIIBAoQCCAAqEQAgUIo EQgBUApACoQAARCKAAoAIAFgQaRAKiAaAqIBSIsCikRQLAqCgYDTlMWCKpYV+duNRjuVrT1beLll L32Sgh/4iYmH+qc97P8AgjwfoIHnQgBYFHkuFWlHIVzUxpz/AMElnOrlNYY6pGbbR7JJV0xcaomr jzn9KrzF3MrnsSxWT/6iDGG4iofPU6DDlKOTsJUblyyTKvZLlmJlXrYyBiZV1RpC2oES2oBLIAWA RYAsgRLWALIAIAsgBIASAVIASAW0gFtIAtFQLbMCLbKoVWVaBlWgYVpRhWgYVoRhWlHNWgYVpRzV pUc1aBzVpRzVpUc3NA5OaUc3NKjk5pRyc0o4uaEcnNKOLmlRxc0o4uaVHFzSj+j7mkZZ+2nzfEx8 n5Cob+NSq8ytAwrAM4gGFYAxCArAM4oBGgVGhRWkGcRQOiSwNZsgitSAHGZ+FAPnVE2ESj5M+aqr BMKlHOVIVVxnYVA9jJRB1SX7CC4gEVoEVpFZVAM4oExQJikDFAmKAxCBihWVQDCoQZVAMwAyqARU IMKgGVQCQCoQIwA2jiDaTArWdINJMIOjJnORXvpKt0p0UUzMLD9zYb4kElTXRQ5TExNwZY6ofrmu bNYjmrFFO0TGcPPMTEvk3KgiizZafpPPlGmXowzt86lmrLfiOMzDo+7JRr2xMuOfg6LJRRTOthZC EmGo3HF9P7DLcbjzvpg3GUOKyCW05ukqLVxdLVAMKioQVHqgGknKhmldW1MOclDsyq9pE0w7tqSM TtuzZ6KRicHVJkSMzi1GJGWVCsqRplSKypFZUisqFZUisqRpFIrKgQisqRWQqEVCKyFQghFQKyRU AhFRQIpBkKhBFAhBFAEVAIBCKgQCoQCABAoQQABCKACCAIACAFQgAABAUCBVgSwgBCCoBpEA0iBV RCIoGgiogFCLAIoAIihWVKr5twqElsVEXCddvGzKXx6OmdWVCJ/VjFVO+eWmGIi36+VLbKY1jUgi JA8UzZMtwDKwAjla1qucsGokVVehAPlUjFuNWtfMT/w8qLKVq/rcdcv+YpfJ9CompLYvSc4i1xh8 aY5XuVVO0Q2wpUc3KUGMiJkeuXLMTKvZLlwMTKuyNMpMtwCW1AJZAIsCFrAJawBawCWQBZAgQBZA CQCpACQCpACQCpAKzAKioC0VArKoFtlUCsq0DCtKMK0DCtKMK0DmrSowrQOatKOatCOatKObmlHJ zSo5OaByc0o5OaVHJzSjk5pUcXNKOLmlHJzSo4OaUf0ZcWxlH7ifN8PF+TqG/iUK8yoBzVAMq0CY oFxCCYoGcQAjArWIoExFINJLA2jACtQg5PwIB8ypmwjAo+NPmqq4rcKlRmVIwxXlCvYyUQdUlwIL iARUAyqEVlWgZVoExYgTFIGKAxQGKQRWhWVQDDkAyrSDKoBhUAyqAYVAJikGVQKyqARUIMgZiAip ARwVpHkHZriDsx5Fe+lq3SVRUWBmYV+6sN/arWypropyHKYnGbgyxjJ+va5k1kUwtch18M4cJicZ fDuNCst2dlpgPPMVNPRhlcLb6yCpLeuEzMLljcPtIqKkUN4+LzSsDU4okDE4qw6WinOcWoycXSE5 jEw3Gbk6SR0jNwfJ9hG4yeZ8kW08z5aoLHJzVQDmqqgUzioQdGz1TnJSvRLqPaZmB7pMyJljLF7W rFCOEwKRGVDTKkVlSKypFZUisqGmVIrKkVCKyoVlSKgVlSCKRUUiooVkgikVAqKRUAyQQKikEAgE IIFRSCAQigEAEEIAEAEVABBAoQAAAgAQKEEAEAAAIoAAECAGkQiqiAaRAKEaCKBYBFCLAChACKFc Zz0Y1XLzGohqH5mqmuqZ2K3Dhgh6sYqHOfF+itlElNJRVT8bsKnm3M7knw8H0IHNlQiwKPl173Vc 9ttkLBF/FUvTmb0f0nTDwjVLUPotayRKRjExWMSCJ+g53cp5y+RVTlmPVE5EOuMOrzG0YcoERsVL Y9MuWYmVeyXLgYmVehrTKTLaIGbaRCIsAiogRYAWAS1gQtYBCACACAEgFIASAW0gBIBbSBBIFW2Y BbSAW0VAWyqEW0VAtsqhVtlUIrCtKrCtCMK0owrQOatKOatCMK0o5OaUc3NA5uaVHJzSjk5pUcnN KOTmgcnNKji5pRxc0qOTmlHBzSo/outbGUp+8zjxfCxflKln4lMtPMrAMKwDKywJiKBcUgYoExMI GklhTEIGbA2jAJikGHpBAPn1EyCYCj4tVMXkTlUqPPKkx/EvKoHsZKIrukuBBcUDKtAmKBlUIrKt AmKBMUCYpAxALikGVQKyqAYVAMKgGVQgwqAYVAMwAkCDKoFZVAMqgGFQgyqARUAwpBAKihWmuIOq PgQFnrzEpXuoqt8tUVFhAzMLD/QrB5gZipInOwcxym8ZuDLHU/Xf3c+XFIOa5Dc1nDh44y+BX0bq aZnZf7PKcPLwl6ccrh9G3VaTmI137SEialjcx/l9E9DgEmBDEwqQOcwMqiKYmFth0tFMU1GTi+QR 0jN5Zkj2EdYzeaZIJbcPK+SvQWx53y1QWOaoqAaY5SSr6VM/2mJJ8n0pb0gZefKHSMSMopFZUKwp FZUjTKkVFIrKhWVIrKkVFIrKhWVIqKRUUKyQQiooVkioBCKikEUKypBAIoEIIFFIMgCCBUCHIRUI AEIAVABBAoQABAAAQigAgBUAEAAAIAAKqIQaRANEFCNFRUQgoRUQIoRYAWAQKMuwBqHxLpVQ/u2r +k77eJlJZ6FZjtomJgT9kbuf8M+T9EiQPOwsALAI81dVJSSFeiY0134ZTOly8hrDG5WIti3Ui00p XzVxqiauPOd7V5v6C55XPYylitqIJiNGMOmMU+Wp1aRSozCIHeXLMzKvXLlmJlXpa0yky6ohGJlp ECWsAiwCWsALAiW1AJawBZAgQCWQAQCpAFpABAKkAWkAqQBaQCpALbMAtoqBWVQFpALbKoFtlUC2 yqBq2VQKwrQMK0owrQjmrSjmrSjm5oHNzSo5OaUc3NA5OaVHJzSjk5pUcnNKOLmlHJzSo4OaUcXN Kj+iqlIynH9A3Y8XwMX5apb+NTk28+IBFYBnNoBM2AVnsIM5sDSSwLiBTEIKjACtAyrYAeOoejUX CB8apmwipR89stZjsZeTmCPXLlEV6Gy4IBrFIM4oGVQDKoFZVpBMUCYoExSC4gDFAyqEGFQKwqAY VAMqgGFQgwqATFAyqAYVCDKoFZVAMwIMqgGVAwoGYEEgFZAkYEGVcqgabhA655JaYDNK7UtwmS5q YqqSYLf6l5Xu6zpSSZq/oicJ/wCZtcsdUP1E6W2dLVq4Y8gzqfFxxnTL4mI6jnRT9mJyerzh9yTM SaxHIddvJ5csal0OrIZmBDEwqGJgQxMKhiYGXMRTEtRLzvkoR0xzeZ8n2EdYzeSbIFtvFMlwLauM IKB6ZUzFMyr3S6hOkwzONu7ahOkjM7bok1FIxODWNEiUihWVIrKkVlSKypFZUKikVlSKypFQKyRU IqBWSCEVFCsqRUAhBCKyAUDJBAoQQCEECoAIIQAIQAqACCBQgACAAAhFABAAgUIAAgoEChBUA0iA aIKgRUCNBFQCogRQjUAKEACgeOrnpJlqscPMbxi5bjwfCkSX1tSicqRip6JnTDPm/VSZTZUtrGpB EQ8szbEzbrAjKkEVUaiucsGokVVSj5lKxa+qWumJ/cSlVtM1efpcdMv+YpqZqHvqJqSmL0mIizDG 3w5j1e5VU7RFOrBRIRCOjGEmVeuXLMTKvUxplJl1RpGJltEDNtQIlrAJawBaogS2oBLWBEtYAIAs gEIBUgAgBIBUgAgFSAEgFSAGYBbRUCpALbMAtoqAtlUC2ioRbZVCtWyqBbZVCLbCtKrCtA5q0owr QOatKjmrQOTmlHNzSo5OaUcnNKjk5oHJzSji5pUcnNKOLmlRxc0o/oackWO/Qf0PefnsfN+cqZf4 1OLo8+bAyrAGIBFYQTEAZsC5sKZv+kBiEEVoGVaB5570aigfGqZvKpR8tUWc+K/s8wR6pcj2BXpb LREINYpBlUAyqAYVAJi9IVMUgitAmKAxCC4gEVIAclQiuaoBlUAwqAYVAMKhBFQDKoBhUIMqgGVQ KyqAYVCDKoBhQMwAikGFAwoVlQMkDGhgQDmq9IHejlLMmovMhmVh+2tlRsiNdGEDjlFtw/Y2y+yp ypKe5IryHKYmGcsYl9epkNny8ZuFYRQzMfyzhlU1L5tNVupJ2am4GqsB3dMsdUPuNcj2o5qxReQ7 45W80xTRpEMyBiVQxIhiVQxIipEzKuT2GW4l5pstCOuOT50+WmEOzwvSClGcaAFzqpzkpWkqXJzk odGVjmry4DMwPoyZ7XoiopmWZxd0dEy50KQRQrCkaRSKypFZUishUUisqRUUDKkVFIqKRWQqEECo RWQIpBAIQQKhBFAhBAqACCEACEAKgCJBAoQABAAgAigAgAQigACkACBVIAGkQgqAaQIoRoCogRQj UAikFgVFCBBh7kairzFhqIfna6e6fNzbcKRgh6cMahZl9m2UaU8pHOT8bsKnHcyuWcprwfSgc3Mg EWAHzq176qc23SVgi/iqHJzM6P6TphFRct4xUW97WskSka1MVjEgifoMXbHnL49XPWY9UTkQ64w9 ERTywNiQA2xkSTI9UuWYmVepjDKTLu1pHOZbRCM20iBLagEWALWBEWAS2kQJawAQCLAFkCCQAQAQ CpACQCpABAKkAJALaQBbMAtpALaKgW2VQFoqBbZVAtsqgatlUC2yqBbZVAtsqgW2FaFc1aUYVoHJ WlHNzSo5uaUcnNA5OaVHJzSjk5pUcXNKOTmlRxc0o4uaUf0E9ItVD+jbseD85D4tRL/Gp53V51YB hZYDNqBFlkEzYFzYUVgExSDKtAyrQOU1UYmED5FTMjEo+NNVZz8VP2QjvJkcgHsbKREIqq0DKtIM q0DCoBnFAmKRUVoExQGIQXFAioBycgHNUIMKgVlWgZVAMKhBhUAyqAZVAMKhBhUCsqgGVQDCkGFA wqARUAypBhUAy5ArCgYIMqBmEVRE5wPs0ctsliOXlMS1C1VyzaYrVwkjEt45F6nyZiPRVgilnEt/ qflTzLKuEptPNd/eciKp55jTKZ46ot925UCT2LMlpCYmHAZyxrxTbz/iXktdc6W/ZZ+DmaqmYmvF vPC33onoibeYEiGJVDEiGJAzKoYkZUxKw4TEI64y8M5kYkd8ZeCbLLbbzOYoRyVqgc3RQK5q9UCO sisWU7lwc5mYV9yRPbMaiopzlJxehFiZc6FIrKhWVIrKkVlSKihWVIqEVkioFZIqEGQqEVFIIoVk ggEUggEIqKBCCBUAhAIAEIoBABBAoQABBABFABFAgFQgACCgABFABBUQDRBoIqAVAjSIEUIoRpEA oRUQIoQXAgWHyrlVJLYrGr+JTtt4235PPaqJZr8/MT8KchrczrwSZp+iRIHnclgEWAR56ypSlkq+ EZjvwy2c6uXkNY43LWMWzQUq08pXzVjUTVx5rvavN/QM8rM8rcq6ogmI1cKlxh0wxrxfKXpOrZAo 01sVJY9MuWZmVeljTCTL0NaRzmXRGkZmW0QM2sAiohBpECKiBLaRAlrAiWsAEAlrAFpAFkApACQA QAkAtpAFkAtpAFpALaQBaQC2yqBbSAW0VAtsqgLZVAtsqgatFQLbKoFtlUC2wqBbZVA1bKoFc1aF c1aVHNzQObmlHJzSo5OaUcnNA5OaVHJzSji5pUcXNKOLmlR/vy8h/S848H5t86ol/iU8jtDyqwCZ sCZsgmbAYgGVaFRWgYVCDCtAjkxWqvQB8uqmKsUKPi1UxXLipzhGJMn2Ae+XKghFbVoEVigRWkHN yQA54oBWgZVpFRWgMUCowgK0Dm5AOKoBhUIqQAwqAYVAMKhBhUAyqAYVAMKhBlUCsKgGFQDCoQYU CQAwoGVIMhWFA5gZUgyoG5CJjYy8iEkdp1XBMVpKV897lcsVKjmoHttlwm2+obMY5USOEzljcLEv 9u8u3uVdaVqOcmdRMPtPN5eEpnj/ADC3OjxH7RKSHPgOfk6beVw9turEqJaNVf7xuBUNY5U57mH8 voHZxQzIhmVDEiGJVDMiGJVzehlqJeWYwjtjLyvlEdYycHSfYLacHyRavM+ULR5ZktULY8UyLVNI 9NDXLKejXLgMZYrEv0cmc17UVFwKcZScXaJGUUgypFZUKikaZUisqQRSKyoVFUishUIqEVAMqRUI MgRSCAQKiqQQggVAIQAIQCKgAggUAEEApBABFABACoQAAFIAVCCgABBSCogVpAioEaCNBFRAioEa gBQiogRoIAeepnJKYrl5jWMW3jD4MtkyuqfZHCvsPRM6YV+mkyWyZbWNSCIh5Zm3LKbdUQMtBEcr WNVzlg1Eiqr0EHz6Zi11RtsxP7lkW0zF/W465f8AMU3lOmKeypnJKYvSYiLTDG5fDmPWY5XKdoh3 YgUaRsSDuxhJlXqYwwTLu1pHOZdkaRzmW0QJbSIRlUQDUAiogS2kQiLAJawCLABAgQAQAQKEAWkA WQIqQAkAEAqQBaQC2kAtpAFswC2ioFtIBbZVAtoqAtlUC2yqBq2VQLbKoFtlUC2yqBq2FQLbKoGr YVoVzc0o5uaVHJzQOTmlHJzSo5OaUcnNKji5pRxc0qOLmlH+8H9NnyfmnmnNip5JdMXnVhGkVnsA zmyCKyAGFaBFaFYVAOatAIwg81U7FaqAfnqyfDAn7S8hUeJktXLjLyqUe6TJ5yK9KMwEERoEVoGF aQcnIBnFAK0DOKRTFAI0C4pBhyAcnoBzVoGVSBFYVAOaoBhUAwqEGYAYVAMKgGIEGVQKyrQMKhBy cBmAGVAyqEGFAw4KwoGFAypBhQJjKiQQDmoGFIMqBhQr9L5ZvT6CoY1XQSJy3Mbaxl/s1FVybnSo 9qosUwoeav4c8o0zcPk1UudbahJ0v9iJHaJjKH3KOrl1cpJjFw/1k6FN45fw4Z4VL0m5c0MyoYkQ zKoYkQzKsuQwsOLkI6RLi5hG4lycwjcS5OYRuJed8qItp5psj2Cx82pp1gpuJSnyZsZbomkfUtlx gqS3qc88Wol+jlzEciKnIpxSYdIkZRSKypFZUKypFRSKyRWVCoRWSKhBAqKRWQIpBFIMgQKhBCCB UAhAAhFAIQSIAihBIgABACoQABAAEUAEAAFCCgCAQUKqAUI0gRpAioRGkKikGgiogRUCNQCKEZeq NSJWoh8Cununzc0zCkYHowxqLbl9a3UaU8pFcn43cpyzyuWM5/h9CBzclgBYBHz6pXVk9KGUv902 Dql6dHM06Y/8xbpj4Rb3/gky0RERGtSCJ+gx5sReUvi1U9Zr1RORDrjFPTEVDzwNCokQrsxhmZHp YwzMky7saRzmXdrSOcy6IhGbaRAiwCNIgS1RCJbSIEtpECWsAiwILAIQAQAQAkApABAFpABACQCk AWkAqQBaQC2kAWkAtswC2ioFtFQFsqgW0VAtsqgW2VQNWyqBbZVAtsKgW2VQNWyqBbYVA1bCoFth WhXJzSjk5pUcnNA5OaUcnNKjk5pRxc0qOLmlsf7if1B+Zc3pE8uceLUSximG7ZViAthWhWFaQZVs AObkCuTgIjYqBXojGxUg+JcahGtVYlR8WXKdNdnH8/IhR6WScPIQepsuCQIrbmwQDOLgAzigYVvO QclZFQMqgEVoExSKkANI0gK0Dk5AOLkioGVQDCoRXNUAwqAc1QDCoQZVAMqgHNyYAMEEhgCsKgHN 4HFUIEIAYUDKkGVA5qBhQrCgYUg5uAyBlQMKQZAwoURysXGasFQg/aeU/NT6Kc2TOd+BcCopx3Nv +Yaib8Jf60i09zpEc1Ucx6RRehTjPj/+XPxwl+fY+dZ63FdHMuXD0QM+bvMRlD9RKmsnS2zGLFrk ihvHK3lyxqWxKBmRDMqhiRDEqimZHNyGW4c1QNQ5uQjcOTmkaiXNzSNxLk5sSNxLxz5MUUsSr4Vb TwjgOmMszD5SOdKmRTBBTfmj9Ra6zOsRqrhPPnjTceL7DXRQ5szApERSKypFZUiopFZUNMqQRSKi hWVIqKQRQrKkEAyQQKhBAIRUiEQipEAQSIVCAAIJEARUApFQAQCBECAUigAgBQgAUgBQgRApBpAi oBpAjQRQjSBFQI0gRQjQRUQILgA+ZcarNtVjV/Ep1wxt1iKcrXRq920TE/Qa3Mv4TKah91EODgoG kQI81bULIlo2WmNPmLiym+1ec1jFtYY21R0yUsmCrGY78Ux3S5eUmWVymeVy8ldUf4bf6TWMO23j UPnQOroqNIOrGEmR6GMMzJMu7GkYmXdrSOcy6o0jEy2iBlqBEVECW1AIqIEaRCJbUAiwAsAlkAEA EAEAEAEAJAFkCLZACQBaQKWQItpAFpALaQBaQC2kAtswC2kAWioFtlUC2yqBbZVAtsqgatlUC2yq BbZVA1bCoFtlUC2wqBq2FQNWwrQrm5pRyc0o5OaVHFzSjk5pUcXNKOLmlR/tZ/UX5llTz5+apAxS sqhFhhUI0yqBXN2Ag8z3cyAZYiuUD0IzFSKhXya+qRkcIR+fdj1UzHd+wi4EKPVKlIhB2axIhW8X CQHtwogEc0DKtIObm4AOSoBzVIgIYAqQICNwgaRpBFaBxcmEDjDCBlUA5qhFYVAMqgHNWgclQgzA DKoBzcBzVMJFFQDCgcXAc4EBUAwqAYUgwoHNQMOCsKBlxByAigYcBlSDCgYUKypBlHKxyOasFRYo B/p/kbzMiYtHUP8Awrgw8ynm3Mam4amNUU/fXKiZWyIt/bRItU5T1Y28qmpfHtVe+jnrR1H7KrBF XmJPV1zx1Q/ToqKkU5DcTbyhJAxKoZkQxKhmRhTLUOakahyUjcMKRqHNwahzUjcOT2xI1Evm1UjG RTUSsw/OVkhWOVTrEsSlBVLImJhwEyi1iX6+mnpNYjkPNMU3MW9MTLCKFZUisqpFRSKypFQKyRUI rKgRSKypBAIQZUCKRUAhBIgQipECECIVCCACAFQgAIkEAEAKEUAECIAgBVQgACAAIoBSDQGkCKgR pAjSBFQI0EWARpAioEaRAKEeeqntky1cq/oLjFt4w+LTyn11RjO/ZRYqp3mdMNTL9JLltltRjUgi HnmXDKbdIEZWAEe9spjpj1g1qRVSwRFvHRy3VE1a6ckMbBIYv9VvT/SbymopvOaiod6qekpi4cJn GLNvG3xHOV7lcvKp2ehUaBtrYkV3YwyPQ1pHOZd2tI5zLq1pGJltEIzbaIEVECNIgZaRCDSIGbaR AiwCWqIQtYBCACACACACACAEgFIAIAtIAtIBSAEgC0gFtIBbSALSAW0gFtlUBaQC2yqBbRUC2yqB bZVAtsqgatlUC2yqBbYVA1bKoFthUDVsKgW2FQNRLCtDVubmgcnNKOTmlHFzSo5OaUcXNKj/AGQ/ qb8winLKFQ5yIplWFI05vVETCRYeKdO6AriyL3AfQlSsHIQmXKrmIxqogH5Oqc6onqxP2U/aKPRK kIjMCAdUYiIpAa38QVpG/iIK5uEDD24QMubyEGHNwAcXp+HABygBYYAqQ5SAiYQNIhBHIBwcgHGH KBlUA5qhFc3IBlUA5qgHJUIMwAQwAcHAYhhIqKBhwHBwGUQgjuQDBBgDCgc1CsOAwBzdyEGOYCAY cQYUDCgYUKyoHNSDtSVcyknNmy1VILhgSYsh/tnlDzFLudK2RMd/etT8J5Mo0yZ434vdfLdjt2qS n424VgY8pa28r8G7Jc0ny9nnLCazAkSeUpuYX4vtmrcQzIhiRDMqimJGVI1Dm4jUOakbhzUjUOak ahhSNQ5qGocZjMZCNQ+PXUsUVTeORMPzc9jpTztEsPrWm4QVJblOW5i3jL9PLejkRUPPKzDakZZV SNMqFRSKypFRSDJFRQrMSDKqFRVIMqoEiRUiBIkEiBFUghFQCEEAEVIgQgACKRAhAChAAEAKEAAQ AoQABAApFABBpANIEaQIoRoI0RFKjSERpCoqEGoBFQIzMejGqq8xYXGLfAqpr6uckpmFIwPRjGmH V9yipW08pGp+0vKpwyyuXHPK3rMuaogFCPBMjX1GYb/9rJWM1U5HO6DpH/MX/LrH/MX/AC9z3NlM jyIiYEMOWMTlL4lROWc9V5uY64xT1xFQ5ohWm2tIOzWkHdrSMTLuxpHKZdmtIxMuiIRiZbRAiogR pEIltIgS2kQJbSIRm2oBLIAtqAQgAgAgAgBYASACACBAgBIFCAUgQtIASAW0gC0gFtIAtIBbSAW0 gC2VQLaKgW2VQLaKgW2VQLbKoFtlUDVsKgW2VQLbCoGrZVAtsKgathUDUSwqBqJYVAsS5uaVpyc0 qOTmlHFzQji5pR/r0T+qvy6KpjJWYnKRFUxKuT5iNQjUQ8E6erlg0jTzOReVQPXRysb8SpgBMvox RqFmKY83wLrVYkUTlXkQjb5lNJimMv7S4VA97WojYEGYcoVlGwUDUERSA/AoGHIBlcIHN3IQcXJg gBzhABzBUIIkIga5CCO5AODuUDiBlQObiK5qBlQOagcVIMgZVYAcnAc44SAoVzUDi8DESAq4AOYG FUisOUDmqgYcoGIgc3c5BziBFUDDlAwqgZVSDCqFYVQOaqBlVIPrWG7zbXWMe1yo2JjPC4WJp/vF puci70TZjVRXKkHtPHMfxLOeOmbh8S6UM23VCVlNHEjFYE7S7Y5XD7tsuMuukosf7xE/EhnycdzC vGH0Ilc0iZkImJVlVMqwqkVhVI1DCqRqHNVI3DmqkahhVI1DmqkaYUjUPPOYjkURLT87caVMKoh2 xyYmHw2vdImIqcynSrZfrrXXJOloir+JDy541LpHi+tjIqHMpFUgiqRWVUisqoVFUisq4isqoEVS KyqgSJBmIEiRUiBIkGYgSJFIkEiBIkCIEiRUiAiQSIUiQIkCKASIUihAiQIgIhRFILFCBEBEikQE SBEKsSCxARICAaQg0hUaQiNIEaQIqBGkCKgRoI0gRUCKqoiAfHuNZ/hMwqvLA7beP8usRTvbKPNt z0xPxu5CbmVs55V4PrHJwaQChHkrJ7kxaaR/9xNwR6redTWMfzLeGP8AMvRIky6aSktvInKvOq9J Jm5Yyy1S+dW1OO7Nt5DeOL07eFQ8aIbdG0QDq1DI7tQjEy7MQjnMu7UI5zLqhGJlpAltoRlUCNJA JbSBG0QiWoS1CLgCLEBEUES0ERQRFBEUERQRJQRFBEUJEUEQGAAFCCAtAtoC0C2gW0gC2YBbRUC2 yqBbRUC2yqBbZVAtsqgW2VQNWwqBbZVA1bCoFtlUDVsKgW2FQNRLCoGolzVA1EsOQK5OaVXFzSo4 uaUf6hnPaf1Z+WRZiGMhM4hylXKZPRqcphqIeN0x050EjAjbsyU1qYeUUluE+CvSW3lXAFe+TCWx G/adMMXOZcqqpSXLVVUxl5tYvzE2YtVPV6/st5CNPXIgmAg74ycgHJXYSDONhAquCo50SDKuwAZx sAHNzkgByVyEGMZAM4yAZx0iBMdCK1joBlXoByc9CDirkj+kDCvQDmr0AxjoRWFeBxV4HNXIBlXp Egy54HNzwOauAiv9pFc1eBye4DkrwGOQZV4HNzwMK8DkryDCvCsK8DCvA5q6C8pBlX+0DKvAwrwM K8gyrwMK8DmrgMK8Kyr4EH63yl5qm2upZLmOVZarBUVeY47m3bUT/Ev9pk1NNcqRHtVHypqYUPPV uU3jL81UNnWSsSbLVVp3rFFM+b0RMZQ/T0tdLqpTZjFjFMJhwzxqXfOCWEzhmVRZiGRzWYRqGFmE aYWYhGoYWYhGoc1mEahhZhGoYV/tI1Dmsz2kahzc/Byhp86rg5qlgl+YrWYrlU74yxLVurVkTURV wEzxsiX6+nqmzGoqKeWYdHfOJ0mRFmJ0kGVmJ0kVnOe0jSZxAMrMQisrMQCLMQgysxBQmcQgznEF KmcQlCLMQUJnEJSpnEFCZxCUJnEIJnBSmcJQmcQUGcJQmcQipnEFBnBQZwlBnCUqZxAGcQgZxAGc IpnCBnEFBnECrnCUGcFBnEJQZxCULnEFKZxBQZwlBnBSrnCUNI9BQ1joKRpHoKRUegpGsdCUjSPQ tMtI9CUlqj06S0ltI/2kotpHp0hLVHiktrH9opHhra1slioi/iXkN4YW6Yw8VvkLUTc/N/ZTkidM 5qKhcsqffa5ESCciHB55lrHFIuOKRzqKplPKWY79DU51XmQsY3K443LnRy3NxqifhqJuF39lOZEL lP8AENbmX8QlZWIxuK1cKjHFraw/l8rHisV5VOtPQ0jiDq1yEHVrkIzMu7VQjnMuzXEc5l1R6CmJ l0R5KZtpHiktpHiktpHkpm2kegpLaR4pLaR6dIpLXOIKRc4goM4WgzgoM4KDOCgzgoM4KDOCgzgo M4KDOCgzgoM4KDOISgzgoTOCgzhKDOIKDOIKDHQlCY6CltMcUWmOgpbRXiltlXiltFeKW2VeKW2V eKW2VegpbZV4pbZV4pbZVwpbZVwatlXClthXCmrYVwW2FcgathXIKaiWFcgpqJYVyCmolzVyCmrc 3KhRycpR++z/ALT+rPyzC1KdJxyyVh1Wic5zmWohxzrpi4cDSUtuzHtYmA3GDMyr6lGtVYky8CHK S+Llmu5V5P0DDG1yl6FqEROU7ZTUMvh3OvzjsyxcPP8AoPM6Q80pyNRAPS2bAK2s5CDCzgM50CZ4 gZ7AFYWcBnPe0DCzvaQcXTQMZ4CZ4DGewkEWdhAJOAizkIrm6cBydOA5rOA5um+0Dms4gys4Dk6a BzWaFYWaQZWagHNZoGFmgZzuAg5rNAws0Dk6Z7QMZ4gizQrCzQOSzQMLNIMLNAys0Dms0Dm6aQYz oEWaBhZoVhZpBlZoGFmihhZuEDCzQMumgYzqouMiwVOQlD/R/I3m5ZD0oqp/927BhXk9p5t3brxh r/6in+m1OZrZCy3/AImPSLXf9KHGYvxc8cpxl+bpqydaKtaeaq5pVwLzQMzFvR4TD9PLrGzWo5qx RTDz5Y1Le0e0jKLUe0lLDC1HtJTUOaz/AGmaaZWf7SU0wtR7RSw5rUe0lNw5rPJTUMrUe0lNQ5rP 9pKahzdP9pKV5Z02KKWIHxKzDE64sy+K+Yst50pH6C1XLGajFXChw3MG8ZfdbUoqRicKaFnkoRZ4 pWc+SlRZ5KGVnii2Vn+0lLaLPFDKz/aShnPii0z5KEz/ALRSpn/aShM/7RQmf9pKVM/7SUJn/aKD P+0UqZ/2koM/7SUJn/aKDPe0lCZ72ilM/wC0UGf9pKEz5KDP+0UpnvaSgzwoM/7SUGf9opbM8Siz P+0ULnyUGfFBnyUWZ4UtmeFFrniUWufJRZnxS2qTiUW0k72ii2kne0UltJOFJbSThTNtJOFJapOF JbWeFFrnhTNtJOFFtJO9opLVJ3tFJblPrWymKqqWMbaxi3xmTH10/D+wi4TvMaYdJl9+U5spiMby IeefFwyyt1z4phrP+0lIq1CNRXKsETCqih4pM1aydtL/APqJawktXnXrG5iop0ynTFfy9U+sSUxV VcJmMWMMbl8Z9Ss16uVTrGNPXHgqTRStpN9oot1bNJTMy7NmkpzmXZs0lOcy7NnEpiZdEnEpmZaS cKZtpJwpLazwpLVJwpLbScSktpJ4pDP+0Uhn/aWgz40hn/aNIuf9o0hny0GfGkM/7RpDP+0aQz/t GkM/7RpDP+0aQz/tGkM+NIZ8aRM/7SaQz/tGkM+KDP8AtFBn/aNIZ/2k0hn/AGjSpn/aTSGfGkM+ NIme9ootFnCltlZwpbRZwpbZWcKW0zpKW2VnCi2VnCmrZWcKW2FnFpbZWcKatlZopbYWaKathZqC ltlZqCmrYWaKaiXNZopqJYWb7RTUSys1OkU1EsLM9opX6pav2n9Ufl3N1THnOOWM21Eok9vKuERt mptKpEOkYxDJtaFocnVWO5G8yYVOFXLUeEOqVaId4imXnqrikqU50cPMcdybaxh8aXOV7lmO/adh Obb0bRADSVRBtKpFCsrUgZ2kDO0kE2kDK1KAZWpSIGVqSDk6oA5rUQAztIVlakDK1KEE2kCbUQZd UxA5LUgc1qAOa1IpXNagDK1BBzWoA5rUChhagUMrUEHNagDC1CChFqCK5rUFGFqCDm6egoc1ngZ2 glDK1Aoc3TwOazwMrPFDC1BKGFnhWFnihzWeBM+ShhZ4oZWeKGVnihlZ5BzWeWhhZ5KGVnBWFnCh uTWvp5rZjFgrVJMWW/2Lyh5pZX0zaac/+9an4VX/AIHkzw0yZxcW+7dJbK2SsIJOZhYv/Qc6pNvK vB8u13h0py005YK1YJEmWP8ALtlFv0CVqKnKc6cJgWrFDC1aEpWFqyU1DK1ZKVhatCU1DC1ZKahz WrJTUMLVEpqGFqhTTC1ZKVxfUooot4p81HIpqEfDq3QVVOuLMvPS1yyZqLEZY2RL9ZS3BHsRYnmy xdIl6dqMUrO1CltFqiUWztSCi2dqJRabUTSts7UKE2pCaRFqkGlbRaomktNqGktNqQmktNqQUWm1 E0rabUg0lptQ0lptSEos2oaVtNqJpLNqQaSzaiaS02oaSzaiaVs2omks2oaSzahpLTaiaS12oaVs 2omks2oaSzaiaVs2oaSzakJpLNpGlbXaUJpLNpQaQ2kmks2kaS12oaS1SpJpLaSpGlbaSpJpS2kq RpS2kqRpS1SpQaUtpKlC6UtUqSaUtpKkaUtUqRpS2kqRpS2tpGlLZmVrWNVVXkLGKx4viz659XOS Wz9k7Rhph1t9ikVlPLRE/a51OWXi45529O1GdLnbSVQ0lqlUNKW8c6rWqm7KxYS24Zzk/wCBuMai 3TH/AJi5ezamSmQSCNakEQxpc7mZfLqK9Zr4R/Ch0jCnqwiockqC03baVCEpLdEqBpSZdW1BKYnJ 2bUE0ucy6tqRpYmXVKkmli2kqRpS2kqSaUtpKlBpZtrahpLaSpQaWbXakGkNqGlDahpDai6Q2oaR dqLpDahpDahpDahpDahpDahpDahpDahpDahpDahpDahpDahpDahpDahpDahpDaiaRNqGkNqGkNqJ pDahpDahpU2omkNqGkNqGkTakJpLTaRpW0WpGlbTaUGktlakaVtlakaVtlakaWrZWpQaVtlakaVt lakaVthagaWrZWpQaVthakaWrYWoQaVthahBpaiWVqPaNLUSm0e0aWokz/tJpaiXqW6Xj6euGkof zR/UH5tlbpefp64aSh/NAT4nefp64aSh/NAPid5+nrhpKH80A+J3n6euGkofzRJES5XlP/164RXl /vKH80THGlmV+J3n6euGkofzRqUeOpqr9Pen/kFcktORM5RfmTjxy1Ejai9t/wD1+u0lD+ZHHK6l 2q+fT9fpKH8yTjk1G03z6fr9JQ/mRxSajar59P12kofzI4pNS7VfPp+v0lD+ZHFJqRam+fT9dpKH 8yOKTVDKz76v+gV2kovzI4pNSZ++8ArtJRfmRxSakWdfeAV2kovzJOKTUys2/cArtJRfmRxSuqEW Zfl/0Cu0lF+ZHFJqhlXX/gFbpKL8yOKTVDK/H1/0Ct0lF+ZHFJrhmHmDgFbpKL8yOGTXCKzzAv8A oNbpKL8yOGTXDOJ5h4DWaWi/ME4ZNcJm/MPAazS0X5gcMmuEzXmLgNZpaL8wOGTXCLJ8xcBrNLRf mBwya4ZWn8xL/oNZpaL8wOGTXDK0vmNf9BrNLRfmBwya4YWj8yL/AKDV6Wj/ADA4ZNcMrQ+ZV/0K r0tH+YJwya4TYPMvAqvS0f5gcMrrhlbf5mX/AEKq0tH+YHBJrhhbb5m4FVaWj/MDgk1wytr8z8Cq tLR/mBwZGuEW1eaOBVWlo/zA4MjXDK2jzRwKp0tHrxwZGuGVs3mlf9CqdLR68nBka4RbN5p4FU6a j144MjXDK2TzUv8AodTpaPXjgyNcMrYvNS/6HUaak144MjXDK2HzXwOo01JrxwZGuGV8v+bF/wBD qNNSa8fHyNcMr5d82cEqNNSa8cGRyQnp3zbwSo01JryfHyOSGV8t+bV/0SfpqTXj4+RyQx6Z83cE n6ak14+PkckIvlfzdwSfpqTXj4+S8kM+lvN/BJ+mpNePj5HJCL5V84cEnaak1w+PkckMr5U84L/o k7TUmuHx8jkhlfKXnBf9Fnaak1w+PkckMr5Q848Fnaak1w+PkckJ6P8AOXBZ2mpdcT4+RyQi+TvO XBZumpdcPj5HJDK+TfOXBZumpdcPjZHJCL5M858Fm6el1w+NkckMr5K85r/os3T0uuHxsjkhn0T5 04LN09Lrh8bI5IRfJHnTgszT0uuHxsuxyQz6G868Gmael1w+Nl2OSEXyL514NM09Lrh8bI5IfQtX ljz1bKhs5lnmwRYwSfS64xn+plMfwsbsQ/0KTXeYElNSf5frs6ifixZlEqR/pqUOHwM+sMznF+D5 tfIvtRNSfT2CtZM/rY0yiRF+ypUR+hudYdMd6K8Xrp6jzHLYjZtgrVVOds2i/MmZ/wDO3Osf5/pM t3GXo2y+fT9fpKH8yT67c6x/n+meSEWqvn0/X6Sh/Mk+t3Osf5/o5IZWpvv0/XaSi/Mj63c6x/n+ l5YZ2i+8ArtJRfmSfW7nWP8AP9LzQmfv3AK7SUX5kfWbnWP8/wBLzQys2/cArtJRfmSfWbnWP8/0 vPiysy/8ArtJRfmR9ZudY/z/AEvPiiuv/AK3SUX5kn1e51j/AD/S/IxZVfMHAK3SUX5kfV7nXH/P 9L8nHuwrfMK/6DW6Si/Mj6vc6x/n+l+Tj3ZWX5iX/QazS0X5gfV7nWP8/wBHyce7m6R5id/oNZpa L8wPq9zrH+f6Pk493inW3zLN5LFVf0zaP8waj/zNzrH+f6T5OLwusPmpXRbY6jTUmvNfXbnWP8/0 nyMX0KOi81U6YsyxVSp/Zm0f5gxl/wCXuT/Mf5/pqP2cX0Eb5i57DWaWi/MHP6nd64/n2X5WPcxP MPAa3S0X5gn1O71x/PsfKx7pm/MXAazS0X5gfUbvXH8+y/Kx7pmvMXAazS0X5gfUbvXH8+x8vHum a8xcBrNLRfmB9Ru9cfz7Hy8e6ZnzFwGs0tF+YJ9Ru9cfz7Hy8e6ZjzHwGs0tF+YH1G71x/PsfLx7 pmPMfAazS0X5gfT7vXH8+x8vHumz+Y+A1mlovzBPp93rj+fZfl49zZvMfAazS0X5gfT7vXH8+x8v HumzeZOA1mlovzA+n3euP59j5eHdNl8ycBq9LRfmB9Pu9cfz7Hy8O5svmTgNXpaP8wT6bd64/n2P l4dzZfMnAavS0f5gfTbvXH8+x8vDumyeZOA1elo/zA+m3uuP59j5mHc2TzJwGr0tH+YJ9Nvdcfz7 L8zDumyeZOA1elo/zA+m3uuP59j5mHc2PzLwGr0tH+YH0u91x/PsfMw7mx+ZOA1elo/zA+l3uuP5 9j5mHdNj8y8Bq9LR/mCfS73XH8+x8zDubH5l4DV6Wj/MD6Xe64/n2PmYdzY/MvAqvS0f5gfS73XH 8+y/Mw7mxeZeA1elo/zBPpd7rj+fY+Zh3Ni8y8Bq9LR/mB9Jvdcfz7HzMO5sXmXgNXpaP8wPpN7r j+fY+bh3Ni8y8Bq9LR/mCfSb3XH8+x83DubF5l4DV6Wj/MD6Te64/n2Pm4dzYvMvAavS0f5gfSb3 XH8+x83DubF5l4DV6Wj/ADA+k3uuP59j5uHc2LzLwGr0tH+YJ9HvdcfWfZfm4dzYvMvAqvS0f5gf R73XH8+x83DubH5l4DV6Wj/MD6Pe64/n2Pm4dzY/MvAavS0f5gn0e91x/PsfNw7mx+ZeA1elo/zA +i3uuP59j5uHc2PzJwGr0tH+YH0W91x/PsfNw7rsfmTgNXpaP8wPot7rj6z7L87DubH5k4DV6Wj/ ADBPot/rj6z7HzsO5snmTgNXpaP8wPot/rj6z7HzsOkmyeZOA1elo/zA+i3+uPrPsfOw6S1snmTg NXpaL8wPod/rj6z7HzsOkrs3mPgNZpaL8wT6Hf64+s+x87DuuzeY+A1mlovzA+h3+uPrPsnzcOkr s/mPgNZpaL8wPod/rj6z7J83DuuY8xcBrNLRfmB9Dv8AXH1n2Pm4d1zPmLgNZpaL8wPod/rj6z7J 8zDuua8xcBrNLRfmB9Dv9cfWfY+Zh3XNeYuA1mkovzA+h3+uPrPsny8e65vzDwGs0tF+YH0O/wBc fWfZPl491xPMPAa3S0X5kfQ7/XH1n2Pl49zF8w8ArdJRfmR9Dv8AXH1n2T5WPdcXzDwCt0tF+ZH0 O/1x9Z9j5WPd5Kqm80TvwssVWjfbNo/zBvH/AMPej+cfz7Nx+5hHVqkor/TpF1hrFevKqTKL8wMv /D35/nH1n2TL9zH+LeyPmDgFbpKL8yY+h3+uPrPs5/Jx7rG/8ArdJRfmR9Dv9cfWfY+TiuNf+AVu kovzI+h3+uPrPsnyMWZjvMSsVJVgrMdeRVm0UP8A+4LH/g73XH1n2WP2Mb8bZp2X6RLxfgFarlwv dnKLCq//AJIn/wALfn+cfWfZc/2omUnp5jmJBlhrET2zaL8wI/8AC3uuP59lw/Zwjq8qUnmPgNZp aL8wa+j3uuP59nX5uHdpKbzGn+g1mlovzA+j3uuP59j5uHdpJHmLgNZpaL8wPo97rj+fZPm4d2kl eYU/0Gs0tF+YJ9HvdcfWfZn5mPd0RnmBP9ArdJRfmR9Fvdcfz7Mz+1j3bT4+n+gVukovzJPot7rj 6z7Mz+zi2j78n+gVukovzI+i3+uPrPsnyMWkmX7gFdpKL8yT6Hf64+s+zPPC52/cArtJRfmR9Dv9 cfWfY54XPX3gFdpKL8yPod/rj6z7JzQu0X36frtJRfmR9Dv9cfWfZOaF2i+8ArtJQ/mR9Dv9cfWf Y5YXab79P12kofzI+h3+uPrPsnLBtN9+n67SUP5kfQ73XH1n2OWDab79P12kofzJfot/rj6z7HLB tN9+n67SUP5kfRb3XH1n2OWDab79P12kofzI+i3uuP59jlg2m+/T9dpKH8yPot7rj6z7HLBtN9+n 67SUP5kfRb3XH8+xywu03z6frtJQ/mS/Rb3XH8+xywbTffp+u0lD+ZH0W91x/PscsG0336frtJQ/ mR9Fvdcfz7HLBtN9+n67SUP5kfRb3XH8+xywbTffp+u0lD+ZH0W91x/PscsG03z6frtJQ/mR9Fvd cfz7HLBtN8+n67SUP5kfRb3XH8+xywbTfPp+u0lD+ZH0W91x/PscsG03z6frtJQ/mR9Fvdcfz7HL BtN8+n67SUP5kfRb3XH8+xywbTffp+u0lD+ZH0W91x/PscsG0336frtJQ/mR9Fvdcfz7HLBtN9+n 67SUP5kfRb3XH8+xywbTfPp+u0lD+ZH0W91x/PscsG03z6frtJQ/mR9Fvdcfz7HLCbTffp+u0lD+ ZJ9FvdcfWfY5YNpvv0/XaSh/Mj6Le64/n2OWDab79P12kofzI+i3uuP59jlg2m+/T9dpKH8yPot7 rj6z7HLBtN9+n67SUP5kn0O91x9Z9jlg2m+/T9dpKH8yPod/rj6z7HLBtN9+n67SUP5kfQ7/AFx9 Z9jlg2m+/T9dpKH8yPod/rj6z7HLBtN9+n67SUP5kn0O/wBcfWfY5YNpvv0/XaSh/Mj6Df64+s+x ywbTffp+u0lD+ZH0G/1x9Z9l5YTaL79P12kovzI+g3+uPrPscsJn779P12kovzI+g3+uPrPsc0Jn r7wCu0lF+ZH0G/1x9Z9l5oTO37gFdpKL8yPoN/rj6z7Lzwmcv3AK7SUX5kfQb/XH1n2OeGce/cAr tJRfmR9Bv9cfWfZfkYpjX/gFbpKL8yPoN/rj6z7L8jFI3/gFbpKL8yPoN/rj6z7L8nFF+P8AAK3S UX5kfQb/AFx9Z9l+Tj3ZVPMHAK3SUX5kfQb/AFx9Z9l+Vj3ZVnmDgFbpKL8yPoN/rj6z7L8rHuiy /MPAa3S0X5kfQb/XH1n2Pl490zXmHgNZpaL8wPoN/rj6z7NfMx7pmvMPAazS0X5gn0G/1x9Z9l+b h3aSV5g4BWaWi/Mj6Df64+s+y/Ow7vf6vvn0ZddJT5Z+vfLT1ffPo266SnywHq++fRt10lPlgPV9 8+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10lPlgPV 98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10lPlgP V98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10lPlg PV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10lPl gPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10lP lgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10l PlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt10 lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt1 0lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fRt 10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++fR t10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++f Rt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq++ fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq+ +fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywHq ++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266SnywH q++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266Snyw Hq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266Sny wHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266Sn ywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266S nywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo266 SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo26 6SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo2 66SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffPo 266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ffP o266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1ff Po266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1f fPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD1 ffPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5YD 1ffPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5Y D1ffPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT5 YD1ffPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJT 5YD1ffPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bddJ T5YD1ffPo266SnywHq++fRt10lPlgPV98+jbrpKfLAer759G3XSU+WA9X3z6Nuukp8sB6vvn0bdd JT5YF9X3z6Nuukp8sDivnjynx2i0vuAnrfypx2i0vuAnrfypx2i0vuAet/KnHaLS+4B638qcdotL 7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfy px2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0v uAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/K nHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+ 4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638q cdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7 gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfyp x2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vu Aet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/Kn HaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4 B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qc dotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7g Hrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx 2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuA et/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnH aLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B 638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcd otL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gH rfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2 i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAe t/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHa LS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B6 38qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdo tL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHr fypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i 0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet /KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaL S+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B63 8qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4B638qcdot L7gHrfypx2i0vuAet/KnHaLS+4B638qcdotL7gHrfypx2i0vuAet/KnHaLS+4C+t/KnHaLS+4DSt b3SXoW5IGYJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICC d1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3 WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZ ehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6 FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW 5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbk gIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSA gndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICC d1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3 WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZ ehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6 FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW 5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbk gIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSA gndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICC d1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3 WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZ ehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6 FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW 5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbk gIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSA gndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICC d1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3 WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgIJ3WXoW5ICCd1l6FuSAgndZ ehbkgIJ3WXoW5ICCd1l6FuSAgndZehbkgERO6y9C3JA/LOstqT+vcPmFVlgZ+D2vrV/zCqywJ8It fWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/ADCqywHw i19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8ItfWr/mFVlgPhFr61f8wqssB8 ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/wCYVWWA+EWvrV/zCqyw Hwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB8ItfWr/mFVlgPhFr61f8wqss B8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/ADCq ywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8ItfWr/mFVlgPhFr61f8wq ssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/wCYVWWA+EWvrV/z CqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB8ItfWr/mFVlgPhFr61f8 wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/ ADCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8ItfWr/mFVlgPhFr61 f8wqssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/wCYVWWA+EWv rV/zCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB8ItfWr/mFVlgPhFr 61f8wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra +tX/ADCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8ItfWr/mFVlgPh Fr61f8wqssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/wCYVWWA +EWvrV/zCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB8ItfWr/mFVlg PhFr61f8wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/5hVZY D4Ra+tX/ADCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8ItfWr/mFV lgPhFr61f8wqssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/wCY VWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB8ItfWr/m FVlgPhFr61f8wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q/5 hVZYD4Ra+tX/ADCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8ItfWr /mFVlgPhFr61f8wqssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX1q /wCYVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB8Itf Wr/mFVlgPhFr61f8wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfCLX 1q/5hVZYD4Ra+tX/ADCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqssB8I tfWr/mFVlgPhFr61f8wqssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKrLAfC LX1q/wCYVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAwqssB 8ItfWr/mFVlgPhFr61f8wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/MKrLA fCLX1q/5hVZYD4Ra+tX/ADCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av8AmFVlgPhFr61f8wqs sB8ItfWr/mFVlgPhFr61f8wqssB8ItfWr/mFVlgPhFr61f8AMKrLAfCLX1q/5hVZYD4Ra+tX/MKr LAfCLX1q/wCYVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/zCqywHwi19av+YVWWA+EWvrV/wAw qssB8ItfWr/mFVlgPhFr61f8wqssB8ItfWr/AJhVZYD4Ra+tX/MKrLAfCLX1q/5hVZYD4Ra+tX/M KrLAfCLX1q/5hVZYFSz2rrV/zCqywI5bzz3K3bhN1wGMa78Rt24TdcBI3biNu3CbrgEbtxG3bhN1 wCN24jbtwm64Dx7X5gqqlaK01FvrKhn/AFz9imNlSv8A3nLO5fYgH1JHlutmNxr5c9pmL/hUctKa SnshF6u/TgAk3y5ZG4Upvx9fHfjf8QPl1VBX0qY1nuGYcn+FVS0qZS+xEixWgcaa7XhZ6UtfVW+l qHf9W5aKY6W//wB1yTuX2AfTjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtw m64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt 24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjdu I27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuAR u3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3X AI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3C brgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3 bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24 jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG 7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24Tdc AjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJ uuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3Ebd uE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3bi Nu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEb txG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1w CN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm 64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt2 4TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI 27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu 3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XA I3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3Cb rgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3b hN1wCN24jbtwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24j btwm64BG7cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7 cRt24TdcAjduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcA jduI27cJuuARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcAjduI27cJu uARu3EbduE3XAI3biNu3CbrgEbtxG3bhN1wCN24jbtwm64BG7cRt24TdcB5Kqvush8unk1lDU1s5 YSaWVQTFevtX++wJ7QPfTWLzFVQmXu5SJEpf8pbpGacn6Zrnv+xEA7TPLVlRP7yQs53XmPcq/qVA Pn1NobIaq22pmUc3+r/iS4/2mLCP2gfN+KeYaJ6MuNVQbOqw2tlC90I9drZyQ/oA+u2ZdHtR7Llb nNckWuShmKiov/bgWN24jbtwm64BG7cRt24TdcAjduI27cJuuAqOu/EbduE3XAZdPqV/0S4p/wBp R64DGdn8GuGko9cBM7P4NcNJR64BnZ/BrhpKPXAeSfNq6yrkWimt9ZSVFVhmVE19OrZUlP2n/wB3 McvsQD9pQ0dHaaRlHRsxJTEwqv7Tnc7nLzqoHKoqkw4QPmzamPOB8+fNiB8euZLqJbpU1ItXk6UX pQC2m5T5izKGZb6yqn0/7M6U+nRHy+Z395MaseYD6udn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cA zs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0 lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn 8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9 cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1 w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgG dn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGk o9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/ g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHr gGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8Gu Gko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAz s/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0l HrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8 GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9c Azs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w 0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGd n8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko 9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g 1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrg Gdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuG ko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs /g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lH rgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8G uGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cA zs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0 lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn 8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgGdn8GuGko9 cAzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgPNXV86jkLM+DV6zXqkuS1X0q40x37KfhmqoH6Ww2 iXapC1E/+8ulSiOqZzoKqR/qNVP6rfZyge2oqUSOED5k6pjHCB4J06KAfLqXo5Fa5EVqpBUXkVAP m0NYtuqm0SUtRVUtQq5lJLpSZuYq/s/3rm4HAffzs/g1w0lHrgGdn8GuGko9cAzs/g1w0lHrgKk2 oT/RrhpKPXAcHXKzLyXig07AMbfZ+L0G8MAbfZ+L0G8MAbfZ+L0G8MA9flNZE5bhd5c2XPSfOWnk zZSo5uak4MCp0rygfdqKnAuED5U6eqrygeVZiqBxmKsAPl1LoRA+UtTKpKymq506XIltmJLmTJrk a3EfgWKqB+m2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8X oN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2 +z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN 4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z 8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4Y A2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8X oN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2 +z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN 4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z 8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4Y A2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8X oN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2 +z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN 4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z 8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4Y A2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8X oN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2 +z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN 4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z 8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4Y A2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8X oN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2 +z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN 4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YA2+z8XoN4YBm2Porj5ilJIq6erk26StQqSHpMRJr1xWx h0JhA/XzqiCcoHyaioVVXCB4nTFUDk9VVAPn1K8oHxK78ctyYyNVv42uXmVuGIH36S62mopZM512 oGvmMa5zVnsRUdDCkP0gd9vs/F6DeGANvs/F6DeGAEuFnT/V6DeGAfWe+uTklu0aZIHPOV/Udo0y QGcuHUdo0yQGcuHUdo0yQPH5cnvbZpCTIpNjMx0VIYc47mA9s2dHnA8jnRAyBzmLgA+TVO5QPi1D pkFzUVmRTFgkcMU5gP8AQM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo 7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM 5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7R pkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5c Oo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7Rpk gM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo 7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM 5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7R pkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5c Oo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7Rpk gM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo 7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM 5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7R pkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5c Oo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7Rpk gM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo 7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM 5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7R pkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5c Oo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7Rpk gM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo 7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM 5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7R pkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgM5cOo7RpkgeG2TpzbxdlqEVrlbT4kW4uD EWPMgH0ptRHnA8b3xA5gZdyAfNqlwKB8ae78QH6awTK/4RTfgdCDof3aLgx3ewD6ecuHUdo0yQGc uHUdo0yQKkyv6jtGmSB4nUVAnfd/qssDGyUPjd/q8sBslD43f6vLAbJQ+N3+rywPm217KKbWW5mO 1suas6Uk2Y6a5WTcP7T1VcAHvWojzgEmovOBpZidIHmnTkguED49VOjEDwyJDK2tp6aYj1Yr0mPz cx0p2KzCv4mKigfsNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/ AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V 5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5 YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5Y DZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YD ZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNko fG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkof G7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG 7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7 /V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8A V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9Xl gNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9Xlg NkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgN kofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNk ofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8 bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8b v9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv 9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9 XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBX lgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA 2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2 Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2S h8bv9XlgNkofG7/V5YDZKHxu/wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh 8bv9XlgNkofG7/V5YDZKHxu/1eWA2Sh8bv8AV5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/V5YDZKHxu /wBXlgNkofG7/V5YDZKHxu/1eWA2Sh8bv9XlgNkofG7/AFeWA2Sh8bv9XlgNkofG7/V5YDZKHxu/ 1eWA2Sh8bv8AV5YHzXtkW+7y50rPJLrJWZcs6omz/wAbFxk/6xywimAD3uqPaBEnIvOBvOJ0gcpk 5EQD5VVOTCB8aofFrkwrjfhREWCqq4MCoB+to7dRU9LJkKlZjS2Na6FfVImNDDgR8OUDvslD43f6 vLAbJQ+N3+rywCUlCvfd/q8sDu5Llz19u3CbrwMQuHfrfuE3XgIXDv1v3CbrwELh3637hN14Hy7r R3B6y66VWUb50jA+XJpJst0yVGKtRc65I9GADxMrGTWpMlui1ftRehQNJVQ5wNLV4OUDyzqpV5wP nzZycrlggH37Jba6lY6qfV0bJ05INlzqSbMcyXGKIq51qRXnwAfYhcO/W/cJuvAQuHfrfuE3XgIX Dv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3Cbrw ELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN 14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9 wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+ t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhc O/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvA QuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3 XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3 CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh36 37hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw 79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68B C4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4Td eAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/c JuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfr fuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXD v1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwE Lh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN1 4CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9w m68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t +4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO /W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQ uHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3X gIXDv1v3CbrwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3C brwELh3637hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh363 7hN14CFw79b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14CFw7 9b9wm68BC4d+t+4TdeAhcO/W/cJuvAQuHfrfuE3XgIXDv1v3CbrwELh3637hN14Hlr6KtrqZ0l1f QNeio+U9tDNarXt5Fik8D40uqmYZFQ5NrlYJyNRWoq9LUVVwL+kDolTDnA1tftA4zarBygfPnTsa OHAB7LNb6mqntrm1FPKppWGU2op5k7GmJzpizGYEA/TwuHfrfuE3XgIXDv1v3CbrwELh3637hN14 FRLh3637hN14GnTKhf8ARbin/wAdHrgMY0/g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHr gPkV9onTnuqKG018ipd+21z6RZb19qJOwL7UA+NNkXqndCos9ZLbzzEzL2J/SyY4DksyYuDEfj9S H4gLLpL1UuhIs9ZMb/EXMsYv6FfMaB9u3WWbTubUVlor59SmFqI+kzbF9iLOwr7QPs407g1w7dHr gGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO 3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTu DXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euA Y07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7d HrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4N cO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64Bj TuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0e uAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w 7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO 4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64 BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt 0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g 1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgG NO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R 64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDX Dt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY0 7g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHr gGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO 3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTu DXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euA Y07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7d HrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4N cO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64Bj TuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0e uAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w 7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO 4NcO3R64BjTuDXDt0euAY07g1w7dHrgGNO4NcO3R64BjTuDXDt0euA8NfbtuRHLZ7jKqGf8AVz2v o4p7F/vsKAfAn0V+p8L7NVzGdeWtO5f0q1s1VA8+cnJgmypkl3VmJBf1RAiSrnOcjaW2VdTH+tLR iNT9Kve0D6dHYa17kfcrVXKxMKSJUykgv/vKs7/gB+iakxjUYyy3BrWpBrUfRoiIn/bAXGncGuHb o9cAxp3Brh26PXAMadwa4duj1wFR0/g1w7dHrgOTrjZl5LxQadgGNvs/F6DeGANvs/F6DeGANvs/ F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGA Nvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6 DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANv s/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6De GANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/ F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGA Nvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6 DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANv s/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6De GANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/ F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGA Nvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6 DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANv s/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6De GANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/ F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGA Nvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6 DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANv s/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6De GANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/ F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGA Nvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6 DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANv s/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6De GANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/ F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGANvs/F6DeGAEr7Pxeg3hgH1nvrk5Jbt GmSBzzlf1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBn Lh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaN MkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh 1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMk BnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1H aNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBn Lh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaN MkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh 1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMk BnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1H aNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBn Lh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaN MkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh 1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMk BnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1H aNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBn Lh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaN MkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh 1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMk BnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1H aNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBn Lh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaN MkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh 1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMk BnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1H aNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBnLh1HaNMkBn Lh1HaNMkCpMr+o7RpkgeJ1FQJ33f6rLAxslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJ Q+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd /q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vL AbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyU Pjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f 6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+ryw GyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD 43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+ rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sB slD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+ N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q 8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAb JQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPj d/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6v LAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGy UPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43 f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+ry wGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBsl D43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3 +rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8s BslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ +N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/ q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLA bJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUP jd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6 vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywG yUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD43f6vLAbJQ+N3+rywGyUPjd/q8sBslD4 3f6vLAbJQ+N3+rywGyUPjd/q8sAlJQr33f6vLA//2Q== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master02.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252"
‹#= ›
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/pres.xml Content-Transfer-Encoding: quoted-printable Content-Type: text/xml; charset="utf-8" ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
<= img border=3D0 v:shapes=3D"_x0000_s3074,_x0000_s3075" src=3D"slide0001_image00= 5.gif" style=3D'position:absolute;top:13.25%;left:0%;width:100.37%;height:79.25%'= >
Tarek Sboui
Reda Yaagoubi =
Yvan Bédard
Geoffrey Edwards&#= 13;
Presented by: Tare= k Sboui
Se= mEL: A Semantic Model Informed by Cognitive Pr= inciples to Support Reasoning about Spatial Da= ta Semantics
3D"Logo_UL%5B1%5D" 3Dlogogeoid
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master32_background.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODdhFgKQAXcAACH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACwAAAAAFgKQAYfm3r3W zq3Oxa3m5r3e1rXW1rXOzq3m3rWUlJTWzrXe3rXv5r2lpaXW1q3e1r3e3r3/73P/1mtKSkKlra33 /861rYze1q3/5pz/5q3/963/1oTWvWP31nO1nFr33pT/3nOtpXv/76X/1lrmvWP/3mullHulpYz3 9729tZT3/8X3zmPOtXPv1oT/1nO9pWuUnJzvxXP/5mvOzs7WxYzvzmPOtWO9vZTv5q33//f/75Sc lHPm3sWUhFLezpyUhHPvxVqEe1rWzpyllFq1ta331mv/5pT/5oTmxYTOvZy9vaXWtVrW1s7e1py9 nErv1q3mxXNza1LW3t73/957azprWiGtlEpCOhm9rVrOrVJCOjHWtUpSSiF7ayGEe3P378WEe2u1 lDrm3pzWvZwZa4wZIYxzrSEhaxn31oS9vcW1vb3FtYwpMRlzpWPvvWP33oQZIULWnELmUiHmGSEh a0qlhEprWkLWxXOceyGlhDqUezrm1lrOvb1a5qUZ5qVaraUZraXmUnPmGXNSSjHOtYz/3lpaWkq9 tXNa5uYZ5uZareYZrebmvUr3796Ea7WEIbXm3nOtlHNSWoTejHve3mvv1pStGRnmjBB7GRn35pyE a+aEIeatvSFj3mO15t5Sa+9SIe865iGlUhkZa+8ZIe86rSG1a7W1IbVSa8VSIcUQ5iEZa8UZIcUQ rSFSEIxj5iFSayG11lLm3q3mQrXmELXmc7WtGUp7GUo65mM6rWOM1rUQ5mMQrWPWzr21a+alUkq1 Ieat7yG1nIyE3mNSe4zmQuZSMYyE5iHmvSHmEObmc+aEUnvm5hCEGXtKGRClhHPmpbVSGUqM1uYZ EBC1zqXmpea1Unvm5kK1GXuUhGullIy1nNb/1pSMnM6t3nPm1q2ttZT373O11pTejFKtnBm1vd6M zozOzpzO1r3OzrX33r3Wva3mzt7v1r3W7621nKXW7729nK1SSlrmzrVSSkLOzualnK3m1r2ElIzO 3q3m972clIyllKXO1q3Ova2UlIze3q0I/wANCOwnsKDBAAgTIjTwb2HDAA8jQpzY8EHFihAfZMz4 7x+vjhr/WfQIUqRJiyhPqnyQEqVLkS9ZwpzZUuXHhQEM6tzJs6fPn0CDCh160EBOXgiRJg2gVGFC pFCZLtQYgCrVqkw9Yv2IVOtWiFC1ct2qVeNYs2WzIkW7Vi3WB1w1wvUoN25Vu3N5wd2rty/fvXdZ 7mWpl7Dgwn/9Kh5cOO7iu3TvoiO5tq3ZrZOjapbKy2hno6BDEx2NpJ85gkgEljZoLgA+0DmNxp4t kHbCf0YlSpx4O6fT37wVaqVMEizGhuzAOsHq5GZyj8tD3pT+0EDnnAT7pTaN2kB27963r/8uzb28 gdXaw6NeH947d++n328/7R48+fHst4P/Dr5oQd+wWYcPUwzV5hqAOAUolWzW+eZgbuhIFUCED3iG EIUNrtUgZ0tJqNSHHYIYIlhu3dTWRxRmxVtDLFKkFknWNTSdUVZBlGKNLj7EmwEV3oQQWhGK2NmQ vn123ZEThkabkgahY4CTTtb230D7VfldP9lhuR1BBiRBH3YC9WCAmEa1llMPvzHUW0JKrvnjRGom CGBRCLLplETUfZScRR+JxFFVHX1kEVbFUTfonOBNQ1ASXZ7mqGn96QcfePSdp1pB3RFUaWrw9TNN aowyaoN34UCa2nbhnKfoo4qeaqmr5nH/yeSUCAr0WZ2yichQZx6pyWNOZm04GYELXobiQ13xmtmu zPbqLK/Q8ihthZdVK5VGy1rLi2Lb9rXtW3hVhU5ddPGoF2TnwuXttn+VCFdmmVXF47K4sfXrrwtq 1mCDEUZonYJGXYkOfz7x96kB03SpmqIGmNOwpQe1VmZsTAiEm0Oy4dYiixn7mCudtAIcm8gMApeT RM5htWcAzfnJjst+OiFXcQs1LCuXDCvcT6kCMYoEwztjacConmY3qjmMDu3dqkVXeamVDDOaJXih 9ic1z5m+Wp+sP9Xqr5O2KeihQk3hhqJSFcoroVTodNU2Z57Fzdk/QWZV99kcUhujZRmS/9WWV4PO DJffdJ31lt93HR7SoCiiC+PcGkIVY9tGnbMUUk+mnba0R8Hmr297YBdlvzqBeeWksVrZ6cMCOdya xCfHLpvEaIJW3e3GIdSQr7VO6XDXUkoZNq7A4cnRc4EHahJFgu54KX1B27wf9JZqejqnp2cNqZeW Jn01pZo2qrB+BBEdX/dLb3fwqKemfrrqI8/2uVL3Yru72U9dOGK8wxK5a1L4sl+DqHWt/hnHRGr5 X2fkQjiu2CVdTJnM4CZ4orokLi8MnKC5mELBX/EiM1zxSLYOJzmqLBBYRfKMv5Sywn997kkBG1k/ wNQfKvXHU60bH8T047AA9DBAYnpQgf90Z6CL6YhjKyLinGKjjoAZoIkBmCFspLikkT3RP7XKYtkk 5CfoaEVmkGGgnw5lxSslLDVEk953kpaa0zCtYVJzmPWg1p3qqap8VXIjd6CHNYaRz454zM6jKkUw TNVwVg8i1mZs9BEPmu2Rd1NIj/6XFLoZ7kN0g1zevtIjyvgNKhl80bY8icGtWLCU50plZOwSGbY8 oG1pGWVUOjmWccnmbY3DXL6M8sIJJSk2pEtS8GxowytxqWlLg9SYNHUmH8YGTa6Bpjl2JzuHBMdE dKtOraQYvPh5h4kCaeIVrwjOKIomi2JjE7IwghJC7ekf8iDJOwdlkDkmjSBRc5j5FnX/Q53xcVGn KRV93Lg0pfXzYEDTGdY8pR8vMVRnSgNo0/bpqE4d05Bcm9N1FiQ7XfoPc5hs5CsvkzcPTkgsJCQh caKCuEuu9JWrzGBlSKnSyqDLLK4EF2VwqhZ49YqAJ0RKvBxJoCNJy4D98uW/ArCHcNaGIEyl0s0i VUye9YyYvyPT7xw0INjgJABBbI2OiLgbhAwIUc+clDnXGqDQkGmJU6IiybiqO98Y72XIwcjLeOGE QpFIhk+jqNN81imkUemN2Xvae7LDs59Nb7Hn++MfBSk1O8JKaT7LFCFrWMgsyutI+NPd24bzNg6F MIS49CRq+RaWu2WzcZpTy1kmd1qe/5JrprKU6U7VctsLcvBXeUFXCPsmlwESaJJDqpeEgvQk/SUV bKGJUD/8NUxiclaO+5FURXOyVYSYyUxxOlCB7mdN6cSpRTUj50UR2TBvikZKUCTZN4WXyNkQSEZ1 JUlLONKnlY1kIdjlDz4ZC1mI7vGirqKP+sgXYEwRtKBEixr6rsYdoDFsVFWLXoUjmjCtOU11BaHu UXDCwGStUJQYCaoor2XSsViGKcfaDE9dKkvH1JTGrexL4eQCmNvW5bSGM4uLQ1nCvglVRvtyjeRA 6sukdo5A3RyIOaVqyGQetoY9zPKYhGeUsF7sq3b6zUNwxOUwCQ+q3hGTFPvRA03FV/8dYYtvOZ2K TqM6aCJowbNyFgcoL7bFiqMy6HyuhDVLGbY7EbZyGgmMMEiVSpno+86g/Tm1OC7WPvsxTWUFqR2g VfTDNvRmbHSZ1I3mxZIsdjFJ6mastxi3R4R6G5FjiZaR1jTHOk3XaXd7W8o40CNA1i0EV2vJ07o6 JKVt7YUuxmQj/cuJvCQIL9BcZUPmbHWaDV8AUhMb2m05vGfyVUTUhF7yhtcg4hznU4HiXrg60d3E S2fN1tSVlhGnZX0SVEeqg9GcVZZ8PKusHqVKPfHx8Jg4w1LOIDXwh0r0YO+pLNEC3nBW4ZA7AhVa G9+XHRoiKEL3ZWmGKBMvaEEOuF//kRdbxMKVkjvyRMD2Na5XjluZYnClrbypKT8pwrSo66cKlJa+ MEfAUkdwxCQbUn9GFiWuCbiYAkljDn1o5gRx+WS5kc1tvEqR3CjkP1L8YcOa+FY6y9U3Zy9ZIufq 1bnKiUXjMo5+ocNAfHtlUpwKtGO1p+CEXvZR+7Gwpm02UIzz01KLLjQ/m/YzY0LPUVUbdEIZdWjC Q72fwvscyC2JX6mIhaZs6RC1YB4WHMsSMnEPMunxousd51rHsO+xY/hUl9oHZlqyVTlZ4lXcETdO NrDO0FJ7SToozhBsXKMSIROWnZxRnc0FIZOYxNSQaXoXzEOMXedrpM2QUdsgZPo2/9o9y/b6iq3t a4/dRm+TrIuYZCX7jo32BkLQ9zgtNQw7mPcArzUuhUqOHSZpCoNpa6Rg2GaAFAZRoFI99DFxnLYl HuZ01pVCIOcvevNiKhZkJmUvocQWvJdAshcYouRjgPJAvFZb4KI4pwVCsRRzJihLLeZTRBJUwvdK DEI/IxZMAvE1OdF09cRZl8c1rhN9RBgyEOF1XXeEW4dE4/Zu2ONMTnVF34dO8UY8vtFL5/dxd2Yg 8jIcujMdiqM4HVFPhsUplnZGqwJI1MMflqZ8AuZHcNRoC5NMAdV83VFZomIl75FGC4hHVTIqinJG EFNHT6dutlE3T5FJJ3JAdkN6Lf8FOWXReqqUWz/yayioLiRYSqcGe4UjiZkIZJFIShpSYi/CXDby WRaSNrjkORMybTQ0TvKnEzfDfA7DKavRGgQhJj9EG9RnJ1rHdUc4VkkEb6KRblYEHjkhZ+iHflrY dtexVMuIEyDnWSRyHIASEsjzFrtjQw6lRqrjUI/XPYVHKoF0MPNhZXk3PZnGgE3jcPuRcQmFYeCR Rg6lePShKKVyMFqzWdaVeUpVernxQT1XemFIc6q1SpEYhjZWYnyRc5poUxh0FhD0iTkGbHmRLizI FS3mSTIofFrxL5JzhU/GS0/mJNMFGuuFeYvXYQ+zVVsWREB0VgHABEn0ZRlDKF3/wSCgYQ7ipA5i p2awAztZSH5UWDLlB3LphJS+WFdfqFcgUYJdhDkGVUcJpmFXZVibFlGP9lgFBT5VpmE8Q4+P9U9B cyUVt1iKpzQRdmlsqVj9xE1TokugMUt784iwNjip1Fu99oI+R4kU6Zeg6BgnWJGtF3e9Ni7DFmRv Yzl46UuwRiRpEwCWsyBOBl0meXXJJ4Eq2UZpJTH/8TpfNUS/aE1jtRsBwk20kVFRqIx1RoW+lH5q F5sP8owpNDYjVlchMUYk0TJ9FoveM4BZeVnfUVGnQ5yXgkf791Co8457SDXVU2l6RD1SA3FutICo E455OCrsg2nIWEyiZiGUZEIn/yWQqodzuXVJM+aCHYiCkqhztVc4O8V66umexvZza2GYPbVivLcv 9uN7zvWPJKl5OdFUMFRtVGlDkgIxoBFEMKmEUJhf4+VVTPiL84WS2AEgPRllaVdnRjmbHVqUVXhn ZzUgTdEUZMERI8En+jUy2MOOqkKHpiJhbHlhBEh/62UaDGNYgfcdYrlHVaIfjaeGAhg0q4KP7dhP eYhtBjolbUWSInUtvOUWFIQ4qBSJp8RB4LKeIthjPaaCg9kYD0mYJbZSlohSFyghGsEvjbRAwkeb 0iVMSrVW6JBumjmAA9ZeryN+wvND5BVm1nRNOrKnASMxv+Mfy3R1WRibG3V+Tf+hdSC3qMQjlx2C dbGTXzhJHF1EFemDMAMYaJemgJ3CfBnnlRCXKp7iRg2XMz8DcJw2YY3SjnBYNFiplYnFaaminQiD PYN2Gi06VTuhSK/ZcmYapZsYehPkOLs2kZYoe3SBb+vZkLHnnlgapsvaF+ZSFjI4rD0SJEOFg5+T g0nSGeqAfLYChNZGMPzBokSoi8LRQ+GmRF+mG2h1SPKXjKfxiq1zdlJkfCFafohahf4qkguBg9hU gmCkon6yEK1qlpblhkpqcVwpgMs5cKpCPjJao2h0gLWKabiasVPDaUaaf1zSRh9GEOJURRuyScYq WyeYgqgkexTkkMkKsxNZFTP/44mBkWOsp5fHBkpCp3JLtaZLkTaWM3SjFiDP+F7BU0g2SovhE1ZW dCZdpU5IuGXBgRUAEz5PdK/vZRvbAVgAE40Be4MfulSuKTb0U6J3siLL8wDRASgjUynmaGF9SHFD 6ndqlCr4V0fbObKqM2n1aId/CKPrU7EGJocONQ2oKquc9ij5iCXGKYHUdoVa1znaQmR7eVvhoqyE GZ83+7lb6hfS+pfFxZBYWrOjCIlRsSxHd1InFqdJFW1RcrJM+z5Ow12t864NunX19WVJ2KRt51ZV 17WJqqEgCqkgmrxlm0VGZBRnZSEopqIaITMJOxBW5bc/6jTRc507ujWWklCN/1Z/ArUq07lYgXRH a3i4Zhk9kgJZFxVoVfNvaoRdoJZ8lKu2d3kt6ImzxZprJMgOXQqtgAHA8CmYvLBXAnxTlfGeeTmt 1oFTe2NJwMWfNPKzpPZR5QognxEl1eZgXgkebWa13QReFdNMZhVE1hS2Y9deXBiaJgNX4xdDw8Sv AOvCNUySRqlLS/S6+AJuEeG2+naNgOVwGRdggNecPMqAoVolEDeA7Rux5FijKzlpGBYfisc0+ahH n7IzMCo9DYVZg3RR1JZuSKskaUqKv+Y3fymmoxvA7BAXrrcXeyIoeuFf8hmtp3Ra1+qI5Hl0MBWS /OJL3uo1SYJma/aDN5qrrP+RQ+yqdbCjMZVrRHLyHy/MIhsDEZbsIsDxob0TGqwJokM5tjY8sFuo hCEElc2zPDnRq85JeYwSq9NTWZQicNZzvb+zty8apD7jdxIGpPNoZXbYHbDCsAhXPQkjj4xyvb/s t5vFJVNmG7Q5Sypoe6g0xw/ZHD4GQQCsY8zKV6cGrXRBrabbzcn6a7CUepk0SSgEa3bTOdcRuyeL klCCUedKZczEwiXjrrxjOymMVmKGyZrMTipCHX3WRVc7MqwZIJ9MmxoMQDihtik7yUR5mzFCNu63 J3bnhgbIltCjuNuLxJG2hlzcjr+zXmtIPfqBzI9HYOOYYYrsgIsLy9azHqX/YrdYw3+HxKRzWbma VC3NgRe99sbIysD/8MaEsVPYPBhKvRc7dok760CaW8BRrRklJxYnNhm2QixscxROghQESpsVGoQT 6DBkx8I9MKILEUS+y13hdkQugmMu0lc3URzP0RUM9DKDMm427IyJKif6Q5Q4/JpDGZl2csl0URJz hxsFhaNcsk/hu7726LdxNIiQsj2vgoYPhcx0mJVHKlnyW5aZtniUpTC4aqSqk8RtmFg6fb+5IqUj GADysJc5VkrbvIkeAcA2e7MrGpHh3BcIjKxSrXMaiFollkucoyGtqD9JC9adTMaHlMiUYma7GDy1 czELOjEpjF7nBdAt0oF6/8abcgHeHYHJbwwTWPF16JTQDG2FaifYteJROolCSql1PmJ3QBwZSvrF qyPFSoPLtJx/+Pe938F83Dmk6Rs09JG4a7SpDnWHiwsxi9bMVlaPr4o1j1tRT3wlw8PTBBmRxcoV dgfHteUXUq3U3Jwu5R1C3QzOnAvV4lIX5gJKnDRiwaKKHxkV+6J0wtQPnTG7PziIclQpVFcmL9ll 1w0Rj5x1B90i2NR+lvoyhzPemTwoeyUSfULXIOFiTiGbIvOocmNnN4jeZ2tfIlJJBps8GZGmEaUw G31HV/V0B9awiVWGk/JPOuNHWCw0fEdY2eNpp4NhjCYqgQR56yg1oN2HsP/cE1HbL0qBX6qWpSPe 1BZZGCU4GDYrnw151IahwFbOTrrm4TsXeqt2XCP3uhriZIEtYgOzRL5qXTjUHwM1rxRqXxZTPDsi ryHBMmBYHMexa4ltxyVBKG6bol5BNmLOjO3d2qO5IeVXK7tzFbehX9hsb5+Rr9hmqoVlKuRYKfAb 5NYTUHm0eIWGgHroqlaJ4O6oy3VIVbWavok7aZbtooM2WWE9J9PoeTAGpVtaFf5V3janb5QuGCxh 1Hui6ST+F1Ide8nqawTUQTTXUwOJ1UbGXDoOjehmqJqZrt8Gms5EqEeo1mZSqZD8JuXGG7nuhdZY HAfLPBcRAFD+8rqpEXj/bd5XsewSvddrh4M8nX69gyBIkth8ItdgMp2ZVouCR0eqQ6NFgxrMt3Cz DMyEbtnZBtrZg9LruJb9Tb5Xyeet3D2aVjSPC1H7XU8o21ytzYjBlcDUfMBNTXtnYeVHffA5K8At LunKqmsXlFq2FJIsxEKS+ddk685S1NWFWIgQk1VuN+TCWMnq9yanLCMscspilPIYXRXR8X76VtRz ZxHIYxIIFGYpe0t/jXUmSt8AyvNz+RRxgi8VITh9ZhC7KmDe7tE7FHUuOpxcWZ1yCOHoeOeIXoBY EpYMnkznfuB2SmXY02AJpefUmR6qrW5ZvdNnj1IzGxj8W+mFYdQ/JxdG/71jbk974c2JfZFrCEme AykuwPZyHjRCgizImqdu0CUUnFJDQ46n7wo789a8kizJwWiphBLXABHgQYB/BHk5EWjwH69/Ax80 FFhw4b+CDhtOtPjAyUInDz0mDMArZIAABgKgC2kyAD6SKE2+LEkSpkqZMWfGLAnTZkyGBjsGYAdx YM5+BpBMM9BvWj9zRZ02TWoUKVOlTqMmNWc0KVWoTJMYAFsUiYGvUfuFc7oUq9WxYs0utUp1rdat 5r5WtSu1aFO0Bmwknaq1aF+3hN8W/fq1aderSUsWvWmA10uRJBeOFMlQpEOBmh949ixUoMPPpRvy YveQV2nSDEuvnrga9P/nhZxpr+6ccLXkkBV5T075Dx1wdLxNokR5UvlNyOrCmr0KWbqBrNQDmNtp HWzBkgWxkwQP3mRBkdwlEkyIMKHtAAgHXlT4jx3BiRFdu2/onmBQja4xCnSCoYsesoykybgzCbgE VZqpMgZxMjA7CG8Sz0CKPJIvv4eoe46ptaYZq6y2BLsqiazOQiypcMAqS6m1xhorqr9GjNErFRFr Ci60oMoxRMBS7MdHt+K6ETrBppqmqaecWnKxIaG6izoPp3upSgmPI2mo2Dq7bKD5HPKss9cWYsez AEvj8rYHWovtgTLBjK02MXO7bSHN1ptsM4PQsTNCkfjMbCQDkDtJMkP/DzU0J7Aa2wuyknoo6jpJ GewBrAAqtWy8TAvk9B/JyKvvPfTOU+289N7zkqP/HgoqIgw96ogjVgc8KFVRC6KpQl0rgxAl4Ja7 MiecjAMvuZEwWjWnEVGMLkfodpSLSLPcig7JaKFb6kQS2dpqrrigaisvsdQ6ykYaDTBMLsa0rW6s wMJSa8h0oYIu0kWVIxTYysoLdKA72QPYNS5xA1PNNjtLTTM51QzTX9v+3Yw3h35LMMtPeStOwURd CqAfRT1eNCpFn1PrquqysqlS7F7y1ABcw4uJO061BO88ifTkDD2LCHpPwIny60moixSe7yL+htZw wAFtA/S4l5VbyaYH/1geVtfkHgw2pfCEehUisECMaiwnw5aSSGqxiqo6ruSqMdsbGftrKbCZddFH E4v6S6m24jUsyrT2JvuvehmL0ixwwzoxsCWlJHHRopy7N1HjgON1pAj9HekzzMAcuOD1vpSttjUL VrNz02UDlE4+AfV1odQf8LXQCFMSCUvkLHXpJZA7jO45S1dWWViSMMWaifFy9dS84yvKsrf2bOY5 PeZ/1uwniobeiLOjP/ooNaAG/H7WV9EzKGasa8+O2F+vzppCnCqDKKhaQfK9KrKkFBd/xVqkdzrI ekdbWuKSrnptay78AxKJYISVr8TIWwaIV176cj9t0SVkVknbU4pEJf8jLco5wopMTVAylH01byjr sdCdFBYm0JCJMw0zHcMWhqc6bSYzExlhonqTQ17g41clcUntareHRe0BiI4JWf18dzJLmSQrlTIJ PnrQnZzIjHwyMU/5alagFXIkaDf7R4Aqgp/RAEhA/oFVRILyJaU5JFYaedWZOlIqgzhNa1ijyYN+ eBOOPchKOikPhtCYk7HFqHB5Uxzjlvg/uaylK1mpEeMa5SRoOdIvz3GWdLQlwPtB5m5qmRtjzIa2 54zIcZt0HCYb1TgMclBCV4MJ+8ATqBLuizyYad4K4RQ62cBJhgSj02ZSt5sXooOEAjHA1DJTsQXx glCHwom9mug/sNT/qDolEcNLeoAynWBxZTDzVKa405MCTS9o5UxInHpCoKNFJHoXgsgbjdbG8GXI Ix6pVa3kc8+GiGogKgmncgJFEJ2oJHbB0omv3NcbWNmmQydaFtmoghYO/s+BpGQU4q6yN2oyy2+X bBJVstVAiTLGgJARXIzEVpR4ISWDHPKdIqlUUSVeBXKDUhQQZaKgP0Ftas2bJWZAhUt/qfNhByvd LxcGw4hpJplPFShBhhOhc4jwjhrz4KCSeEGS7QUsKlsUpoBXEyq6LDzI29oWzxMghaxTITrLEkUO orCeycdVYmRjqeDYxo7II2lwxFBe96kws1ruQUGsmk3QVzXJKbab/5aLY08c5yKyZOVuBsRoKjWL QbowUpXVBK3hZASdvP2od2qhl4kq65bFgHS09xOtEuPF1Zf27kS3bUxMwQK5kmiMsY41EJYmc8Lk 4IyoQrUhnuTDS4fZB024gS6gpoY5zPEiUIZaCFTzdMeYFGUyxSmUSSIlLc068V4rK2hAL5XH5G0K rumE3zlFBZS3DmQjB/mZan4SFKWhEXtI8xI/XzW+1PSzI/qk1URchpJwespBO51QTXTIIMpFpjz2 aSOuFoUEaZWFpOXqYHlpa7JVAlCT38IkifG3Nilli0gtmm2KBtesEl+QXrmFaQUzaqSOGeCm/7PJ SxCrUNk11lAD9f/TllTYJV3SULnGxJNyrXsZhkx1uiup8jJ3SmHbKajHSCTiVlM5HSguJmUGqNQU v1oSlhQWZma1osym1zwwjgohcWKV8x5yPYUBCENiHFCs+IPXu7LKNV1b04C2JxqtQU0lv8ojWUPo R6t2M896/ecpL3muGe+2SpstL5XopdLQosiyR5LLR2H74tEezi2KAQypA0jbIdlYiZz17KKuKebu PgaJn5aQvgh1NWdeJrjI7VJvMgMaJ49pyp55XVMX4kNcjrAkmhsusYj8TLBMponOoaaIv4My9DaR oDTBVIPdO9/2ooec9WFeXUcVkfjFO4yClJWG1sPXWRXYP0dDTaD/E62aRRMonPAraEsgnPBgERlL uepevWld6r6M7YJBFnPGdzxT3gEwbbPWSmtjZFIX/e9HmwxMiyx40VJqPOP28ljMo/JjEBoUWLaL ScZuXmH0gfen5TkodZWdbM3tcmC8tFOXkons2G23t7NcEHeP4+MmgqU4obagh2IkqZxM8VFV7A6D rMgpcVaGZnZ1d0H0E293WuQ+6WTj9ni2T4EvTWkFHrhHvtSfv65JjPhsL2+iFhKWJDbhN/Eysbrp HwF9xMYs/Ra3QGYTkO3uy+HGMdZ9R+prUTAu5DJSJKEyo5bPRUWI89+Nc8vxyVc9ZERJYgCIeHOc 154nklsfZhak/8yR+PBTtFS2bqjM5JC8UE4sHFhKBsInZTOfcjl3LDpu6muqr37Ej2oi8dBsqfU+ 1nxqtZzN7jRnzhSkVfIzf/rzqzRk1coiskJ0ve/5vUUfbXvZ05DAikqZYS22j4b/rYfLOfMAvFSR iRETIJKLHMoDoZHZKmnRMVnjIBC7CsGRDtSarYgSLchwIMyzIBEzOSBLIt6aPEfxtC/LCW8zIpxD LN9iJmTSF5f5DQeLkE9BIVpKNugyqszJMuHAHGNauuGgmD/5FORYpsTDKXToB6zaHc+aDiYqNyjC opdgApKQIioKjxNCp05JJwCBK4p4K/golYkoGqKhiIKzp7/rq/++ayigybBE4w9Xmad2AglJs8NJ kzDoIzZzs5C9wrc81LWugiRPM7k/shSQgZxCHDERs74Nq59BlCSQOwtScgoCiqS36DhTCgthAbLd mb5DdL3uEi+aWEIuU6yRUKgjxAyWcLqnC44/IRTjWiYSysGDebali5jqcpliq53LiB0L25iZWEHd ggx6wb7tMwkpTDOW8b4tQieZ6RnyGao+ixNZwbCfKTTw0S9baUMB0683tKd8c78M2Z75SzTLkCX1 uT2EysP/40MMy4j6uCLxcLXV6xiiKIkPij1DFDNc+7hGwqBLhMDNC4snfEKuwq0Uw7Hd8Z2cqroe c8j04ceYmD3//jtFgoLBAKgqGqSMyeFIHHw+3TiJ3RCmLEMmzViyqaoy3tOaqQEvIULFxOuH3Kk6 E2wlhaQXKPo0N8Mi8Rg7mSkPNwOjcyKVO0unPbuz92AjZMkreUI0wFqueVoTv/JDqQzHV/mSveuI vQOJ5SOrYFO8YEuO3Okt9vo7u9qzuvoIZYk1reCwi3s9qhPFfPS0D5Im3SJGDmEkHeOdKYmpm5yx m8y1q4C9EvS0UQShuyxFdQgiJLKX7PAtB3EmmDzCR5sdbzuQoPzBgqgq7CIOKgsJzWAd14mNKgPN kHA+wctM6OtIslxBhsw82PoqsOCm9cIUKTSHcMKU9aoZgLqi/5+6Je7Qj/kBI7/Cr0OTw3yzlVgR mEGzlb+6vwJ0TgH7KwMTn4bgjz1DuDwERABMqKeTHHMbGkHinq48QL8sxiDpnZFBQT7EwyQqxBDU vBGpoFU6HHbxKr9cxPTULIzbR1CsObm0EhOsEp5qkJ3AibEMp6GYrqfivWzTvR1isNWhTMlgxZbo l98QiapaSZP4uWOx0JTAmJToI2iaOusTTNo0L51kkEgbvMITSnDiQlAhyraaHnnLj/h4P+6pzuuM R74LrKvEiLhjiDKJyvGJo9GBiOGqCUiDzFN8z6oBLzcctMaDL5mIIL8ISAP6xCvZSXw0RPnEy4Us NbykKesbuf9VUsTekQ5O5ETd2cm4BC7vMjcu+y6BmpxhQ8XgGoqKSU3MUKiiSh3lcz7QjMbqQs0g dB2eqEEhaia5VMLDHEX4lNOxEJbb3L7dhJA3kzOQgEbw2AjLMK5QVRWB+Qm3O1V7+p6rrKdEkwfA qqc4lDvn1BB+KjD5wdW9CrgAg4iD806w3AmHIw4+HCQMsRwHfIpDCj025R1gibDWa72P6cdGdLlM ZEQNArWQAbd7rNNpcsiHjJxPA46ZbDh8MbzFqioLmSrkwlCgG0kHEw5cGkmi8lOYFA6nyyEY3K7W CSJPYR8BxKmOzEsn5JDqWMbtY0+SyM3r8JQq5MlOZb5PLT//o5Q3N4oeY90zNvIv23DDqvRG7OQ3 WHGNLzlLVulGuvNRrwmoqKM0PIS+/rM8A1BDgXFAw5mOZQEbEXHLmIK9sGhMBJ0JfbQJfdS4jgox rItPj5NUSnUlAPXEQbmpTfy1XvtZ3CtL9nEmkqgq5PAU2KGy1InXYnPFXDyWP6HBZVK6WmId2sFF gbidf8rafbWduf21SU2l6oAJvK06TM0USptCZ3S3LbylobiznmgVpKEvVYkjVXXON5InvAvH+kvS NbE/k/2HV9U7OBw4oIi4z/gJGMyVw+u/styy5QBYAZMJJqnHcsmLzho9GhOll3COxEOfKP1S8bo8 RmTaf9Tb/zV1nJGxy5kI2qz6NN46RHyJSyFrQI4hywShNuD40D8hjh06kOFwsIuJmJbEKRz8PeES Dge7UH1tibAVFPRRED1FjphVwpMYzLgIHgPIJjWTwuxjLyqyosIytjorHzCMk7ULGjYCNKWUw41t IyA90rMUrEvDSgHDu3I0GjdRNOs8R8O6uV+NJaANNvqCI9AKF09CJWYJF9IaHA4SmWjNkxEdXpkQ 2jqtWRK+1omTJplLXphbQHA1xI9hQANYweXwsqfLF6DljfC9LslErOv1yn1pHSb9xVnstuLa09Xc Lu1yxRF9punV4TjNtUIcizLTNa77Dpf54rOaR2lMK1FhK/94ExB6UxihQZbO3S+rDNJufCM4WiO9 A9l7mqMHts6GeFVayU558g+MhDoorTDSnRwsMcG44oznQKRo+WBxQa0oyYtHIq/I6WGYSDwv/TKR qb4WfsCXqpEAbcDKy2G6/DVSXt+kmAyQ8bZuY45T/L8TbqreoBgY/F4KBRUhZAhDmRofZCYhuuVd hsmTtEyFUs2NuVffS8GHi1rwAosdfuG9UBSDpZTQFY8q3BQ4IztT4Y73EKMwZAhA+xI1DqN1ckqj ycbsjL91/tjRsdW8Wxp1XqM2KlKUrUELXkdH67+O5IkcNT2DbEtTqjVWyhG3WKB+kBZEBFityWQK ATYkWuH/6tuqmsuJ4P3Wi65hE33oh4RNQ/YyPY20QQknYzm27R1CjMEVXslaVLyMpZMM5gvRP9W9 7HrFBD2JPjphhUNfX+tZ+WS5J5rNoHYiQe7bgFIvC7GcnpAv9DjcdZIrePKJuvtG/GqobcSewGqo 8OkIQdtjvMNK7Pzqe3KTB3jVPCY4+OCuYJU64Orh/1Pk7MILrkiMzkKKBSoS1rURVBOM+pxofvYj mBRd3L1haeLWROTpun0MU4ZImBPF6jNehUbMori6A2xA4KrXk5xX5QviiInXn9LFXW5QGBQ66z2y sz0yjSQozCxLFtSp/2vMKnGOEq05f7QOHgmr25YwXNFU/5gBv3kTPxuFu/XQD74TjTyjJ3zrGvtT I1fJzn7qJwgeOD326gceMKcUWaic4IsMIcQCRgmzFGRRUcjbQFaam1aKMcZRi9LiEafgaUSsWgR1 x/SBHOON0yCjPuHNqbtMTBsuiYoMV4ecb+blYZpo61zpLVbcxfJNakHpmSObOq+MxacbZkExNp1b nVkC6Z5y8I2ZXa3qmOKI1KPlIOzADg8Jaq7T1GqOM5owlSsl1TCMnjeau9jAvzbUJ/6YZ6vG4ziu 1Tt27luFZ79bk10Fa+ce630Sco/oY9WokMMy1+9srGfCiW9E6L1GG5JiIOgYxEY66JMijHrEMcis ven91/8GlN3Ahsgz/zWiTWzBRijhtehQFPA99Oh7pUEg3GXCUw4apGVhZlsQ5b0i5D1lglceCq7T HtEodtR1jKULbow2D1eOow51wFsoksIIQ7Ow+8ks5CJudqu6Gj9v7qK0xDMhRTQHRkPxsdzops4k 3+NVX3Ujz2O8O8sHy2cK42HGMtDkGJCvYZtOWq0s5ahOgpINaq1KFO9rAUx97LmgsjmOAcSZeNqJ 1B2MxkNCGS+pdWa7BSFvUzjEU7ixtSpCZXDwrB0SGqaT6FrwBE1VxK4lVnfUTkfVnnMPv+Kd8Jir uzrazjwSV9H1Ah6VaDPulFFRJZ9bOZbEfZ7vuUb8ag//7cmQQZIfGQc4p8RVI69uCE6NOt5qzVW0 gbP4O/Z46Aa4kibkEDJX1pTwduKkWjNoYA9hupGkU5N5ufhyzOJkyGl2nDPkYInWAY1ShaZolHjN 1bZvkBlGkcj3nQhJh4sqrfUTzI6QCu9BlbylpqMdzMbeQg8uoNtlnWPbS37yXyFQENeq6oPNXKNP Sk+bAxzq3+nJSymrOHPGbnYeeKtGgVkVqUZnj+1Rx/036S5yVsd4y02NraRusKZOBx64OoYIXZm0 RRfw33IVXoBE1VKKY2850OMWnHX5ztqKFbmLJOk8R4kUaDZQH0ZN1f9ZZx7aw9RkSDXeICPBjWZz FH5S/wJ3vt1fdwZjUspxvqnPetT83hty4hLCpR7aF2ha9OgzVyk3lKsTbKJFlB17dO2AovjNle8A j0vn7Rn1UPJ5cXj7woc3f+tpPMVFGlrd8SSNYLGWyo3fJ8RvYIznalrX+LwDLLOuau7kv7AECAO8 DAQYGEBgAHQHFwZ4EIDdv4P9DCAxMLHixCQUp/UzZ5GiAQMaMRrgKNJjxY8dV3I011GlAY8TLbqM OXNmSIIG1OnkFeDnz55ADSZcSFBhUYU6CxI0qFCp0YFLQx40mPOgwIlYtx7d2bMpwp8+B/rcWjDA P4QIDaY18MAt2H/ofM4l+JaX3LMK7xaUe1euz7cNCf8GOCdWLD6xR99CTVqV6seQPNGpQxfScuSb OjNzjknQo2ejPQiH7IE14k98pg+iNoC6LGqHsvvyctLwtsN/eB/80/2P9z92aGU74W28YfHfv4U/ eOBk9+/nynmzM778t3Pq1ptjV/4OYnMn34O/K96cenfu3MF3r359PVOgpI0WnQ924VOGxt/aUGny 5UQBGtDfRSH1M01NKQlYUX8iGWigSSAdyNJE/01TEUkzYcWTQCFZVV98BhEFlVP0dRjViYRBpRVk Em2lFYv9mBgUQ48FFdFYbhU1lmK6KeRTXLwo5RA6uimGF49hCXnYjwc5ZECRA+nm2o9FgrVUfvl5 2GH/ZJtJ1tVBHD74IGg4uWROAP2MFgCaBozm5mcEtQXUjXSmhRaeP0WEWkS2ReSQE3vW5ltDgvbG W23HgZccoowyGt162k0H3n7TFQcRO+U9UF1ymXb6TnDoVRfepqGGqt52+1HaG5BA2ijUVCj+1Nh0 QVVUkzkavVRROAHmStOCFvU6YGYJSrhRhTeBdutKDjYLU6wLueqqirOexRBUUB0F4lePWcUhi5Bt VuKJSokY1lkDKZQXWXe+5ZBBghkm2F5rMYXXjwIBhtZcafkEmL9VAUZlh1bNVVVCJZo7FVVK7UHV w1B2+aBmMJn0JpshgfZmtDqZ5hqdIeeJp2624YXb/217CuebdMyx+ud0yu1WKHvbBVeozcatKuqm 4b2j8283NOdez8s90M6oyhENtHbMEe2yetXROOOHWhK11IfIvZXRsRj9J+BHurr0X2YXAmtSfwqC RGw/w2p0ksYzkdSZjFhjXVR8drd62LVXT92YlwvNxGGasX6E32GE4W1Yukzh2PdP8NImlpH4RmQl XRF1OGVZdHVeJOZg8cjUk0FZRVd95taNU+A5eTUxTrG77lGbo6mzMUGjoRnAaHeGfOeeZxmpZ8ok o4UkzL7l5hBEJf9226LobfdQetH/I0+plWa/nXiYOjcedUjrnJ2p1bln/qlFZ8c0eDtD5De3I9KY r/+slY6pq7O4jrS22mc2S1KENLOSmggwJEiYxkf60xIHEXBMkZmRWo7EkPt06ytkoY9R9iC4Fm2m PoQL0VQ8N5jIEUYwgbELCvsSFr4Mhkd/QQg6+HJCJLVwVu0iTFkScicYlgVKstKWxAbCk8JJZGIE ARtnNAOaAKTEI2w6SJsIkpilyGc1IsvTn4j3nNucLItG6g1yujgz4wRqN2TkhaiUIw+l4cxSkcLO pdZnqvWAT3rYOQ87kCa+/dhxVHJE1XWIZqRuIaVa26IP4H7isgEWiH/+mQiBTiIgXUWIJBiyiNkO JKxNtk1AnnSWJF2itgchrJB7K2V8dkSarCEuS0b/2VZO1EW4bWmLIZ2Tj2JGmKOz2MshpNNL5Y6H sA49qXNNwRuQHmClYhbmJ4YREkLw4SqrhXAiVomlhyaCGYskhHVjeolNILOxurUJKGvaHVrclJgA rNN3qCGenk4GKDxBhJ6Hws2hnKcopcFMetZJGhlJpT2eeQc8msrj09aHPkzdsX3Z8eP54Di09KQK UXTCkrUi6Mr6EMU4eJlQTPDXybUByADDgqSBZEJAlOTvIwQMkCc9osCSmiOACARWZzg4TDrlMIeH vE+T8vahfnwrVgt71bkY8kzhHexf+qKhb340vHf9sl1RSudA3iIXgPUrqLsUDOQKkphznY6W9Bnc /1XS+soCVgykLk0TaNw0EY9gzGNUDJmciPdOPv0LLYSSTRbRIp0wHko6MTvjYWMWnMSuzzzm8dml AtmO7C3qOxXtGaMQqp5Oneex5infHRfrnh6aDpY7BSqN7AIeA/onQ8TKkK9iK6Gxca1rKpFJODxT kUoa6KQ2MRZNcPrJ+WxULTxK6mkzmiYTbYtFy42V344JJM1d0FrG9FFBrnrVzLmwIGMJasGK1Lco 6UhKBmGcYeCSykKaSCrqSgiYjpiTiCHRdTkpYGRoByfcUQVNayKMO/WkuMMQqouTC15sAvAo5D1P aY1SHqRKlp1EBZR5hyUfpZ62xwxP9jzLGQ9CO/+ctPOND1ICleOodnacxGFQW9SaH3328yC17XaS IBkbTUzytrdlqKYoHcnX+qFJuWEyWDMNqbMQOFfW4URaohtKjXrKS9QZUir4+Qo2VenkJG3ZX2mZ jQwj1zh4+QZfg3nhyfDlS3qNhV3ykUtT3NyqOOdLYTNSilbQ4dz7SgwmSExJSj+CBChO5HY5+S9W eucxXGLRePDMTTzLfLPnEYc3KQMsXiwFHfL1sY01I1VosyM+8mQWOwyN6HkmKqmnORizb+zZPyXa MwxSsGqOQQqJlCMRk9TYpUsuiWz/J9xjtfW3nmEksI0dQFAG9yX7QwJ+o2WuxlGQl9Zi72aGuBT/ GSGOivNRjC9veS+k/Gu7ZS5vuq4KOR0NidpESrcMtyWlY1rpRLZ2pWUOgpnH6Jmb9v03tLjGOtw5 sZzoXMjB82qn3wElUIrMop9Slmnq4UzB6EnU89hTMwhXmHp2nCimDvoeUp/4Z3fMDqNgbepN7TE6 oDqxxtWXM19SbZUYfdVC1ocVSx4LfxipSQB9LKyO8Hq2zQJpgJQ8LKAHa229EvoBZ6KR/VXMcDey 92F6qlHBkStbeDMuDPUClHqNcM2T45GbyRwlI5E93Ajb274StlUCg65vYCcK3iyTVKho8Es5mSXF vDJcurnU0BWB4k6cmLE1sabxrAEZ8cxupNz0/3U2f7INcJCE+QZzz2bs2E1xOuVGEzPte3/Mo8zJ wzOEnjx7RhPPHcWX4lNxFqCkMt96XuxtbJUWlZFTTm+flQRjUf1YkTx6ZN7WH0oePZMNDBaOkQ42 ZTWbtYP3oZbGPrUT2Sj7sELqXY+5lvI+OUeDlE2UkHdLHm23KuLNqpNUObw6JwQdeleINNVCc7Jw Sffu5XM2YQUAApzrKAiCNBLifcbtQNH2DRicDBhQ4Ejw6JXx1FPJyFNENA90HA+jeFyhYBynpceF QYrGvcf3VFYc+dM/PQD4wN6mlMfPPNQckV768BOneFiFPc8E2UhZzYgAao1P2JiCyERIaMSvHP9d TeDUJYFN/zxLSvAK0dUWgHiEEY7UAWESFl4hsjWZuKBOwjQOrUUF+G0fD9pSOl0LWOWF5JjZLbmZ GsrJwaCQMdHIKanL6KwflKnI/6VG79GPUdXHuNRNNwXecFVMhOjXf8UEwrnJT6CJOewQn0DeyOjV vwTG8RCKF4EZzIAHcshMhOWMdDgHGjmK9jzWCb6HH/GGpljWCXZW1MjcZ6EK7mlHQKXiHcVRewyP 1ZnW9yEFUFBHxvyawD3d9LEWJlXE8CVLkTVQ1D1SkcGETGRSSaQE/rzNr2VIbgUbEnHFdUkLrmmZ fcBYBJ2OUJGbXYAhXiAEkeBIk9BPdanb8bj/xi6R2zAVE5WwU1EYRpUEjHWlCIjkW8QohYG4yAAy mX0NWeDphBhojCIu5BN10BVB4MgICiXyCckgD8UBioUNR8wkyqN4VCyKHi2CGmSRCgx+j2gVTc1U 1kO9XCD5DPpsR6aECkCFnqtVmGf50h9Wy4f0IM48SdIJm6/sD4G0RFvhCoAYZXD1h7EUSEeITRGS FBEaS4MkCwG5DUlBC1fohB9yU3sdkvftVA7xi57E0H2kowzlxcEghVZVojBJzvhZm5stFUd5y1mY UF6UC/+hyJx5mzbxhFQ4UJfITjE2JUMeG8aUU2nACZ2oxiSKWaPdhm1cYm2cDOZdIqL0BqUR/9Z2 4AVzdEobeV4+CVT3SFT7hNrJVUfLCdLsRUqqZAqJuZEt3t6J8ZGT0aE/ItIrceRbOBIozY3PUYz/ FJ2vZGHgkQQBKVmyxY6OYVL0bRKgBUtsEaFgQtBQ+KFumhVpbdla+KLbNUmaCc/ZkRe8lJdugBlu jN/+SRNTqNsUQUlbuKN8kMsrvRdmBKbrwJffFdFgHtuDVGF/yQholBPvPCBV4NJSAA/xnEzxAIqB ZZFGZiBl/kNy0MxmiuToWZgshgpnLceoyaLsfU+HcpqnhM/5IA15YEo7pNwLVoempKT78Ix2IOiH mNV8JBV6RKVTYiVyDiWSOaVREqeDANBTWv8fSxWpFi4LZ7zU0EXj0P0HRlzfuOSmdFnbHQpFUFGO vVjVFx2TbAiEmjUEL6ARksgGGuFGmzVVbDTFOkkLVlwQXcRl6hjFUdVS3w3kEQ1immyT7CRROEHI TOgXYhrAQorLx5iGakjiFVmk8UCapOGJJkbHcOBTZv5RQOUi0dgkRc0kiYlP90iKznxoyFXWadbR q7XoYqmgeqwci5YK0bjKndHHXt6VR7FW8ZUUMg4dTAxhsUynVQqQUnINEWbITVHdsBxgAlnf2TRp SQkIe6VLBGGUtJlOUNzFMV3OazQOGqEbGp3nmaoHGjWHGZEpdoxpmcWQtp4F44xOelnbMMX/KX26 Uk/UTb/hp+uIScUk4UdIo4ZQxBN1xFbsTiKKjJwo3F71xW1cJMWxisPxxhoFxvMEysUFCntIWIZ2 JB9xKKhoGKtVivlMVvt02GJZFhyBz6nB4KeVGMt5T0ziUarmok72o8wSl7U0hIVpRrAiUI8CC48W Ha9aIzOChAGC04SABoA+IdnMzU0o3dERayOFkA+OX1nQn3FRawmVn3qZaZmlWrhybXXwwteOSteS q7g+AA3NhpmVZ14wDntKbS55Hb5xiQBOhYwoRLgQYNVVDHJ6hmfQFWlshhWlRuAunKNGWl9B6CVK 2vvcE2BNj+uJIhutqvdQ6GbBZHvozEFN/1b5bOz6UNYcnaDINparvqhrpoqmwqarDs2mbKch4Rxq GQClsE0SDh9FLO0nFWZQ0pag+ZpJFF2CNF9S1sTbBNe+7tbPJV30OV8BpdKVTs1OYRDCoOP7ySOa nqfZli2sfR6spZpHNUdDMAe5lum3cpHjVBec2kh85B98dZuV7QQQBSZ/fpOf3Q/FYOXOZUwCjob+ dpDvGOxjJmzhYqSfWKZG2hNwaKjF5kwJWo/HuqLocirnvt5+fJamlCYLRtbtnYrLoV6oWJZ4UIdl UYrqTsd6dGQrJRd2xlh2FBHyIYv/DMslEWtWvkRRImGwOYivhc2+NsvysQ20aGFkLCFI7P9Pi7gr iTyZ+B3XUKwTC1Wi+HLvLF6v2Zar1oYr2JptKj5E2aJp9Y7OwFCrCeFQCNkoIBbFw8CIlVnGZPjb QYZEVSbkkr0JShzEoIlL7RxE7+BVBDraBBbuo3IehKGFy9wMYmXHGuUMY6WqeBTHKpKiSpKuqiEU x35uLJIRK9IkimaYHXmwqqBcqpnKi3nd150wQkxH8CVrMUqdjpoNzz0fEdJugaCN9Z1Ubt1YgAzL ksIN0Ooq0glpnr0dtcHqje6giNQHhJap6g5N1wqUzTIHHq0uICHz+F7vboQvF5uXjlyGN14bKbuY l7ROG7sOEuntgzRI3wroYjImGWKQOyn/Dl+V2QBTjxgVB8rQc6U+Ss1UMj0TjRafCseu2tCE7uaG HspaiqmSXObe4IhSVMoZDUR8RwXz0anNaPTeXH6QYwl57z8syH+wFIH4j2/6aNFqBjbeLrLsrpAJ 3bEQC7GIVDgtm0rxWtEdzrfhEJQ1FbW22TGlC5lCMdeeh5hS89eexxV3rW4MtRUnxxWbrT1b4hSX hWDwBXh+8azaGWbgmbisDpTwRN0MIBzrqHDyLX8p5jnhcZ3szl6l2cFeovEQMsmszMwQsidqYiHn MyJvDylOSuqOGqcCTWsGh6jOkQh/hx7doIpa7gTzEci1HqlMk5YlUjj+xGeVVM81G9kc/99zCsjY eA2xnclKI6FKHGs44Q/PStIQ10QkkRTZsEiUqFvVzme1PgaYca8yl+0oiq+kqd8HUtrY/kY1S7Fs UPPWcrHkwIt2iRfNmhW2GQRO/J/rYIZBGuQP4zBrZQzfLqBdsZPiSKTvnKGEEgoXYWLF1Yo9Z1yE ceLGXap2ONbKYm6Jlug/EHZsahh3LMDKpapmeap8p2r2oGzqMvJhL1Tr2WRO4pIg2uicTY165LBS 3laOibQtn4lIEWEsJx2w4Fgz3q4mGZDOKqcqJ19O5GqzePYDfSO6Qs7B8MVT0QZQIzVRm0dQazFu 93SZFgTaemtx1Pj1osyOh+/k3eWUzf9KV9lZUviQlygFvpLSTNgt7DCdxkzdmDjiYi4gOkVRY+Yx 5IEMo3qRFl1kxHrmpVGoZ1IamXPac5h5tw7UpHyi9lBKLGoWh5ZkigK0CX6WZmHwdES0qv3Gzyxy 55awMk8QctWSWQnyb0Rlcl6S2BQjSe3YjF34SDml8M5vJxnL78qvcLkEDD8jsFGhSMxNGcbFMkEZ j/t0qjGHzQa1FJ8n+G4KcZep9up4t34rrVexbtQ4kmQzM70XgsMSL/QDk8ttV8+tYH51wD2QTXDM EqETnLwJokWkgPlSgsE1JmKgb0hapS4WxoGgiXmcIq83ZhG2q4aoBZ8iZSGNpoSqxm3/bLpTMg5O MCdbsnkYNg6q6F9bWmQfsevaeHaEtYU74WvJbqb37u169ogvmUoJCFZuBE0AWRSaFM7OlbJWX0kJ +vAkiZpRc6phj/Lw+LcydRUHN/Ls+FNbnqzfeo4Pd8mzOMrQ0B0eCRl7n1TMEmbQV+HwWX0RWUcT cVy5hLN/xkOGxDu92R5PYJ44h55AmnTURqEQ1sosz+bFmnEcciJnLHcU9PYIUtR4qHvUkWneImmC GAxeSiaTHMqBmEk29EOpIqqtPfqmCEYrV+RwByqH08+BEkK6VTIqIXSCOCV5DUpl+vThsp9mhEqB ElNqEoH4VsPQB3tOTuOaT7h+nre6/3ruSfEy+9HYai3l0/p5iunnP/Xn6zjoB4YlZs4vqdsFhV0H /VsAPAxz4TzAFVuxyVVc+WeNDOydMF53Uw5kUqR4X56lZbs8R9jIr3kIcjzHew+eZyrn+vlDn6bn corJjTvLbY+slR6cz+T6oOi5e8/RwGZqtpyrty62IQ47y5igEedM99iw+RZsdbpmS+f6C0hLrPav 5H8VDqtM67CyOCVAGBAYgBdBg7z+oXsQ4EHDB+wc/nvwD+FEXuwoSnzAa2NDiA7lddwI8V/Iiw1P LtxIUSVCjgwZFtxIsCXMly5tUrRJMKFBdAHQ/TMQIIABXkOBGlXar2jRgQb6CYRqQP8duqFSo2Y1 gEQg16nmoiKZFvWrQHMBzA09u9ZAj4FFexCVOzfAv7p3idq9u9BuX5cZ67KDKdEJQ8IT+T5wMlGw YosSDzt2rJHyw4b/2L3D+LCd5cWKNVPO/Fk0aMSbN4MmjRF1u9SrI2Z+3fAzY8S039VeTHLhVYJI h/4cehQoUaN5IS42ALbrVKjM+42damNqv3D9wGZNG3UaV+xZr0NfTpareLDMn2M3kERgWOfco7J/ v7X9+PVQu7dvKtCuS5EPOVrppZYcaogh2wq0DECHAiQpQIs84khCJwbkpSCdVDJoob9uyhAnlY4r SESlePmpKeECYEopdPr5Kaqm9pD/qj7nZCQLPoHYs5E+s4ZCoqi0fBvIrbqQEgovuvKq68KClFws SQrtSiwAjAyDCTHMJDKMMcgcXAyy2xxjxzXVOEsNM8Ryow2310IjabSHNHKiTcvElC00BetM07HP +HzHNDlh+8xNPw+jcr/iTESxuCCN0qih6gwY67z7vPLKPa3oy/G6qTb1DqpNqctROknjSw8/8qbB bytS7VtVPfaSSIs66dAjS6qC0KnII5WyZGkhiHg7KaXLLqLoIzURdAgiCTO06DOZrPzQJQo35Amn v3564DiGDEjISCaJsoq4n1B8SqCjZCxKnRrrw1RH55ijjqyzvHJLHbbEaEuqpuCS/6vbJKOUq6+7 BoYSIYaglFKlwhgzrCIvG75ss4QlMhPZyuC0bMw+UYtzzTErdk3PyjQCtuKJ0gQWWc0udvO0M0mW 2DJHjTNu3HBPXLSgIh3D5zv6orMxXqA7ve/S9LQ6OuntgP4qPvTkfQ7SVDXVKr92pa46O6R0ZSdA zAbEM8GPjqX22NtKDlDtsZVd2+GaWsrow508FJGhoET86ajejipxv6OEU8rcddFZV0YaD9/R1p+D du5H+9Li17cAhswLKSTn0ovJDeX+B7AoKXIyS4gzmmyzKb+E+ErWuMQst5Q3dghQtN88TWQ+JZ4T d9keSvPkMyHSU87kGPOTNeEv0/9sY5ZJO21LRX0TjrimiAtOy4mK+pk5rnKcSrqwaBVafHOkS2+7 7Z0TSytLoZNVavSrY/rTqDZNP/5zHSX2wJN1TfCy//03JZSc7Ux0GgmDErS2i8SEItfC0E6uNRic /IYodjuOkXzCL3KlCCgqOpyK9uCUpNFIPTqy0aaigp4hpWUt/UIKPipnuYHx5UIEq0th9hIAhsGk LnxpjOf+ghiHfelLP0SbbTz2kYppBGR0aiJoOganNqXsAZqxIrBc4zos2ul4ZHNUFGWnrIxNDIpa BOBMqkdBE11lZ0WZHk8sgxXpeMo6TWPc+aLjnfzIxz3yERV+uIce7s1vR927T6z/tBKr+1CHjtMx gLxS5SmZAKh0CyoQREKiJq8VKJNkQ8lt/OO/tkVIJI2pSIXktqFqQYtDeDsI3jISlKAQRFzWI5EB UBQ469kKK4lrV6qyEslINRItaKFPitxyucvVjEiY04teeLiQIVpJh1miEl8Ag5HQIXE2qZvMES02 vJC5jEu24Vic7oQgLLEuTB6pGMuw5JkHiCw5LKuTZPYkPJYdcXUZw2GQ/nYo4BQnLwUSIVgkBZX1 LYePRovf+BrnHfSZEKEjDBpzEkoWSQFzRuwBCwrrwxz5dCtjB7zkRmpjICVaJiVv41+yhGXSAi3x Px2JyWIGlBMO1UVvOvmLQUjk/5PNDUegiLJeCJ3DIqrIaF0j7KUdnVY/FqrFLHBpC1zwgbl/HemZ eSnMwYjClxxWiVeKqUjqKmKYxpj1SoiRRzxb07HMwAwiy4PYyGq3u9dx8YpWlNMDFoCZMclGIvaE Ypk8MsWyRaSMxONN/ubimzRuUCk4M5HnSPKz+z0SRw+dX1r4KNKQlso838loWiS6tGBK9KHTEC14 PnUqph3IQLf5Yf8QFqCYMHZXCpLd2lL6vwdtsiNge0AndVuTubGSlQaQZokAAy5wDcQqOltUP6pH XXOxa0bNeZfUGkeWHkRlvJEzh+GussxmQhMv/VGSkgZGJYP5xQmAEV2WygoZXv+QbmETCUlJjjhO 3CARsZWpHcwGnKfdEPaes2PHAsR2T9msJp1uKpk+4aQyNAGKil6CiBvdCJzpDVRR2bqNUxj5Pe2A L4WqdRXQUHsfRz5SaFMZZAnd5x7vgQ9SO2pkix1HrJNBiCXR0q9wcUpkjmwzIvtFibE6UqwHydSg EJJQkQXEw4Npi4cKqeBwhMKLrPYtg9Jj476QargUzeepPX7O9xyKqeXwSF9XtXNc9oPnonTVhgAb TJWiBCUrZaQxas3tYR4mmdW0rneLRtbszHkn3Jnz0b17E4TzJJvOcFjBfuJYYutJNj3xrnnlrM1K 4WmgyQH0OJVF1FzaOkJGRgr/UzeuKNOiA7TvncepUQsvaE+VNfDWKhzjASbV8Pi9TZnVuAJiTNdO ueQFxuaUEKottVZC3CW3zVcMavaVvQa2Il8Lbxa04HNBjCu9HIeyxVHRfgbSou2qaHG91JGldkQd HtWrLOnlFxOuwt7LSTOHYo0mD4FoF4wgBHSbgcxhIP4/Il6Mm/OsZ8mKd6Y+cawzULyiawZLT9bI huS5wbRmhqeZOkWmTENezKlVbs/YAQ9Lc/JXiCk4OTPzS4CIqVV9uKI+G2PNOkpjTkVpjXT3TBS8 djRHjsiHNFPVCpjnm0qBKuKgZe3Kpc0i0K4KuNuVgOlXn5xySAQ4LCd/EsvW/6ImQhq1pDAXRVs9 qSBQ9HbmRRXFKmThO3fr/R70lI8s7IHzi4B0dH3J5SyUSy97oQl5Jg3sYAWDb8J6aJiAMfsxbU0Y lIx4sibOBiN4RRlqLP4yYOVGwlz0+JtugNhG807C9kyZzI/F4Cyi3tK3SVPzbg7QnUePoPhYq1C+ g1B88/qzUDWt82s1Kahzx9YnNOFU5DNISqXn2GQ55ZBpy88FMWSt5Kfmk8mW25mo8tocEomjHnTl KNvUptC120GIyiS/4e0qXHbK3yqrslhEhE6ku75rRq6vj6QimZJpIM4CoIxEvdprAh+oPzrnYBgO dZwMJhxuS5xsmzwG4qIIrv9AZq4UDbEWw3cszK9YhgVZQ+RAjncCazQUi5726h9msE3oiTF2b5/s 5OXuhB1YQ1nC7ub2LpcoaO96yOEIacVU5TuCaemuz6NKyI7mKM7sgz2E7juKxitGylJSZei8YihK qq0cLqa05MNqSyUQQ8qeDEygLLmYJco2w0IEpA7r0FniBlo4ByFciSfIkGuoR2fYbe+Coz6cgrsA D9d8jJDKo6HmTD3aoh/wTCDcohKNgwn2TGDoAjAIZr/uojACDb4ygjA0TzAmjojCra36qYgEjKZM 40sI7J4yjGVuYOR2UAg7g+TK5IoAC7C0qE5oEcJSzmR6D0+W6Fje6a8arUD/nKRccAbEJOvMBoIw OKJdtsO1FBDGVms9eA3YwONpTMVpxAPfGskL8+2Q0Ce0mEIj1CpueosIiaW2ym/sOG+3GChiOMJg Bm1Ams0eOYK4nO3tnOsggGLuyEz/ugVXIsuokgK9EjFG6q2p2KXwEBD7qmNTHmdSqqoBh6IHsqqZ MMfgwmpgNo+aLlB0LEJLnGTh+MvD2ooldsNRKGzSdqMWEWzllKeLfHF4XGM06mSw1skG2WF4LG2v mGevWu5NjLJkfnJXivL2VGe6CJF6AGoQjQJZiuLGeuz5KqUrgUk9fI1pvKNTRgU7rjAcg+1GyEMq 9O3FnIsNeQOf3DFYfEWA/w7kpj5pgH5FIvzjQQ5E2lRpt9LqgMKmgcatWjykJ6qFW5oJH5iEjRBl Z25GcAhnXf4vvRTxIouu6ZzqvCJHLfzFEnlOcuziX56p8u6Oc+CrNRWDrHTCGlNRJd4qJo9rnSpj dkqweDwM5DSpBNvkB3UQKH3x5DLtitZpJ2OQeGIP0xDrI04tsW6SKY1HZkzmw1rtUIpqg7RTTYTC foLOGyGlVOiD+fDtaLSvHyxKPBTJU74yPF9FIHytfsgw9Njw2RCsQSTDHR8iL5ulkkIpra7MJfyD gQh07AKUrQq0/gwC/4DKbphEb4AKqKCRl6orcSQSayDl53SEj0CKR9LCLf8o0RL9jShAMkmcCUXt or5C8WCcRCVBh+EW7jA0kJ3OBHX2U2Jo0p3+hxa3xGKiSNNUJtN+UDV2stFQrq+GUGUWwBeNVEj3 icN240jNSFCC0OZEzHo2KI1YrYccIws7a6E+SgG7Z5AesQnLszzvqDqqbsU4qjMxpXv8jjc+gvzg EOtSw+zg0SXqsO1QwknGLu22qUBzak+xrbYK9AJ7IswYVUOIilEDUBoDBzOporpiBL186buADE7L MQyT6V54pGYazxxOkyga719QE0V3CjAyhFUPrXM4LxUnjmIQY9HqKq5uA9IaImX+4U5+zxYfIPYm TLH8ytJ+EgdRsK/E6Xj/jHIB3qTBqnNmtohHmZIz6DIymQkaC1Ey5aJrzOJSQEvpxjNTfsmEriYJ SiXXuIJUmC68TIX6hkkgrmZ/hAyA1qpWlWW3rBFC/DPrDmQVmYVaBpT+FpRAWeJrnK1g3Q5CGxS6 pNFvlBAJV+Rw1qxGsqcrmcaP7E065BRESVQ082xyMEhgBk5Fc+hzBuOtOKS+tsxz+vIDUarsaApQ j2g1dlME42lLjpKwIMzSijFJi3L2lBR47OoXIaxYV25ng/UhkpawpBWegseTMgxOVo04uDQa9c5Y 3JFNeyw8uSI8wLNp4LM92nU83xRs1eNMNWuhXmQenQdjcGql5LGlVIoN//Px/FJJUQsWywp065jF yQz2Q7olW4YiISL0Qn4CIX8DXXLmRQwAqdAFKhIRcdiM6H6OOVAoLTATSPLFqpKJLi5n3QbGz94r I3BoIXaI2VLH0BzjemBSFdMwGWUHam8wsVRvJ3Fz9WiQwVzHCTLjFxvM435WCCWN9ZSU9XqQdxQE 5qAzSoNwB/2yqAKqstKImcrJKbzWChUqI8mTCmXMtGxEmLI3+dgWCzNlO+qHtpZo28COseIEYR2k YvIRIQB2Dakllf4SMS2kyLzGQGmDfr9vQCmiIM3tNwYY3chsz0jMEJ/iRXgJcdyFbJ0QVjgrK3SM hR6nmNIlL87imSTwSP+WpJpcszW1KXT6cVb7khVf8n8+owdrg65UsHevlK8crBf5illZpklpL0kX IwdLLip913iJlzo7jZ2MEvVKT2WqFFunsaiyc1towmW/0yIr+OiiYiyPRl6Yj3zJ9XsRysbSkj4g yQmjwh2bJzVS47+8LYyEaw398o0FBKdYooHUsFCnZSANpFCLq1Bpwu1ABHEbFCi47LkMlyck9BCX SjOHQs4eWFOjjs06M9g02EeWwynioi2yCjjYi3RV0yRBccvg6z+xidkKc1b38awA6Iw9puIII50C JTScdbBckDhfDhhL7uVosFm1yIVzWItu8IbNSHlDrcIECzpPbKAAqjL/BWp6TsZr5PNd6wORhi6R 5CeY0EOawdVd8e0+vlgrRIo58nFBMI5tavOFEfR/BQSAZbIwC+0xTtlPb8JPxa7aNolQ+9Ag7EJC /5CCGDJnqDEpAiBGhkKgKRZrrPh7nWPWtCJq5qzOHrABS7Nm+Ix0DaLQQEeHWnObYEKO8RVLPhBm lygkXjfUSqM06BQ4a6/TglgXV2940yRNjtZ3LUNY5wTCZrCKpnRKMYIYw6RYdVZM3GmHyWZMZmZD rhIad64h64KILlYLqxhVPgvO1Id8FopTonDYLopxhq59bOXhioXsZlaUmKwytg2nOFpXpM0vCSR/ mSVaWkLKDnaP8Wun/zgn72RiOI6Dy+COYQPZ37ZrkccV8CryXb9n18QrhajqKuLiATURL5bJLzjR c/BCrNLqHzAPMzJPNkU5nmhq4mxzWYvneCQCOGFDSJn2ITBtF3dS5Tbmh4UYKXX6SnsYeIm1SG8x WIWTeNaklXXaNrAzW6e3jf4v7xpFZRo61zSrTMf1x8CLVLSj6c4TR8I1Cp8OEdfQXoeMgBzubBoi k6glnPkWf1Ui3Ap2vviYhsS5MeqZYB/ornXCJ9yrIA24IMZMMitLoNXFXCY3gs031+S0fjBlqrbS qv6PmQBGvQLm4PQCdRVVA/ELBPdEDykj0eJJgAQFbj1NZs6JB5+1TP9EJhgH67ACazh7b3i4KAZ9 8U1kmIjNCDlJjp4K6Ih11GnfO5lXDeckp2ac5wG0evvuyD3C5xvdVWwppU2re4TEw1TguANPylEK aIC8CWP4Ni/VMIXxMsrCe2AthLzHbo4D1UMgSG4oSK+L43C/LJChh18Euu8EIkPr7V3StisfCoXG i0eGxAGt6jShqUj6zGQVDr5clBQz8DWFqKy85KyG0Mtz1kvmxGV4k+K8KLdtGZZ3+eSalbaBsKV7 WggxIyhzWxiB1q+GOSqFmkcPq9L6N0tzPEisNjuPgrO1xdi0uny894p3DBu7mKETyX4UOjw0i3Vt CxZlhoXJjtqMa47/AXZf9VWuUekl+ldh/hLLmeXZc4KAAzlCMWQh6W7bFxfEhm/NMjNxAq9Dx0P5 7GOheSRfquoBg8/xUJQuVFOCbMgv5IZlNVrCT0elIqN1LKakW5FMHh2oi7EYbTC2ZRrUmXXShZQo xwRpiZOlbbhOhrdKyaSAntWXlVGa1ijE+uaJpZcMMe40dUSLGSejTIUrqOO1FEfI8QjAD6983jBj hgUqnVGUcLTnJnzh2lCtdcUmWmLhzq8f+7Au53pGCdWnrAXLGkVCi4NvcAaDqvev5dxdrK6h3LVx OnZeFvApLlnPAs5fTPLdP2dlOxlhhghKSkezv4R+tQSzJSPRh9h2/5q331X8B0nNMnh6dxULGI9y pV+ceH234H/xr1yP8HGP4F2vGYHHxbfEWWcix1e9jaYxMi+EZsq96fKDjrKRQxtxLJD7LOtoPcex 7XkrlQHoyfcTjRnLP9642fHLiDhEzJuFgQQS28gvgD2kWsR8lvbmIISiMdWNIduIMrWU75rigdmF o8Dy5xyJPYzJLfjtLZAC4EZ2ZFFUrCzQz+69dDJPwmH20GvZO982V98hMu5p3x1rTYKTWDmtw1x8 TGZQi4q5VyGCplk6xVeOSJdHd3Wa0+D/FwGiHbt/D5w8OOjkHbuD/wYGMPAwQESIFCdKrGhR4oMA Axc+MGCg37R+If/NkSRpAEnKkSFb2iiZxGVLkylLouxHUqXKlzJJBjjIi+BAXgWLPvB4kJ3Cg0eZ bvRIMOoDXgYPBgg61SDHf0S7Epz682fQsVXDTuUKdSrTn2fBnuXFK+xVrlcNbIRLd25QdHH3Br36 MG5EXhUh+vQJMnHLky0Xg1QZjvFJczFfvpxsbibIiAHMPexh4B9GiQ//STT9N4DpsKY3cn3N2gnW n7L/vX7QMOpYglVvN2Qr1WDChk1zIyx+9J/CdrgXHH3nRKnShNIFKlTYcLn0gtfZLZT+rqhz6ewE HnROvejABcq9L11446j16dC7Z/cusPrAph7Lf4f+3EIXEZaRAQT/GgiRRQZOZBtTWtnEUk4GxLSY STRJFk5LKvVDk0oaGkBTTIxtCJJQqi3Em1MMSSdUe1F1xNBRRLWFGztstYUVVrXtxg5RNgLF1UYy ChVjUEMFGdZucQmpl11JhmXga33NBVhgD22EDl0JohMYRRT1wwtjipFEU2MnnRRZZiI6RhKFoGXW 2WeFcRYAE6EleFqeqlG5mhOs/ekaVa9x5YSUBG21H241GpdioknJtx+LDAHoX43Jgeffd/kdld54 1xk0nnUJRZefdvW5N+oDntKn36nzTffdc9RhB55BCznHXo1LHQepohdxBhGXwSoI7IBRflXUQyUZ wJOEkKEUE2Ug/+FkZmQtxaTSmh4+25iiX0m14qOKOoWUU98qaiuyG8mD5FtCTiWgr1YlytG4s2Xl rmp47ZuklE8KaeBd/3DJJF+i/SUYglYOW1g/yiYWgJg3PWYAS2y2ZG0/aa6ZGGgG9KDsZyLfSZpp q622Z56GahSAn0zK69uPxqFbI3DjglvofuAqWmlvx/mnHXFKxdcqftMVVKuq0XUH6VILoKrQdv6Z Byt/6R1dHXvkZYeefrpuJ1xSSwlNYF1xYZTgnApzSdpcRm2U2EnTbBihhJNxWFMSFzJLMYQh1b0Z Qz99BdxC5qm7HbIw/qbit39Z5euhkN/WlbdAAjWkWjnSxRVRYv9JKeSUd4V29kZJjgUY3FNmKdiU ECUcsbANjzktSBajpNLcIOmNE4f9qBMhRJl56DFoHrdN568lI9yayntqZVqhVA2+1W7JPhXkt/tt VRRVTBG5UNgtIkTrO0KXymqv6QON9XWcmmp0d6HCp+pRUms33z/owS+rfUmzSp35YMcoR9OS8igS F2Ed0ErFahB3HGKTaWUGbxOCybXYVCYOYetDePNQaHBjpHkRhyn9WYrPjva973kve94DoVbmFbqq 8MJRLSSS5NDSPCUFKkluWVLo+tUXuphOSVTaS10+chouEWZBXjJMY56IN4nRJHgeiknwNEYmZfUA MQ8DWdpAYzL/5KEsZaqRjb5Yo6QGuYw2BbFecGpGM8YRxzip+kp6slOV3ihFfwG6mnnYo7WmsaNT DRFIQrTGIlzFjzp85A4j94ep8kmtkN9hH6VO1T/3wChx/THggX41p4xwiXWkydL4DqIYEokECRJq ie6WxZMNYiiCKFHNWVC0qBjlMTyOaooviSMPninuRiAMDlayp5av9Eh7x3xXGlFnOrV87plmmeZY WGcXJwWRMARqHWm4iScvEUYdm4GimeKWwWW1qUIkuQxiMgMiOV0EJD3Ah0Tsiacw7ulkfyJUGE2W xo1ILyqHOpILeXUuna0IQL2ipK7y+DOB8NGSVdEPpiy5kPco/2RW7CNPdzSaSKSppzu2ehUmK8Wq lDryUwC6D5GU90m1FasumxmMbeyYnAuSaCV2C0nGHEMhJACugiBZi+MUN8JxKUVWMbJhcmJkOdgU 03OQ89m5RkiUIC2JZS8zyzNBN818dXWrS9JmDgemGr7QaZQBEJbDNoOOuNEughXE4t8Yc5ngvQQJ 8CxeOY03GuRdZDWmywtqACrE2DzuNrRpphx1qSPLhQunN0PhLrlTv6Jl6lMByk/+jGZJRToNVu94 mtK6sx6x/S+TRRNIqaizvvlc6j280hnsCgTKiZTNmwjM6rhQKdedkmi4Po3i3rZV02J+50W5HKAv e3mfm0EOIf8z8u2PBudbZDVkRrJhiA71tV3QjaWNr/nReKv5lvN6jqp6AYw2AaNEJt5FiQpqYsTQ SSaUnPNuxXVMtlryEHj21UuqSZBo9HTg00AkjK4B7/PC8sIXEspbwaxXiiacywcEsyN4fKp6zoVZ 6sBWtuF7jyE5q6n/eBRVkBQIez5qkPksgKMKuYF2nqYd/myqxJp8rYlrBeMHnIppKKoLAxm2QIko kG1inGGjcBPgCopoJBPMm38rWMWasEUrPrOwLw0yR8t1ZIAvevK5CiUk3Ux4RoMLF+SeqTmCzBB7 Wa3uu+pVPUOd9y2do0saDQYRgWkEbQsj0GHKqV9oWbAmN9n/214jFBmSbDFOIfsYKL1omtC0jZ+C Iaw8njeb5knVT5LbMsyKIpXHphqq9zFPuoySnvg0ZVQ/Ztqsbg0dVrUDxxd9z4xHy2vsPG2iUcvx 1FRsUluZjzyvotqoyKO05DhnhMiLaZcUxFssKW/V1AbJBEPUX5uYxGK8S0yMTtTUyfJsoctNoYPc LWcTTW68yALzd7AyVbC65kdp3hyf+Y3deEOTqgNHb1v93KQBsW1KRlabl/S7XzNNo78sucxiIg1x OHnGY/TUNJ42TcZ99nOrnFusP7OKKMZuT1ErXHdFiXM1cGkvPFV54ANsLDXZpmp+4wmQQlbVEK0B 8ubyq5+o/37+UXb8esVRw1V0UwUrSL4vxfZZgHmMPUBj4XZOZ2trRjqdIOyFS0APUyWjJ87fWlql NY7T49hpVhTmXKooesSwUQgXLwyrSypoxKGT4cVyOV/u7zgySJ2n+cKrhE7PP1kQEYNosCqdI2QL a6sByGnORnv7ypKRiYhIkiYQdbyLpKEIPzW96dSkjHPgdZnL/vFpb73+mDLL5X66izPpojopMB/g I9W3UunA1oTEP6SItRPJ+/HYpJpMT6fK45wbJD/XGsU11VlFfGT3GJcCwsgni0URuLk3APjcrZrF bJWHwVOWNVFMwGtTnESdUMwDjBVBzPc9XJrLKW2+IXWhSv9wWpVqzWQkRAF/yzR4AieAe/YT1zUW 47VNCPcRByMRCZQX8BUR6EBOD/MQmOdtioYTE9csjJYhIoEhvUMRHAcauSUaK1gyC7Z6p0FyLfMX sNE8K/c5dAZmT3FQ3jIUOzh3ibJ8PCYU5lE/N5dZG9UdJxZSsbIquAId40E0UdhR84NROMc/wkd9 zUdkVCNAyjZIp9IzTMUiuNQ2CkRor1MR31cl2/ZUE5YivrJEigFPgUM4ynRqwTR34LMzUhE+5LNu uoEi+GYWIDQuZTFQ3qOIQbIWrNaIAicg8cKD1dNVi0dETOIX/iIYSJRA17YlGWgYD+MYoyhxctM7 NGEZIYH/RdGyLB3nRStoespDGnCDMgy2Jw3GJK2xRrzRf8olXd0Fd7lEEFSTUAllhFpjhP5BbGCo hK1ifX90HgchfUyzdPqjFIrkYgGiKrcyK9v4c0HHVFMINlt4H9pHjQ9kQmCRIF1HLK9jZBUIfqYT drYSOcK0KMwTQmv3hrc3a3f3VFdDd8ixK+OjTH6IXkRSc9MVbzRiR1hhXprTgLfkW4bIQqWGie2i eBkpMPxCGEOkhlzhJIOBQE4kV2RSOxTjOxdSZRc0Iqq4GZ4BERyXNgeWYDSJYHHRPGhEgzboPdRj UNWzg6aRKFFhVUJIKzxzOD9jQ5F0NUcJK9CoYlJ4FJ5C/x3xgSuQsgBJFzVU4xyqEnRHB1rws2xO M5UlhSn5k5VNKRxDFobggRoh80lskzYiORhp9StM1os4WFAEWUwakRaDKFnvth30h0thFmZihyz9 93f41mCwcS+QuGq7VxbvYohsIRaGBzl4VolAlFg4STDwiEScOCBep4YKgnnKghIXwhIW81874XlS ZgDWMmApODIX4UWlV4s3qU//tJOu0W8v0mbk1UbC+SL4toM1FykPdRDm8Ucw1xSAdB8AQpWQ4mJ8 dJXeuH2oRSk+Fj+VsiqYEn3MpkkuFSBb8x2MlGLo8x7E1hFkt0BzmTaCYU8HgieCAY/zSEJH0Wa3 uCdBQf+Q39Fm9MhhafFkCvUcllJZZ4ZvvvFlhEiRWYWAktUjh1hnJERvP4KA92KZlvhdbsEy1+SY VaI6v/J9TXSSE8NoElRXd9VfOeGiiKGC7rdgCWJPeoJgfHJGR2I9+sJlgRKULVd3T8U98sdUdtRS KIKkggSW0chRVFN0TFljmSQrUKh0xeYEnnKVVco+3Jl005GlP/dATQql3uGVRyNr/jEruVE2jmcR a9pW7NgXJMMLNfo6rYFqMIKgQpNUBJqnv2UpsYJ+HIYcYXNMc6ZmhCdzf2FQ/siDbaEbN+NkhTqU gSdWBneRl7hNFYggaNV1QcFEStYl6sAlb1VO5wQiE9P/TmyyTjHBqsxCQfFET7VpAExQMrgpg5qW WKS2T9PjGwFaqIxyTNzGqFaVFElZrEiKScOXnlqobNJ3c0UzfF5pWtOoSUhDfcFGdaASddBXrdKH UadinZrUlpRSjvinNUuofVAxfmu4VlXijqiHl1cCSnHoZvSIOMCJG8HkhwGpUAW6M/a4IgRpgLRn JKWGTMSpkHD0LguJLpVjkQMrJNdliYzDQx+qiXLhOnfBQEaGhhNRO8hlV3ZTghNiIXZVbqzEEvLU RMcjGiloYAoWciejJLUBYSuDG1ICZi2HZz/oLU6GrK8WKQ4lFJekH7T2H8r6R/KTUluYdPHBlpxV Y+yz/ypa6aX1A6aZMh5ZOWZLA1v1QzQPNEna95z5803gB35d17Lf5I66VTI/81vJCYTH+Sg+k0LL hRTMVWIJCYR8F5iWYii/WSQ8yLDCRHj1shYeARz0tpgY+VWNCxgU2HgfMaKfKJeeqCweeJLm9HkR ckUTYldIQCEC9jGW5rJ5gnqoV1iAsqu8KSSuB01qKi/2pl0xojNJ+nLOZW9fUx/R4XOoYj/IR1Je uY3Jl0jbMa1eKh3OKlr0M2PbyHzmMY3Dd0jReTRPo4yt1RHWAZ23oj8IeW6lmTyT16kg0Toed2D2 CapR1Y+9ghwMmlBzB4QPIFGJI7/xJxXs8n+TOTgEyv8jN4JMe5t3Ecqw/mdLEVtnCvgjO4Ik0NRe E8gLwqJtbUMYXEFKpNl1TvQQh3aiJLvBJHIZe6WKq1S6pVpgMwqzL3ijqYGL1cR2vtkyxbR7k4o9 QyGE67Yih4NCKCU0qnIqBiGO84srNHaWShdASmd005dRmoSuVtm7UeO0SiwdVNq7nQK2VytJINVZ Q7yeo1Gac8mOdPKp5HdPVYIWs8Y0ReqDONRJvzW09HgcOzy7jhKUrfuGLyNzgqsWICTDC/p3+3Ev B8W3VGWJ+cbAhQyPZgMYZdVwXkeaF4GGX6KiUdQTJmEtFjdlIdsPNlBlmQEyngEnuPlxMSgXt+gn EFb/gzTrwofyWLWxTK38RgRFZnmapMw1H6IyW//jPl35NI80rlHsNdZLfUvTlrVsjm3JUdGrhZDC regzv1ZKPxwFNGuJUkHoXBdYuSQqp5JHooc8wQYGLpEyv29cezjFh5Jyp0RCu7mBpPu5eCkkRx0K mLwxke0ib7rXZUUigACHI/6ymZsJkheBJWjVhqtzlxETMhC3wZK8TpKhO/2wIf1QGX9FYJvmGbWI emREWPy0wn/7wtzjZe7rgyyXu3/IH3CXHUkFhtXLWWLaYlFstVCztKzCa+ihtd4hdDysSU+stVQL W084lfILxS+GKfYTH8qafa5VtLTVGmEXLBd8IAl2/8JzOZppxn0I6reEqH9vPHceRqCVMrs49Xfc YxDB9Jh/R7eGt4NjsTisxl7e5Xfjwj0WaakGh7FvKdCuIzp1uoZIFlf35UQUhFw9YUGM0aqXkS0U pHFmG8p6skOIhZMcsU+1AX+D4xu3kcBG0n8GKhUShZQoNEJgSEm7AobShiK8NsSn9R3KW73cO2ym /a1LY40/x2O8DGOlVcSyjdvbiJ7uA2SksmLa2Nvpt9fnW3plgw9nM8HJfcgw+KdD69UrwkZ86WEz E8NJRc7QfbN3ml3lZTNuzW9IpX/hpZ9uJs+W01gKSF57htmX6pgIF1eZBjeiSb7vKCz0aV+jiBIj OP9u6/QSSaATF+TfUh0RKwjVKGyjKdOYqhsotvE4bPQT8tCvvDKZ+cqvx+q3kMIbLDWOW4pRXXl8 Riy1ta10/uHTRoxzI07iv9udpv0p80OWIYXU6jmO0dG83uFRPgwpRhtdtvVxCqMwhwzGucUZS/It 6wmo9wx79uhUW91QH0a4tnUb95hmNBMWdytCDrqI03XP3mV454dddxYveuFn/NxexM1N3JxW9gm+ FLGBIZHBiqFOi0FFbDISI7FXJkgRnjy6CeIZ5AdGnJGbhyVyNiJqfSczrJzZ5/2LF55/LcJ9cejh Ks6em8WF3mjasvU0TLiN5Yl8tgzM3KqEu+w0VTH/jcpbP9YLvdg5lbdSvB3VatGcWQJUvVLK4IFV lx3rTe5Fi2XTKCV2rA3JOH7bH8T463UsWfAXFcFpVQFHValmXtqFgHq0oG4tpJaDexoqLwIjsdjF wjjZkdvsJCHJZOKrdQTyyG8uyTPRaBIS0RuSVzgRGXFCYC5YegZu13mCOjk0UFvRd45lPYT7cm3B j++2UNlhe0GT1NxLWkrXYdGH21eIlSJm2sEGW9+hSPrTdKeuWq7i0i6OUS6GfFMM4m0JtuV6bA01 i4XRqXZZYLJIl1ylKOTKSasW1+n2QMxFQDmvPVKy1npWc3REkUI6FAhqM36sLjcy9Dbz0f1scN4u /4FUwsjynUAaq6ntiJokKVc1USbvvqIheBK8YxLUMhFehCf4NEYxSFjOY4MCxRqEXhDUQ8e310xu r85iNjPK+I8k9LT0CElUe+odFR6qPeJ/Hx44dh4JgdqZnpamIoWsEttXiuJaXLzO67un3Y3sw8RD LDTp40tD7nG5hdykcyfoC+iOro1WPd5zzI+TmhbqK8872IsUusqFyujo3FTGeS951Eyxj0zopcCX WE1phLGdWKdQn4EBMHmjuTZvxYFlInGj6MEk69C6kwQQzTfyrkU12uefUaMHLrP90tEOBrgTFtc8 Inb+eEp4iM6MdMu3LJYdsXRWyZYxzfHNeMxRLP8UXbliPXdRT2OF8AMQTt6xYzdQILsFDxa8O5jQ ocKGBSW2Y3eQ4MAHAg86eSCR4UCJ/9hR/PePV4AABlCqTInyZEuUMNGt/DfzpMmO/x50bJfxgcid IoHqDPAgADujO5Hq9PnzJzuhHZ1yZGqSKi+OUHMWJfqTl06wTcFiDer0KFMnX5+GLfr0AdmkX8ma JKp1LN2ied/SlcsXZVKVBk4+EBx4sOB/KnkFbsnYwON+KiNHNtDPXGXMljUbSGIAybTJnCv3CxfZ RuVpjwOYW934H02WNAN8DWCyNsrXTm4bfc37a++0aXvrFL7W+FS1S30ipZqToVOtDyiOnFiRJ/P/ gdklZgQ5HeOCgxQXIB1/UDtDj+k/gn8HMfvBGwQpPh8/XiHS+AMX/Bs/kH9HjKr76L53+KNOourM gyo9injibjvlAkDntZMEawmflF6bScKYXDLgNZZ0Yk4ppZ5DqqwF6coorKoWdEoqsNhJjqupyjJL xRi/krEqtcKCDrq2dtSxraReZNEptXqUqy8m+bLNNqP0mk2xlTqkjUMOX5qpMJT2aCylx8KE7DEk DLiMsiTMCU2zaZAgrZ9+yuzntH4C6CE2PG/DTaXX9OwTL9/ywguqo3j7CSx5kiKuSB6bi2qoF69r KroFA7wBQAQ/ku8iBRMqyImHEELoAU31+1TU//cQ3A9C9shTL9Pq5hv11YQeuJQ69EDqDilYb/WO ICc8CrYhAzui7p8AiVKtNpZeWswlZhcjbKXF0NrJP0mvg9SpqIxaKjojuU2Uqdq8UtGn3to6ay5u tcqKXKjYZXFRbgvFCSde4m3urCK5apJJ4QabzbaBq0THqK82tPCl2WqzqaUtU6JMnccopgyzzErD rLPPTIssCdM46we0y8RMqYcA8EE5tg77rO2m29L9RzerBOVNuKKKKy7np3QEcicjeUVXq+eQrXRB WSW9lUFR+1PwvfZWvc/AAvv7VNerJWpVu57AC8lpq8erSLv42Clb1nfss9q9iZyG+qKxJQpWO/8R 38boUh5TenZClvnG8suWga40K2xPFFGtgB99UWfEealRJK5cFFGv4qraadyO2sKJo3CdZIdG4exC 0UecaNQL8p8ElUvKpFin1kKWNqRtQgkT09uxLwPTnczKztR4ssvkNIDO3vvpbE7U6rTTgDsTC8x2 6EOMKbGbrgT05XR38ne4x7UX3UeOCuWcKQB94vzE6wKkqMFaqVvV0wI78jQ+8OQ/+ry5s0ZIPJH0 e1DXYFmNIQthWnY8BSpSpQchwcIVfLQzK1vJD1MkqY7c1GY+jOQPU0RxGbX0VqWYMKxCchkciSZl IvOVpSsm0Rd0rLWo00UKXWAJC0fIwi64CMX/Lomy4ZHqMpag3PAuffGKooyoOiflhTZ40YuFWrK6 mkjoJM9amIem9KyJjelimYGMmkAjmtCcxgYjixNo4mSZkoFpWTDp0Icy5KeYXYk3MftcRrjCONTR JTqTy5wLUcQdjnAOW0LxlKR49ZGnFUQhBHoagQriEI7kB1bp2YlDcOUqtFFnkXL7DnYUWL+tbeeC CFqfeg7iSJCcaiAU5NrX/pOVQDkxQ80KwDlQgqE38mknhPOkf5RDvjqGzjh3ecr21FKutKSwdUnR Wfcc1S7N7TIjOvLZCusItPBN0yyKquO/VCQlv/iGYFVy44ecWC1oxYQxudtdY8akJt51ETVl/yIe GeFJxtKs5E53CgATzNmD6OGmYYmh0JPO8hdBlYt13LNWW8LnLmlaSzmGU+Z2HjSf8BwSISJ5X/+0 9qCDePQ/nkoIfBTi0VtpKiGX2mRJ/Xcg/13Kf6Ay2yLht0D9jLR/CspU/nyFtEtmxSFA4RRG0ncV 293SWbMM4e0G9pTCNcgnAcrJg7hFxHVl84feIldTuGWoaKplcWVJVKFcyK6v8qU5VyVfo8zVo23K zJu0aV1enggthkVxirZDxxRVErEA9GMxlZGYFt8ZGuEJz2Og6Vhj4dSaMJGTjdOj7Ev+tMSvCCeZ OeNKHofETD+GKyjoG4omsenL/0hSf++x6f8iF5kfjtSHQKGEmgAfaZ5TirKBaVPkpcaDUe0kkrVe w9qnbOoq3r4jP6gkz3068rT8ldJYmiofoRDGMsVgt0MuYcqJ0He+6yStmNIMHY0gp6LK6UhEMIwc 6haUs2M+QB700s1oLRe59u5SLuh6K47gulBvKlGuL3vZll5iToQVDCblbFhhqAimlFDMTI85E2bu qTE5/c4zleFYyFKGkh5giE8j1pNA/4Q9Pc1RnDg6nbzswq5CZbWqhOMcR0iiFKNp50HbEaprM/od TA3QLaPKKIAQmFuSKgS4Hz1k/l4KkoTkVJVwG4hvETgrTVHEIlAW0X4IuEoEiYSXoroajdH/Y7Q5 TmlPLsHHTWYSxXLFiJXGFRGO6bXHtMJYdGchrfaMcpXuNQWW44vUWvmlVa1QToVzme8yW4cUfuXF utijK6UJpho+PcyyM9F0lR6cO3ca9mIdM2yHh3dqOpWGTp1ZDaZXxs/tEpS7cdQNbdKyG+xZ5Te/ SUodRaIkZ/7IRuPDzvmMe8qN2I2nuYqt2QiCykryymoKhNom73Og+XgZQl2jWmxj60grq+1rEHGk sMB87mfHx8jnGVtGqazRDL6Fdg1mmDpRErFemzAnGl2vVKrqk0bXEXPmBW2NPndebqLFcZYDn+N8 Pc2oPJyY3VqhuY4I8f/e6LMCLtiTKnRF/9oR9CQTQueHP37vL20pMoFVY5jKhLHTyMmLoQEZZ9z0 sTI15k6RxWVAOz5QhYavJGQ56MG9olVDoTeiNgJajLYVUn+H1NxZ2yAntTbT7IC5oyttj28H6D6O 7vaju3oPAbEs3EuyW1aeSlpNy4O1ly45V3GzyL41FSyMpi/RzNIdhP/aRp6JZDpSrTN3tCVNwTnd ez7BiuF4xZau7KtdVtmJvA7FeIYHMWDZVN1VPM9VXt9GYLdeMYoDxbA1hrCKU0S5FTn0sC1RjIqi HhMXO0O8xoIRNKXpTGeY9xgQddCNlG2ZguP4GuRjT5y8CSZoV/hZo7/rtFoxrUffZlxeaf85Vbuy qtVoyu4H+hL8itRa1sRzbaPCtpNz/xW2XYWf8tOWkftuEI/Dn7+Vll9BTh5RV1jW1IZpGLqqG7ix qm6JjuewL8TbtxZpl0XLHuKYkdGaCoXrmYqrMfViQMSBLw6yHjjaLhBsIzG5DDUJHjNBgiSwARtA ARVUwTlBAhuAwRacwRWswQpAART4BhSogAowgQrIhh40AROABBPIhmyABH2AhGzQASZkQh/QAR/A Bih8Qh+owi/Ahiv8Ai3cQi2Egi78AnLiJ9YoMTf6E1nrk2VCqDSkPIZKuLegihFZiz5zkak6H/bR IawJMoSAu6whqf/AFSMrKU/5w5f6qfH/+KniKhUEuil0k4iUcruPkqkrY0RgERsh+7JPuSnqQBs4 NIgHekS8U6CuKIrnKcUPUwyn06SQ4DG3qDGxiI61okOgqBEZ2xbqY5F8AaLmeCjKi7O+SKj6Sj6B GsYQ3C4xpDAz0YwycZMSREEZxEEcHIIxUsEUTEEbkEYUGAJo1MFv0EETQAEhDMIgLEJyJEIdMIFz 1AF9UEcduAco1IEugEd47AI28IEv6AIu/EIvhAJ+5EcxzKWkeiPiGygPPK+YqQ1f0yPKiS8+OhKD Y4obW4664aUE1IiYAhDYmrZMSq5NeZXskKRMAkSwsZX0UJAlE7eksa1ScZXXcp+5qRVJ//JE5CoI Saq68FsQVZw77LsvWcOSZ6k35IMQ6sgtnUjAfrMWHEs8oJmUWeQgi8ujdqkmbHIKzDEOfwlGrjid gjk4mCnI4tOnwECZOimZZdywMTKHFNTGHIRGG0hBJMBGFoTGbJRLHayAb+BBH/zBHqwAEDABENCH v/xLdmxHJ9QHNoDCe2CDePSBLqDHe1RML2SDL4CCLqBMLxwGKMA0EAoRzkTDg8Q1FQuAsrIutVK8 qHgmssAciorDi4IR8vAoCFk3CMEIrDnEKbu6jcrEILsy/7lJU6I2uPmt6oCfZFsQl8qaANHER8Sp jYoyJ7NIqHCpUKwg9uspg9imNQO8n/+UqPp7LtQ6PCNTwDhMkaYLCgpxAj3SiVz0CX65L9FBF3kh ukSbNJlBMWHsoOlhCdYIDNYomTMxh7JcxjeJy7WUxheswX5AgSTIxhXEQR3chxuEUB68y3D0SyHM hr5MR3REx3UkTB/QhyoMUXrsAsa0R3zER8pkAygYhsncx5MZPnNyGZcZvsvCi+QDq2+aGSWJQAvs o1fkL+UwDuorkf1DN/aJTk1St/joifFbHwexpJbUrQYpG0QCM0dipPxTn4s4Kdt6pGhrP1kxkHZw iLeDFZI0Uxcx0/yDv+KaTtd6L6/IC+AbPjVURb1TEAJclKxokBdKIB1iz9T5KqhoK6X/KIrm06bi gEW4AousFCdwOopZoyz8VKeVQQkkWA11MMESTJMx2ka5VMG37NQVTIJBaFC5xMEKsAG7xEtWtdC+ BExYXUdZbcInjEd5DNEoxEctrMx73MfJxEwo8DtzmFFmMTHa+EXQzIvNU5RdY8O48qO6eJEhPZru IolC4im7o5XWQpADeR/7ASB0sxummRW3qSmZMiXtICAF8a0IAk7fQs5n60NOsS2MYpp2nbMA0Qhq kzqMcEq7+jhpQUj6c5FBcwuhGBA/0iSg4JwHBD3Rkc8a6hz+6iqdKKtHG5Q+OTiUIBRhjJJihLXH 2LlWK0HNIFkVlEttTAIUbEskiMsF/73GFVTLtfTGGwTCvQxHDM0GvwRMdQQBwiRMd2TCeGSDe2DM xvwCxdxCeqRMfZxMlRhWwEmq4PtK5FuiAKivXCOO7Xmxgksm1CG0W+ycfvUu6oK6oerIJYug/rgP WZkPtoUVE/kV+JjJAbEPBRo8TOIU4OREthm/sDGQUdE2kkxX/OhbeAUJ/hAIAcK7qSE/hQMUWaPT sBAl3BK/5hiRPf0W6VAOhjiv3yA4RI1KyykvFFGvhwukHsEZRUFIP4EZgaIZgWIJ5gGTO8lUy0hG NVG1t9RBmXXBGGzLtixVFGhZU3XQtQRHG8hLH7TQnQ1MfeDQwXRCd/SBomVMeSRRx/9EWmXoVShQ 0X60N2aRWuk5yCRqkpdBT4GZWLIIpGEbHYP1txGRnBPhV7ilSCYz0ppKj/nBFOHEzY+yLZJqGoUI YJJ6sv3Rmp1KssBNoFtp4DJTO48MIKPRRI+yO46gqkCCm00xCARJylGEIrGCqPnFyQxiLYjcI+OS yLJ4mRRZT3oBUhZCSs65WhUCVEbtkYRKqD8rMd0oxuX54Z0jwQ1DApNNwVNNApVlQSNu2bRs2VPF QXe4wW/cy73MBkMQQgvV0Ohdx6KFQqLFhiqkR3tU2i3sXsrEzMrEzKkNWaaCI9qxrIGBXSdRyEPB ih1Fjl2sYbc4DsuhOmG5DlGamnL/FbepO9y4ATOYKrLvK9fh8i0x3eBlOy4Inrvx6yTjEpvywGS4 Rc5IOqlxe1dErr/mskgM9KySgLj/0ddWgjpq9S4+XUCc0VHw6VE7Ks+1OpLziZzGQa+bOLg6Ol/c gJk0+xOUWbAqudQANUsYPFVpVNm2RIE5mRO3ZEFpvEbjvcG6rMubBUIhPEfnTUcubsIpDNF6DGMf kEwtROftnUx29sKQJTEa5RMFOxQdlrTcWN2nFIv9cisWesOmm6jpKK3wilctzbJ9fZskuxVB/J/g lB9TAeCGsKSY1NamIQinITIw27JZ4R+rO86HyCRZoSma4qiMsCirgw4wbc4GoSlM/wkJs4iXGImo 7LOOJpPNFuHTx/OPIYpWGgk0Xjw6f7a8ocCR+eI1ukg+q0gXmqm3EqsSftqnfgji2yXiN3nmtXRL lv3dGhyEl3XiJ65LFMgGcFTeHuzLvtzQnt1i6nXCdwzjESVRLoxMy2zRYM0d4TuxYSxIq22dHP1l 0GLf4xhUiZyo9dIxq+otvXOutQklqjHk8/hb4eSth+gPyvbIAXaV+iAPlczsTIIkshsV92Bk/YG/ +0A7lzrOpFEQT35EqViudr0UwL7caKoz7NOWx4tDqJvYX8osxHFAqJQ4932mh7O405UL9E0ig4oS pEaJHs4le0PGMgmeNkFBlGXBlf9dWbdU2RRM0FE1VR1EVW1m1b4cR2/m2VntUMS83lvtAjDOR3pU Bi/8VX78sBBTp/tkiTmq2lgmutdItOBwvkR7aYpFPKQ8KZnW0ukgkcEJZVghTgTOTSErzgdqlVXx H+IEm1ER1xsgXPpRCCgzrnTFOkrqFf49P/3N35QaaWu7pAbClJKmroogzvL5N9AhkVREJAFJ4dhu D0exq4QjixfTCriwoYcKl0QZK/G5Kqroxf4+3z+ztQ5pbmIEYuaJastYDctwk2fURt/V7hgc3mk8 WTEfBJnFQQkNa3C8WR8kQhDQWXD22Vn92SfUgXoUY+zNRxXdXu9tZ3Ja4w7J74H/sVobPR0c+aqt NdgdAThgmkVYNCHolIrKfSTkWmzovMmoUWxHGo/GtvAFqGyO/PT6oOywcbsoTZv7yGzyO1L/cBou LUlHEg/+u5vmso9HV1yfeAiecja6ERW8ZUCJ66U03TfrCBbXKhxcBI7xspz3faYaGS/M+W224C8O VF3yvdpKM6hJld0gdjmzVEFsJNXt/l1pDvNoDt6XlctUvcFUnWIqxuIsRkcQcEd0/NkursLpZUx0 Pmel7d7JbMx9hIKAXLOejLUUQyLMSupKe7HmWNSJ+repwJaqEprC3XUps9JNViWTyt+2HTutCZt0 zfT6MBXC/XgL598NzhrehKn//606TJyOm6KpsPHkkAxTl0a2/dj1SzKWX1nKFhrdnSgluUtFQ48S zpPWrfoqAZcvPaaK0VTfALfnoeOgdRn0q23qryzmnVOHHrCMTPUMGExLJW7LOQlzGDzQZyReAj1V KW7VsjYBQ8jZDIVetRbaccbVexzje6xMFF1RFy2npGKZG7W02ojlXGvWQqc4ZUIdQSUqo5+6kJYK tvsa/alXA6LbV9HNUDePThf5yv4yAep0jwh1xdZs5szszI6axuZoRcyOxB6qxa2yBpdwjWotbOW/ uPGOUMTpIKIXHeKVgiX2+2Km+IJDGmn0Omq+4obK9/219TLdzhoS1LmNpYZd5f+u+qaeXf2csBIc owWNy3Ive98F/+u2RgVN+2veQXXnwSDE0HdPR8GMXg+dwjo/Z111b6b9d5RgDeipdqs9yNBsIYAI 4ORBAILs/vEaWNAgwoH/DD54OPDBxIcRH7DDaJEixncZP3p858RjO3bsQn5c0JGdypPsbnQcya6k SictF8hUqTPkApYuF6AEytLjgptFXb47mvQBT6ELSgYNKZPoT4w6H7T0aNPqVp9QnSA16dKlzJcY yx6ceXDBw7D/Tk4FO5Vd17EmRXqUGJHXw74R/QL+S/BfgIaEHwY4uHdixYx6FSu+GPltxIyJL1ps G7gg4oMFPx/my1cgwsIBTJ//Tq06gAEDPVwbCKDOXD9zNvrZsJHkdm4kvHEjSeJbuA3fvoujwI1i OfNvy02gqIDCRAUT1LMZymYdkgkd3fWB0Kdj/D3yPnSc76JDvQ8fXbD5+PKFjfz6ULpAgfIl/zAD hFmrFpt/qf1HEEGjGWjaYIUZiBhm7HB20V6YSWZRRjJJ5BFFKL2FV1oaZaTTXSc9gBWJMPVEUogf QYVUiie9+GJSMPo0o407haVUTya+SGNQPPrUUzs9qXSDWiJh9Y+MYXloIlUjGfmAkVSRJGKLKEm1 oUtYgRUWWO9gVNKRXzqWEUYYieYgQn6BhqATCH5GYUUlMnZmZRL69WZgb/XF/w5fED5YkDx9DWqg E4fpWZgTqP2zKGGLmgYpYeaw9po6sSFhgDlI4KabDSgMF5xvwPGGhHHF7Rbcp6ui8ClzrUJXgazV VWcdCNZ5lysIOpQnng6+oncPG+ut5wMbXciHTX3y3UffF8PoBwWA//0zYIEKmvbomoWJ5hAvBzV0 0WV6JaaZY99K6NBHGx2k4UBbgsSkTGKKxJKUIOXEpL1qxRhjUCIG9ZNHPzkV1VAEE8UjUR4mNfBV P8HbIkxwBdXhXACb9NVdAxmJU09bzaUVw2rRJRVSZNYbF5JvKVbuZ6Z5NthoiKn7ELp3NnbRu+Ra VuYDCf1cEdCaMSRuywqtOf+aQgQNehovqv2HWmoCvvbapp0Kh0ISuPVzaj/hjGrb110XV7ZvybXa 3HTRRUcdrdTdakLcuX6366/j+VBee3kT+4UP2LARn7L1sQGFMtHuB8V/Awp4GmEDEvg0YQtSlO3M fL0VoZoZ8SWnziWaaaGWWuZFMVxSOjniwCOjNJKJSk6lo4sEz06Ujj3BWJSTRNLoVFFUphh86hS9 qGSNG6dIZkkm6uvS8nBBnPySV340EpkgirwiWSN2mWW87dBZYp5wNsTtmhR1TlGfFYbfGNEOPehX ZZl9LlHnBS06mJ56LkitonxJajU9qFRrzGGATNnAHMLZDam+ximw4WZTxTH/FRIUaCrkHCdtr2KO dDr4NrmZgDvc6U547AYs8ZwHbzr4wnrg47dlyedw9ImWflhTLRs6LjaM2hYPEYQQxaipc0vzll4g Irr5nQl+HwEd9bDnvBHpK0zHy17rDKaUg83IXzmiksAOpruCdVGLXsQSS67iMau8RSUJq4lIalKk 1ZnlYPOKY0m60pO3tCgmWNljV0qCx4NdCSw0QR1lLhS+hJyPW4dKEBBBt5GcEQ1EJcKT+L7ll6Hx AolzalAj+QRAghxKkaAcDaNWszgA9aA2ZMPNAoNzwK6NqoIPrI3ZkBAOspVtCEjQ4HKkAx3quI06 I7RVd4o5nu/wajy8ag96/3QQOGO9Zz6D+wIQ7LMfaH1hcdp0XJtKaaiX9SUAQrwfEgvSyHfh73OT tJCGlNShJapljztSHYZwsruTGO9Fy4tR76xIpBvlzkdOsZcWuUike94odUVZwJRWJM+GtlGQ+kLJ SSB6E+ZpyEgUc4iIrFcvPzrBjwexyUBK2iiKHGokJ22URNqR0ogcqlFSG+BrXBMAmqqGCakZYLZ0 Shie3vQ0OOXpUIPag6EO0BxVg81RbzqbHiChB2LYlFQ3ZdWoynKqstwqBSs4CCQMYhA2EOsgZhXC 8OhAhCDADghvVR1DmAA7FWArCKqzVkiAABLZSCsk0qrM88AHG4Id7BewAf8FbFSTB/mh4WIbW4f8 FKIOdSgEZStbiHkUQhCZlYAgsmAGCUggC6IVrRWysAYcclNq1ZpcnLA1udKAq3NB/OEl50QZjbRP im3RUFo8dLp3wrEqKmpJ84RiuzUeF4tZOR7G/pk7hS7JuGMMknSr+xKdLFcry60Kv7Q0FjF9hY86 cWfGWMKnepmFIzKxnmBCmpaVjtSk6gPXP+q7SNI8SqhCtal+KWGaMJAGpwHQaQ/+0dQCI9WoR1Xq Tat24KO6Bqo9MIcYXKPUCj4VqxTesCyvClZzDALEYP1qWMWamxMbQlbZ2RVebwUCF5sgO3CVcTYq MOMKQALHMW6xd/CqzB//6wAb4xGyYHlATSPTcD+Ja2whoNDkJ0/WsoKog2YFodksWDm0nbVCaEdr 2ixsk3HbAk22BEI+RH6zcvWrTDrlJz+OrBN0dCKjnUhUpCeShYt9OUxhjjRF5o5lRrsLnoyuaDsX FXqhWAle73L0xYlm5Aa8kyfsRFaWFn1FQyISkr2iNMfedkljX3mLe0lNEXCpxb4wXXV9+RRT+9p3 UQA2cE5vepgBApjABt41TW3KBAsPkAk0PSpSlTrhYytVqVN18ISjmmyoWnWqWjUViKs9AxGDNYGD CIeJyVqBFcxqrXktJnfWmuIZY0euNk43XOsq7rPaLa9+DfKQg4wNI8un/5qH3feSl+xYJ09WspGN LGYFUfArFwLLWZAAl0kr2tPqELVRo9bTEiSzQwGNQZwZZ2fe/EOOrAsy79zQu0CuJZFuV0OBTBhB WtMPA7y8NQx6So3AOFAbeRErXEzuoQNmxarY/OdE6cpwSeYRFBXXKjFR0erickeW0OSPxDt1o1Jd slLzaaQcWWlMUwprr7O0vgL5Lzd/utPCEHXARl07gm9q02EzeKlDpdSxJVzBCUubqhe26rWvjdUZ fBgJgAf8WH0T1hPbQFYt3lVbY7xuEwRjVnC1cTDqSmNDLN7HebUbkHXAgyAbWQdAQGw1gWB6KAAB 9Y1dbJOdDHAnDzyzlP+t8jw6a2Xbj3YNEljDaA8j5hxei8+hGf7GM4c++/kFUJSBH4XsND8zISVJ KTcdmMayo3mWhDUub02mXp6pxATsiowG6FKI5DsaLVqewaMKwMafc95RySazg3+nQ+R06qOuR/V6 0hORFM8xlUR4sdehpEUAOsQBsprWrRSiKAp+LQqkAJiA/YNO6ZSttV2BsR1NGRixuR3cEZuxxR2E JdWxORsJWpU5zMC0VVuIsaBxcBtZlc0gnBtdZYOL1ZWNyYrjGYKMqZhczZjc2OCL3YoOxFtf1ZsP fB4L5Rs1lZ6+pZ6/tR4UPFaTRVkVRlaVJZzsYVmXfVYWlNbDrYZp8IX/AaQJt7QWYQCRD2mO56QP 8y3fmQDRljBFnYyIFO0RFIGMVJDRQcCcAWVKH8Ic95kTpmGRF+EO/TmMQa1R9FTXoQUdjCSXdZFR 8qjIWbTEIBFdd7kETOQLy0yMmEyMTfyRE3DiSXGiSJTUe81X2L1a1wlE17WatvjUUG2gBvZABQYV 2xkV3THVB1ZNB7qdGBwVVi0YVN0UhdndhKVgBYnB4HnVpsyAtgGeWGWbic3KugkhDmrjNkZeigWD IUQejomjjJWbj5kj5ykTkX2BkfEAGyAWE6pe6i1W4bCe67newEWZZs0DlWWWlWEZ7pHW7n3Zav2e aVhLmeWP+XAGoPDP/0KmydahD5xtBP2AmhPlxUrMEZbIk1vsSERs38slwfb9YW3sVr9EDyQ22s2Z n4+UEUFRF0Ep1En6k+50zFYgnUYZyZDkn4ukDsXYk064Dk7kxR2xhVBaz5iQnHpZT0spYEyBywFK RH39haM4QRjwGdvZVITlYrCpXYLhlLExVQCAoIRJVTEe4wAJIwmaoIb1AODxneD5xjRyW3HAYFml GOXJzVtdo4rJyjfioF/i4LmtW7ttnhASYeeNx+cJljsaFukx4X6knr6tXj1OlhReYcAZnOxVGWdp mZflnjjdkP9gy4E0JGIYBuYYjYOUVCXF4Z18yIe0xUq4C+j4X3DZhf+K8EvFAGLMjeT2BWJ9hZF1 8c753VyQtOSPNGKQLEwZ/UsXkZFBlYhvGV1FTgxFHZ13scVPvFNaZGcpmkVJIclqHmWjiERUEiCs OaADit2i9Jo5uGdtUIp7akqydeCwHeNZguCzGRsS4CeyqQPeFeN+4t2F+Z1bwmWIPeO2gRVYzaVY 7aUP7uW3zYoMRqiKRV6OsVuOrdiucGhaoSMPDNbo3VthNWFkMtZk2iOU4aNlUVnt1V7C+WNnjVZp 8d4NMQo6EMbMOI7YKVLx7cX59ImbNZL4EOmD8Jb/ARe83OHq3Itvgck8xVPLGUBIdh9tGIANwNwt acrLcQlA6YjOOWf/zaEkT4gp/PHOkNhEQy1a7fBTzzkJSeHOkJTXSFxfiRil6XDJHdaRFHnUW5zi AJIaSIXnH7HUS8HaSS0SLB4qpLgnp3jYVh3QAbmne05VozbbpkiqVl1qBSlVP0iVa0SVLwZAqN4d MS7btU2VW7olC4oYC46VNWrjXc4KuMlgWckKuMlKWYEbuN2lYKZYjhXmi2kekBGZ6IEeiT6m6UFm PDLZYj3WK9wjZk5WZlbZ7eGeIHwh751WYcQGQZQdaIrGGUZE8ZXLYvxMxwGNEYWPIYXO6SzpzlBf XOQI6tiLdVpGILZGSPrmy/Hr9lnFcuKc+fEcPx2Fcxks/Rksc/bO/6Ytp3EdlIwcpYfUhJ+ZUdOh xMTwSxqRGh2ZhJH80Z4uZaqtJp+EHSK1WigpBMoSBoE5aldtCrV1Vcy+7FZdVc3C7My6J4BumDAi I92VYKlSFYJW24exal0mnoQeba5WQFkxbQUkXtNKqKxS3tTmmIZmXoca4Y8JQZGxUDWRnpGZ3umZ qDxOJhUCXCFMQWVN67RmVu2FFmcpnJeV1uPQLSn1j8ax1raomZqwGSXdSREVEc7IGYlsyXKthEmk jpJ0xCfeBadVSx/GHJZGam3spgH5x5SYqXLlCEs2Rc8h4nGaKZCQKfnB36eJCacRJZ3m2f+NCU4g BURxzExkZx3hhf9JXd0qah1UAmehIuqiHurjcJXZCO+pHAfiGa9xEG8tfRVWLZsHFuOyaepUDUIP hJj0ikGCMigMjpXTNm2t2oAh5MYK5AbTgq+uLu357uqs+OUMEqYQciiLjYcQ0BsLga2xLqGyQkHh JI6JQhbrTSHsYebs1YGLVquVcdkWONy2iuZqKaS3nma49EW3FA2clev63IkjkQgTQQ/ItQhcZIVK TJ3hhtGZaF/3BWLM9auW9mtrEI/tgKlJqmSM/GuYKppQ/ARJ1a74KUwhFuzA3IBvDRJd5CZYvJG9 zAVJndqUjOdLqMVRilQdPTF4nqdJkaz6aAvvEkYEQlXZnNhu9Ib/8SLecrBK4uWG05oxGVfAcfjG CUpbMjobz8IxCu5dM0LjCrYqDC6tDYhv+D7tWOkxCsigH5/v0yqt5P3l5WEHXg0rYt6b5ymh6IUt ELCBsoot/6Jo6zXZKwictPZjP3YW3MroF5bWgIwGKeuta/0J3v7JnsiWRPrJg4SPhbDXEtnpHfqZ bIZMoEHRclYLChvQy9HGNPwyv4bDlsrc6pgR5yIMcy2a7WAXS66kw5ZRm7rfogmPUDpUlOSkiLDM yLQINpNRSWhUpkmUxwoSWBCqeLIXKy7qfBUG7y6KpLKSp6AKq2zQPfdSdFSorCStHy/ohSHbgA5o VKEqNMLlCpKY/x8bbV2S1UJzr42RbyDzaq365fpmqBAu8o8JGeitEIiygZEpy+hFstjmB9lO5mM9 FsDVwStcoWZq5u0p3JaZFrUYwN1azgMn0o/yhTwUDWWMiyV9iPhA3+j0X2NQ1MmkRExs0XR5ZKQG opX2K1SfsJX6B3OtkfgBLA8jZ8M2p8Eazw/jMBH/zlIXhTi/qcP8Ec11bEr8ERP7KfG4k+vKhXZV xp5yYgHOBFQmKkxFZdiFHWmgXQ+ATW7g8wZ9gy+9Ta0kNq3k4DV2mw343c2yJTMONPVe1TRWG4hF Y4i96mYf3kLrsR+vQEOH9vnaqq32qjgOZg0W5rwp09Z6npCtY//Xkig76sfpQSb/mjQUQGu0BpzA XaG1ZllML1xpldYY+g+c9I/eTg7GrRREtvKaCTVlPARM2KGSzhMc2au9mkhMUgVrEDNIOrUJt0Z5 G8A0eJ9/zAhNcO6jOfOabtrmmuQkqq5BRddxmld3o+7t9sTECOVZcxqHBLgUf1Sq2ZN3uhRKad17 eV3l+DUsuuIrqY0JfEM2HLaFT0cw7aWGA9Pb1FgOErItUaOBdpim8l2qSq8ds6BYIbRtzEBYzeWL fzZp12X55nGK8eohr684QoIhuO9hajSQgWhHF9k7inSJkvRus94USKHrBZwmaxY/FrA/IrAo/wcp EV/SDB9DkFP/uVawJV2wyREp9MXmxChuWEAPXRclR2RFTkSiUDzuCe+rb+pQbPRrzClJcjpXVksX T/CcwhZsD/uEpPkOfI8poOe58UgsvdZu9rhEGjGxTBAPE9OuKArxn5Jc1hkgRfgRyXrdU/5uTNFU Bu0DrdSYdSh2YqM6MF1HBcDYYvMzXZqK3yGoW+ad4HHYqlp2grpnWGn2WIHYC744ZI+VZ79qaIuv WBmCXZ721ILjs7MV5p0VJPjYa8dvIwMBkSPrbFNy2DKrPCp5/2ryirKttcIocXuhaR2kgziOjnKS +RhfBANGmSwEnxBpIfUJnUnR/qH5c5oO0ClziQQAMPPmeVNu/xL8csSdRnlbaUEcHcSUXxnxSPu1 pP65X8Rn0cmg7rx4TM2lzj4ZD3vtt+tyWsf4mR8JSf6Np1DCxF2LFKDmNTyrD1+zc6GOnQERdmNb x6lbRzBYR4ezeo41Xq2w1YSm8Vhxm+F5VYeloBynqrM1fa0f9FetKvZy9rAPu1gNe7IrdB6f9rnZ ZWBe9IsRITqm49mDKOCA6NpTE+mNtLdbsmMxuWQ1eQBTmZRbK9wiMGmlxgPoEPElSN6KC2akK0JM sL1XyLrQJrtaDG/dYXXCy0foMld70aP3Mvd9pJzL3NOUspyfRj8RlMH8C1PMH+Wb3w5L2ksS5+g/ czh7BRMzTP/Emk7He0geEvHLY8SfqgUUp4UU03yDK+qrRaAEocA3VPhc/bx2aEfPJ3/c/PwwlVuH x7rhTZDNghi0ISMxUtUz4nrRGvQMJH3RsmA0bnY0vioMLvv3fpse36qzfyO7sTaPxa+1J+Z4ZPu9 CRZt80DpOWZk+v+3A8QUKAOhFBpY51WdQggLClIoCKIgCRCzWBFUEeO/ABoDPND4YCOvf042BmC3 ESRIkf9EsvuX0smDmB5lPrA5c6bNl+zasZP5jh1QoA/YBTVK9B3Sok6A9nzHtChQdguMLnhAFShW qg8MdDXXz0C/rwa+mgs7NkAAkWrTegVr4F9UrEGpaqU7N6v/3Xdz+dK9WpWuUac3pi6AWjfw3sRO DFPlGfUxu5iEAxOmSrjp0r3/FnBm6sQl1Z494352KTluaieknYz8l/pla9ezXZP8agNFbhMVTPQO 1huSCRAmgmczJNxEtuHBkQ/fvbtCdBtIbAyajsQckkHmtm8XYw78oB7Ye2zv8X0Gkh7mymd3vz19 uPTf4XfnbuP+DOuDBoXbb8i6FSrgrwJDojMwGAMNSTBB40AAARIIJdQBBB0s1AEbCzPUgQcdgMAQ G2x4+IKHD0kEAogvUFxxRSiAcBFGgqAQqA4o6qjxRoVufEWQQnqMKKIsLrIiizW4WuujtDhK6bW1 XEpNJJpe/5qSJl5iotInj04jisu4uIzJKKmcKuovoaYiyqo06corqzbPtCqtt5LoCqy37DQgLSY7 6orOrl6qa4G6spqK0LzCLLSwBcxU9E03BWWMUEUPu+Gqngxz9ClGM30M0qfM7AkqT4MC7TGq4ups VFRBvewBSif7KabVXGrtMdVmu1K21gLQdTzqUPhmnwqy6c253pIz9lhijQVhWOeOk6666rDTjrvs 0nMvvRm+Y089btejbzxzxJih2uy8QyI9+9TlTj//BpmhOv6iHdAGAwcZ0F4EFzTEOEgijPBBCnUQ wkKCC7awwww7/PBDHtjABogRPYxYxRZXnOJFgQQiaAqDav9MaKEeF/IxokKEzEICIrPASEm4kFwL JI1Y+qjJlzqKq6OTUqrppZakzJKodmgSLMxYpTqa0p8gM3PRQ9Ucai6u+hwrCbP6CccAJPgMAK48 S+I6LD8TCzRRoQC9K0y8ChtbrjULtQuxQdNE7Gme+srsMnYoA8qyUg/zzFPCSDPsMadAI+20kWQa 6anS2mntSnley3XykdK6LbfoeuOtt2GJE065YYMr7nPkoJPOumnLDQ887NIbb73zvO32u/W0NYfc 78ZFr1py1x0E3dTf3c+GFaI1XsB7BdT3wAb5fRB6fysUGJILL9xQhy8uTDhEHrpHEeITWXQRCIxf zLiggWj/tHHHGyGq40cgrZhIZStwuB///PXfn//+/f8fgAEU4AAJWEADHhCBCVTgAhnYQAc+EIIR lOAEKVjB/fHiAVbihTw06AQryYQX7JDHSXxSFHmA6YREkQxRJFeUpbgQhi+EoWNiWEPH0PCGhNIh 3SLVQx6KMADqMIAQ30LEAPRDiOrghVo8GEInsgODHmTLRnboQyvyEItXrGJRfphFLxIqHTsIYw91 qEXEuJCG7NiBGtm4xhnWMIZphOMcXThCO4qQJAFAAhJyg4Jg8AYSgPzccEI3SM8FUjjRqQAKKrDH fohBHeqApBgCQElI9kAdmKSEJJ0ghk52Uh2b1CQkKSGG/0uKAZOmRKUqWdlKVyLBlHvcI/D4U8ta DmhAwbiXLoMRyGD8MpCQ6GUvswGJYvoLmUJwhhCEkKFmYoh73gtR96g5ohGxqEUYm5H6ZnQj9uUI nA4BkiC2kIVyEskKVpDZRl7DTpl55DXxjCc8pzTP1+jknlKa0jv+kRR+eqqfTLlB4N4x0IEKtFV7 MZynFjDQhmbFUpnaS6AmOlGhcc1qY+HTW8xiFq7JU57sTAvXUHKDQDU0UCZFqUlZutKUpjRT7Xgo Y2Rq0pouQKYz1WlLe8LSmOqtoX/RlEDtdlBP0bRUCnUb2eJ2qEVdJS6IW2it7hmb2igOcq5Jyx5x 8w1kff+1c2FNFrOMJSzUUWc72GEPe1DZA7f2IABwRWVc1WOAtmbSrf3I61vb2lb1qAd2f62WLNPF HVtGyzrRYSQjcanIfRknQQCDkHAkGyELVc96B9NsMwnGWWw0kwfeK9FoWZQH8g3EtNtcHzjhB79x BukiJ1PZzERSW9omKSW19QgGO9IRDFIpJy+hiU1O4xPQcAkySkGuco+CKLId7U1sU0yZivIasGjt LUgQS9bCBpaRskUlubUZSZGiF7UpBr3PZSpT19Y09L7NL2oKlFARVSYeDgpNkcrvoMpItKM2JlZ6 k8xTalWrrMpmVlfN6lUtl7WuMnY32eCNhJelnNIxBwT/vKmADRppA2m1LrCxyw7savfW85iYreyJ 3V/X0y3soMd16EIXu/RjA/1ox8bxKl68cGmgCiSoQIE0TgWCKRwJHbl6EBLC9FwAiSULoXrMPBjB FMYhaE5TtCcq0flelIcXccxG22QfyFrrIx/NI0jlXFlFYoakksyMSfD8YGy0dM8P0gRMNXEJcfnp X6gohWlkMopTp7IoTBX6TIhmFKM2Spa3hO0sb1GSR27GpDkv8Z5rW6+mIyWot6Up0M+tiqMgxRdD o42ihfpMpjjT6geMRm+tijWsZRoXwljmSlZZtWlAxamoJm5WjyON4ip31bhmBzcoGNY3PIcszw1L H8PR/weypDMg6qgVPKhc63jiqm0UV7IHBnDrtt8K2G2jqzw9mEG6ZdyddPmuWtWBF/HuVa8KLE+X CvqjgvpVARAYorIBexDAIOGCClXIstWLsoY6iyEOKcyaJILYlleUWhdtLMwF2ZGNfASy157MnOYk Um9va1uSUBoke4bzzX4rXC/pxCYxv5JPvFRCLlHKMX9J21G20hf6Asa8bLNJWLBWp7Fg19F4MgCm a8tyKsUFg+WVrnrTO5W+yY2pZrub3ph2awAXFKiM+cylGHO2uXCGiwN2LmgG9anQGA00hOE1p1rl OMg9RSa0qg1PDqyRHvQj2d8w63OSM/jmTBs5ivTwHv/FxR5xxw52cYV8XMUN7req2K+QR6V61l07 9/QO9PWxcS39c7zi3ftABSoQgwBOZCIfBxIAp+zAJwQCFwhMB7fPvYVuDwKDGczKHRI+NtjAIRKJ b3zng5HGakQjHTmkECSLH5CEpGZ1em1mM+ttTHa1WzqnhmdzrjOwhQKmoTCXS1dRSs4BhSahZkX9 i5abGRtHp6vdfxpImMb959SVkbrZg2aihPZi/bTuvdquUdBmL0KtTVLNUTQlbdzkHQKtTR7An0bN bQJtoOhi1zoD1EalKWxicH4toOCJKKyKJ+jpM9qB2KaEJBwt2XLjG35lkTYHrDZn8WQJPMINrtwq rtL/ogd7EAhNzAdjR/KC0K0A68RYDN20TQz+6t3ehV1Gr5bmxToAxMcGYUFUT/X4zRD45QsDCXoe xOCgx+AMLvcq5PZur+Cm7GCGT7Q8xJooruLETEYUomPax0daq2SEBCLKSRAswgqmSQh8gGD8BcqW 7F8gBAxjb1+6sEA4bD/kRT96Rz9sR92YYN1mgAl6gAk+ERQ/MQxCcRRHkQkwgQnCIAycQBWdABNc 0QluABYxIAxu4AYwwRZx8RZt8RadIAScoAKgQBDWYM2K0RhXxiC8Rwf8RUH4owcoYRVzAANCYBu2 QRW3YRqpEQO2MQSm0RulMQeoURyxMQe2oRzP0RzD/6AczbEaw4AdcwATtiEe3bEay9Ed6fEerVEf 9TEMNIAe/dEfWSAMWGAbWIASWCAgC1IgDZIFGrIhD9IhI1IiIVIiK9IiZ6Ahj0Ai7aAhMXIGYAAj 7WAFXKBEbsRk1owYiZFIVBKdhMSbpiC0hMAFZNIFXGAFamAFcvImcxInd9InddIQfvImg3IoVyAo a8AFDMEFkFIpa9Ipr6AmoRIqnbImhaADco9gZpKZtpIORAsbujK0QktEwpIswzJiyhIt0fIsIyZi oIAHYHIKvGwK5pIu6dJGpqAO8JK16oAK+LAOtuAvyWkLtkAQLaIi0gkxrWAN0mkx18AxH3MNBmZg ov8syRbxQY6j9VKPC5MHQEgPeOBtO9Zq3VTMrTrxrcLgGXsgDCghAFZxFZ0ANlkRNmXxFWXRNl3R Nm8AA2LRNkPAFn8xBHzzF51gELBhHo4ROVemRnyAQuzFrVbxFaXRF2ETNSkBNruxG51AGjFgG4Bz N4HzBoAzDIBzOr1zOnUTE2hRPd3xBsrxFqFTHt0RE/BRH+czPvkxH+9RP6HRGt2REv5zNf9TQCnh GQd0QA3yP3uABdRtQRcUIxmUQTGSBTxyQmfgQT0SJCeUBYyymUzLtWILOYlxZRwiL93ys2wvKY1S J1eURVvURV+UJ3PyKJUSKWvAEJCSKnPUKXWgA2b/Uiu3cmB4gLOEgA6UqZmK9CvpwBl4YEmX1Ct5 gA5ERAjSkkrL8iy9DAhMy7R4YCDKR33mspv0si+pQJz+MjDJaZy24A8Ns34OEzEXsxkcM0475EL8 ZRmPjBEhy0BWIJDuLd9wyTpGj1rsQ91CjAhLMzV7gBV3BRplMxVZURbD4B9qExZr0zZfERd9MTyd YBp9kR2A0zeL8ySTsxgNAhtiTzxcEwM29RVpURVRc91OsTx/cVV/URrHEwNygFOzERt9kxx90Rp1 FR6DVTutMVejcTzTMQzi8QaCdVnlkR+jNT/9cRv48z8D8iBXE0EFtEH/s1tngBIetEHH9SDBlSE1 /3RCy1VDZ0AjJ1QjKfQjZ8AoOQQI3MdHSBVlemRGvIeZnPILW3QQctIOBkEk5XVgV+BgVyBgYVRG gVInbTIom7ImJVZHr7JHnWwrM1Zjh1RIP6tDphRk6UAHupIOkJSZhHSZpjT4hLRK3zIP3pJLYXZG tHRG5hJHpuAV9DJHEgIw36dn/zAiANEKyokwCfMwi0QxrSBOHVMyoYxCLPPfMuwR8+VefCx5BoQ/ qgU+cIfF1g3yTCwMAoA1w9Y6maA1XnMVb+A1ZdEV/yE3ezMWwbM8neAEpjE806Ebb6AHsCG2JMAY /XZEJeBDbEBRddMbp3MVTZNA1W3drDM4sRM7ff+xG7dRcsdzOoVVN5M1PNeTGrVTO2mxO7dBO93R CcyRFe/TVe/TPvOzP/tTA6ARdgHUQAVUNQ1SQQ/0IHPXXMOVdw0SXM2VBcQAXSV0XTX0COK1QkdS RA4Cfo4TOd+nRpRRCL6QKHMyYAPWYFdAXhF2YRFWYL23YK33RYnSJsu3Jm10KSnWKWWSR69yK50M Y5VpZDmEs4RUZO+XZU8WZDtLf0E2f4tU+KgUJkPLLWU2DzBGYzTmLsGJCniWLx0CMNUUTc9UTdVU EI2WMN+0GYrEMRUzMiXTyQ6O4IgDDFnvx6wWUPlDPrpjPF6nW8btUBX1GcXWUWXTCczWhmkzFmH/ sRdl8Rd10xYl91N1MwQ+FW/xdgFCoAdAoBAAd2X81okloBB0YBDMNjyBmDrfahMLdRM5ETg/dTqz 8XKBs1dxNTh/NVdLdxzbs1nvkRbjMY11dR5fsR3bcR6lVVr9sx9X0xopoY8FkltzN3cbVEGfsVvT 9SEbUkEbUniJV3iDd13ftXjjVSnHkkZ+hGSyYA9r5Cxp8l9fVCQVViQHdpQJVpQVtkVD+UVT1EZb +QuTUkd91GJlkpYzNn6ZKWW3cpnsd0iLNJd32UiD2ZdDNn+p9CxjFiZRS7VsFi91Nkf6EoLNtC8j GGghwiKENhAxYiUZM07j1GkrcwwN4d8gEfW0/7CxsHZ4BhU81g3dxCWGA+AT3eqGnUBRcdhs0xaf d7iHc/OHN/WLhRNvffGIQwBv1RYEoOCJ10ACFLpIpFgHzGE8H5cVV5OLK9prC1U1Hxdyg1NyD1ei tzMMvvNzQ9pX29NzhZU7mVUfhdUdc0A+m3V1VZd199gf/RMaDVKPq1V2ufV2vfUgb/eQFfR3NXSR G5RCjbd4j3dCQVIkQYsgcqRMb0Qg+HV6PxmVsdcODJZg7SB8Rxl8dTKUVXlFI7aVc7Im+XQkIQFH c7RH2bcDOoB/33djMzZlixSXuTIR53pjPytk6RctwZIHXjZLI2ZL47Jmu+kuE4IvFVux+5Ivz/80 MCnYmslJEN00ThnTg5kWhCXkX2JPT/ftQO6lQJSnOvyDa3FHd9jq8kwMnuuZFc32nucZNq1Yn3mz tn1zboEziYt4G0+AoIMTbzHAt53AHPgWcI+7EEDAHCQ3iVnxUL12E8fFraBx3bgxoDvVGztVor1R G8OxO5s1jqcxpF36WHExOsNzG9pYHkt3jonVpfnxjme6j/UxW3F3Wwf5dg35pxlSXBkSIuE1IgEc XjPUQpWSQ7gU4zKugAdmemOPRUeZq7kXwrcaYbVawhn2KHcSEkayfG80lmWyR6/SBeDaYuGamW45 EXNZr215xfXaru+XSP3XSrfMywr7sJk5L1n/y5l3BJofezDPdLLJKeQQs0hWBjGbQTG9eRGf9kEK RE+j42oHAcjuLV5oqVp0Z4tJk7VR8x9UszXnGYddM4gxwW1tmxfJMzwbqojT/DuLuBs/tW5/Ox12 swc85Lhf4QtswG1xGzXdaou3GKMvejWdABrb/HE9uqMlN73TOzuFM7xDOqRF91a5k6UXHRNu1aXl +D5LVz7zMabzkyADdDX9E5APNL/923cZEqjLNVwh+SAfGZIfGSM18l0JfEK5WhJmciy5tHxQJCwH Rimrt3tNWV4NNny1Oqy9F0bJ2iiDHSfPV62bbK1p2Ufbl2BMPK5PPK9bnNv71dtbfGRB9isP/xxK AzuwB7uwExhMm/ku6TIvqWAKHPtGplmayekvJbiCiRadElMxkXYN4jTJmJwRQQDIFkRAoqNqoZxe 1oXzzO1r3yquwlaGCV02XbPM2fY2eTGMbTGJwdjN3Tw82UG4f3sb08G38Xa4zQES2AAIsMEGAqAX +7xQ2ypRtdjPp7vQV5ESstG6QTU4uTE4w/NxSVobxxtYp7E7hXXRb/FXc6CNuZM7l7VZR1el1RG+ 8ZNaVZFaKcEfYxeQF9KnCVnVFVnsz5VC1VVDG3mSG5IjKVkppayYhXRgbNLBq1eUu9p7szfZtVcn F1asVRQnPfxG1ddfqd3wSXxg4HomsR3Ft/+yyWTSyR5f8qn98Q3h2320ljO2SMPdfskSRWjWtNb9 gJe5LpkPx8eUx81UEKYZaC04EAPRaFsSyZW2MS0LT11vCxWJMxHeXrB2sNh53GjerR7PE+k5cef5 HyhhJKhTnzMezX3YF5NY+kMgies2zusW5VEeA7TftzHgGf/hVTFR0Al0NVuTCAUdNrdRVbkxG3+e u31xG7sT/ruR0em/GzXXVrkzBMDxpCW9WF0RIDBtyxFmG6aCBw1uc5KwoMNt2x46ZBGGEiUWFyti tGhxY8aNGEOyGMmiB4sZIkeiPEmS5EqWKGOetLNihSEXQlzoyOmipwtDhmoKHbTCDk07g47/JiUq tKnTpzWDGqoBtCekGj578sy5FSdOITl3duAKdidZnJC4QvrqwlkHrzzhsm079iwdsHjzCrnLgw6P v3/zAMkDhbBhKDymAFF8ePGUx5Af15kyuU4dKpYtb7ksqM4WKoI2bwktqJkgK6dPW1m9eo0V1691 goAEYrahbIYqQKqQe0WFQRV+B8sd3MagQeaQI5lhDkmP5j2eRw8QvUeAMAGYBKD0j4kT72GciA9z w0n58+ZvoF8Qgl0I9u7jh3CC4QT9dCHSYaifP//+E/7xJ95zgyAxyAzVhReeE+H1QEl0CCIYXRgU OhFCGBiEgEF4IWjYn34h3LBfhx6SOKKF/xpmGOI2GWKCQQ43LJQDfRgSFMI2N8yYg4xhXOiEjjJG FIZABRFEpJBIhsFCRBpIxBFFGZlk0kUXSXlSlSW1hBIlM1ByBEswHbGSmCTBMIOZaM7AFFA2AcWm UzMUtUKccdJUp5xHQaVnVFRl5SdXWsFFFlhfCdGBWVzVNahchApxRaNyBRpoV4124EyhYPEghKaA 8TDYYIUB4SlgeXgqmGCF5aHYqlNAAVllU2B22aybeWZraFuMtkUWo6FmxRZWZMHasGs0Q5sQtYFw myHDBVeBb8FBK9wKxy1nLYLOmSNGddxS50R0DDrxj3jeifdPeOipp66FFrJ3wwkYuMfevP8hAAhv vfXliwF+9u5br389DGKDIchNKF64ClJCHbfVUcLgiB5iwOA296rYoYr7ZazxNib++OOL8+WwIQYc 32gyixz/iCOOO5I8kBMGhTFjkQg9dFCTTEpE0TYUhVRRRx8pSSWVIpmkkpdUviSGSi3B5LRMKNkx g9Q0zWlUnHPWlOedcg7ltVNBQWITVVLddJOfPkHKFl6FGqLXV4eyTdZakFLq56MujKVVB2+dtShY zuwVeKekAvFpYDyUOkXiiBl2amGuRkYZZa9QdhlmsmLuWa66QsM5rqYFu5qwzWTRjGtrzAaCCZAs 2+xwwP0Wu2/E2WDDDNb2gIQ5ulfHO3X/wGOHHXc9fDeuguKla554Id6wAH32YQAff/jhx85+1QfY 7wnp2JuOEzPwZpxzDqP7MINhMAxhD8jPl3F/F/aQYfb/9fdihiKTSB/+Gb5IH4wsgtGFVjSyAa7s RuSJCCZ+1KOIDEQiCgkDziTokCZNkBIUdGBGMAi0kEzpSiLp0kguorSmneQIPfjSSswEpjSxwExH kNrUpFaUO2FNT1XrWlNa9xO0+fBPXmHU2holhLQMylCAOksQgxiXtAXxClqBYk/eQkVG5UVTfiEc qQhHB1EhLnGfKsziXCUYyEROMlSQTGYwIwgqbEYQpOFcr3LFq18JizWwaYYVaKMs3Awn/xjOml1w YgcJ4BRIOeZITnScI52FbeeR4QmAuL4znuWVZ4HqyiQ7btCeTloPX+7hHr7uBS/v5YeUEhMDtA7J u4Mx5JUVYZiEHPSw/l3sX/DqgRh6hK+IWQw/I4LYjUREMg2JDGQf4xjJcuSyYeYgZMvc0ZFidCGO 1Sxm2KygNnHWQY1cpGcdJBqWiLa0kJSTJUv7EtOcppKVxORM8IQBUowipxvuSRJBaUoNrjKVq/yw iZNKol7cVsS/CXGKkpJUXN6SN69IEW1SzEnf4KK3vPBFi1zsVKn6IqpP5eFUp1pcZM44OTVWTnOg 2dxo4KirXOHKV8C6Ix6tUJvW7WY30f/ijSF/ExzisBI5uJMO76wzHYVZh0GSDIN3yjUu5alneZ2E z3ui2h7q/ad69cFqKUuZDkocpwLGKVB0MEghpTKICepjGCUKaCH6aSwMx9kff1QEzFsGs0QkitF+ ZtS/GZkMgCvSawOHxCIMNZBIJEOIAh1I2AxSKCKUiAiUJmKRJm3QZ10i4TeJFpKXZIkkJnEnC9Qp Exai5BEoMRPVjlATe4LNJvjsIdpushYnCmpSQmyU21xgxLn5LYlMtC1DoTjcnkgRishtqAse2lCJ OhcvWOxLp/xC3SxmkaOIK5VHgRCqMSYmMY8542TUaCvR5KoObUxvS2EaOtERqzas403/TwHJ052u UnbN0ZZ0ttUt60iyeOViqnjaEa4bkCc96WmPetLxLieIcgHcg1f3SskfUZ5ge/vCgBiOE1bmMGxh aY0Of2m5ILziEmMbGoQh5Hex+ZGornbVWDE7xEyTzdhCxfxRhw7IsZXtCEcyg9k1E3IzCTbEghRc EgWbpGSMSHBoIhEnC5bGJYxsycojQSGYwKRClcAATGc6iWpZQEOkKEEobhLbDxMKRCHslisEze1t 3QJc4AY3KwxVLtqK65OHSpGhVaSUosByFzpg4y/OkK6h/bIpbFB3uoAR1akG89HBTEFVqpJcZGZF BSq8orycAY1oBHGJONIRWL8alh5p/wqCZlUAdvUFa+yc9ZvdOSeoYhiqAYj6LaR6pzuTHNfyLJke dcnLwfWB3ik/BKCs+kc/F94Xhb9VIDUdaHe4M0e2g9oDDwOVkeAqcYoA1L1xp2g+PeBND5oNoA7h x64e0hHIiHmj9/nVmBhy0TMPqCMGEuQGAiEZQXYks8US9kgQnIg2wXlZcUqZsxBXp9Ek/qUudxkm pmUJ1bKG5n5ipSe7zUpO3iznOg/x5EgsuULvZtzlujy5Uvy4yz9+3D43FLnArUvgGI3FKujgLpna y6Y2pWhS+SUPXRQMD1IFOcKI9FWTm1VnNCea8qqXc55LNaqH9RrXEWeQsf5NbghW7f/dbWuo00l7 AB5prmAP2JJPfSpV5RNKaE+YX92T2LeKJ2H/DChbzNkdco5DeMKryUAG0va2EFShklH4X/k6t4UM PIjdlCxD9+pPxfDa13Pb+H7KDL2IejQykYWeZJhISIwKrlgi10wDCaGIBSXrWAtSSWhAe/hnTXKE Kl/k4i9BScVHu2Uvz3BqYFPzVeiGk93qoG9qYZTb6OY3lQMqUl25ectdDvLZXgEr4HdB+D8+fpcD 2isdeBReCt1ooWvK/fDn1KasK11P0QGkHjXMpTVNGU9bhuqcll5uFEe4cgnAchpb0F6s0Qy4YQLM InY7FVbyRV/GAR251juOVDzb4QT/kgRsvzZsyiNVC3AD8nEC7NE9djdu9kEJBrI6gzAueucEDyId upMcy3FIHCYwtqODgxAO1zZLC8JJC5Ax5KYh7GaEFxMG4SMEFTBX/dNstoQx57ZXeuUhLJIhGLJj WhhAhQVAQyIQMQJAMxIRRsIzRIIJLIBwmIBkS7ZkGWFZIOFwIiRCURYSJMQCGlBOwpdlLKFOLEQm YnYmTCEUYhMXPJEWLgACSURyOYGIZMGI1sdEDMUTfmZz5Cd+LqAEmEgV5Rd+mNgTNcBcb5FcgYYT iiJ/esEX0CV0fKGK9ZddSUdpoXIYZjQr/8dpuAgamPFGouZSv8I5qeZeqzF2gHRf/wIDHAMDSLmB BLZGg9UBPEbFgeMibML2duehHiNIglM1L9yTVVx1SuJxHJDgA9iwG+PDMLsmYs/BHMhhHLbjjr9h HLJzHMkxVOHSIahUYZqHefthIWEgBoaADdgwCJiHjxAjhe92P/djIiVjY8pETfeDIT1WTCJTcKun IwXhQKl3TQgxQUxCeyD5ZE2We1cmTlsiE1W2TurUh3y4h3YwWjG0cTUhCWihFXgRZ7+liIUiKMwH FgTVk2u2RMy1fTMHipv4E+A3FZ6YlOVnlFiAicRlforCfkJXlalYlfIXXXRAf34haduVaZIDBZdB OWrUf7eYUp+RlqFhC3KEgMG4gP/DSF+xs1M7RWvHoUu8sy1iADzWoTDSyIHcMUlvB3dO8DzS8x5O 0D3uoVX9IR5iUAEgIJBfoAM6AAkmUBvjwztotzC8ky05+Jk8tQI7WI/hxi7/QYTLZi/40j8pBgnY MAVfYAgu9oQk4h4mAm/v02IhkD8ms2N61W8ApDIbAiQC4WONJRBNkgMUsYYyo2QThGQ+QzS4ByV2 WJ11SBLfRBLp1JIvtIfwFENR4UOEshaOuDZw4Qxug5OTQnK21VzNVXM5kVzgN5/iVwP2uQKcaJ/1 6QL4yZ/2ORWbeBOeiFA1UIrrt4pWWZVAt6BDV2g8UAV/cV2Jk3RgdGmuIl4lNV7/lMEFU/BpKHU5 6EUFbOkZbtRSbfmWq9FTYHeMxxgcOFUgZtc7RNWX/0VJbTdJ6TKCOtpg9rE9KJgf4oEEFWACAgkF AimQlKkDqzNI+kVUGVgdy6EmMxBWNkAtYUV40BEd5TIfKVJhFcYv/Dgf6TMIIAAFUDAPUFAB+Hib mQc/GFMyylRMGaNMGoIjHWJ6J4MJwPlAK5N6CYFNB0Fw2fScbficbxhOI5Q01uklWMaojNoS5bSS fahaNHE2eIEoaKEXRYQpOhl9brapTWQ3Qbl9l6ifnLgC4oeqqHqq/rmq+LmqANqUWIFcWBFohAY4 t3qVmnqr75dFe/EXVSBpqpIY//oHliOlabCioblIop2RlrqiUltwCasBLFs3jLHWovL4dWBldkOV gRyogf8wjdN4MASmHpuUHvIBbdcDbeUhBjYAAjqADVDwBUCADV+ADUBwrz5QmaxjCONzgbxGHUaV HdGRX4k0eFgKVGhXIeVhP/liLxDrsGNqCDoABYWQBVlQB5CAMc32YiQSMR/LSR9rYwCkIijzIjny MTXyMgEkMy77QAKhhsmZhgpEqDgTnU+Ss7r3exeRh+tEfIyqTsMXE18mk46ILALFFmnxZp96UE0r ckvEcst1E1A0fvNZA6+KtVp7tVtrn16LnwDan2Brqp8IlQ3FN0iUq0Lwcz9nlf/s56Dzt5URSjhj VEaL4XQXaqH8FxlcUAd9+6Gaczm7SKJtqSsomqIr6o4cFhywA6PVsZdO6pfjImAH81TPs6MjaB8Q xg5cZR8BABzxyl33Kpn5aqT3Gq/8yqS/UzwLkjzzUR5oNVYFm0iJ1G1NWppcSmH8qJqZhwHRoWI6 8AV1gLEYWwjYgCK91G6riZt16nkZ80w3Br09FoYbwjIK4TKoRzMEoQEEwVg5c7MLt01BU51Sdp0i cU5XRlp8aAcxWRNpQ315YUS91TagChch154QhZSYGKv1qbWuWhNYC8BZKxT+GxUCvLX7yZRH+WdX gLaGAnQWBRYQOnR9QcER+qv/1pVFH7U4pUIYYGQYlAYqmBaWUScZsWKWmONG5aWWl6BSv/grCtgM dBmPBcJTOFVrnVlU3jIu2zGu4lIe7XC5lquN12OC9eG56eaapXuvTPwF85qvX0Cvp6sD+tA6srYt 2VG573LE9dKw5yqD64OXMuograsxGEZhALJ3wAEJFVsHEkC8GAsFYhBtEdOxt+RLNJYhLFJv/nNM z0RNKAIku2lNZ0gkgsp6A5GcNdtYSPa9QgMllKABOQtC5DtCJnROXDYSMDQ1hhBbBfWIjdh8cAYo iBgpo3o3Auq/XnufASzAA+zKqvyqWeu1UyG2WNGfZHuJ6Xe2fIN+fDNoEcwp/1g0fxiVOBuFOEc3 GElXrGLkGPw3GX1bUoG7i7oYGtA6Gs2QK1yXoseouLZDa4aAAgXjpMDDgdfhdoK5SexgHjoKYd0D YfHSHo+ZDToAxfZKuk4sxfSar/nKBkiaumJVPK57YfVydxemmuv8D76jS8/BXxvIScjmL2BaMRig MFOqiPZqsVkgCHCcsbJ5YiXybiWykPcjsi0mvc27b8kUIyy9IzliEDE7EBBBMxHEvdt000hmQZXc EVGmTuVEZU0zfH04A2eCZoySFmsROEPkiLVlv1DrJ2YDRYbwffW5J7CMn0ahBEcRy1w9wFqbqluL y+VH1QzMyw3cN7+c1ml7q/+tWHRblDhaVCr3Z8xfyRh7+yp9e1KcNrhVV7gHqHVcJzA0jAQSqBsV kA02gARisGvQCEkcKJjC5jzYKNl0l2z/gAQmEK/yes9Q/MRSDMWgzcTYsK9KShvG0QPAxkkGfdAH XW7sMSDc4mHVQUkNC0yqST9qbAhs7ANmWghwhLEcDcdfQAnwg4QjO9K2tGMjcoUL6VccA0CY8FcR 8SIr47IDh8iNlTMEx5yNnGSRXBFMtrOb1RIakGW/Z8kkUXFVw7TTl7SNUp7Zt2Znc7VK6cp4UgN2 gN+yvAIbUBQ5tAJnptX9DeBeXeBbKwmq7LVHKX5S9JQF+nII9ctnPRZoC8z/ezHBD9oXcptRjwbX cA1SqzLCxvoYHLppsRKAblSicgSM2oxqd6RHikvYBWIDPZUN29qtNPrYOi5sl2se6uw877EAQu4E BqAbPlCvUYzk8+rZ/BzF+gzF9GqvqKsDJmACBRPZrc3aB+2N9RIuISY8A60vMiYxY8ob+8pdFnux GPvGWSABwYKxdZANOdCmvQSyoOd5vWkyH3M/picygfoxLj1wA+EyfNq9aNi9jpwzPFOoEoQR4b0k 1rnTItF7xKdCYrLetdW0nmq/i/i0PqSUrHzATmEUWX0Upk7q9DTgMKBDNXFmrW7gBa6UV7GqNNmJ ZRuK5odco5g3E67WQlAF/3oB7Joywa24Fx1efx38wR91GJk24pOTRprzCmgJR8yqK6XmK6VRR8NS ATKe2DIeHLjxG5C7dgojSeZejU7wAEBMgs5TmO/BDs9jDhWg2ff82fbe5KGd5PbKBlEcvKNNmVbc SuKBPVqu5aOEH+PxSKh9MOGxQO4jYwn/IBum2wK5dHXg22suLGze5nAMBDOgjxYTIiZmTMIUTPkz vdZE3S8iED8iEC7tQBfpQGXYJGrIM45se0jWs48sTpTeEkJrQuq93j6BiET/W+39EwDVZ2Zzn3ty 6vSUJ6t+FFrN31RvBwJO4P099QH+6l3dtV7Pif2LFQ7uAlhQtWTP4Hnz4P+/zMtpXRfAjhdv/+tC B6F0n+F40ClAQKGoUmkW6uwbuka0QqKES2q6goBydLgy3u3AEV9WjuPmzoGtOy7lqs7t3O4BYANs fKT2muRSzOT5nO9AELxRfKT9PpmkbQLMGK4/XPBajoKP50oi4roYwEmcBC/swiAzGDACo9vx2ttq DsdsvvFwrLEUAzF0HoUpQnrPLaeXt296Lm8xGyN6+kA/RtPYpJwSpJwaKXttKHvfLcl4CHHYSeni 33szoEJV09RENBfIIsrq/+lhP+r+jep4sgKrLk/3XxT5f/80EfU10QYAYWeFEoFKVhw8aHDgwhor Gj506LChixoVK1KkeLH/BkYsLq54dNGhRgeQTTx2uNJB5coOQlQKgRmzipCZM+kIoVOFh046PHri 4QGURx46eYDkMYo0D5Q8U6Y0dVqHilSpVF5J3YK1zhYqgrZu3SIo7JYtl6xssXI2bVobSJDYGOS2 QgVDJuYiMRegR4AATgJQ+ufESeDAN5zcYGd4wY0FTpggqaBDhw8d2Cx/AYL5yxcobDJn7px5s+gv bDRjY4MNs+XU2CbrM1ShRw/HgjGkO4H7xG7eu0Pk7n3i93DhGE4YD5EOA4YQgsPMNjdIOt3KnKEU EpQli4Tt29dw1649e/gsUFZsGx5C/XrmIZgzR9/e/Xv1TnJswxCGOaYQ/9vuY9oGEwBzCCMH+woM EMABt0EwjDC2YZBBTDQIg0IKt7GwQkooZGEbFiih5EMRQxyRhQ+PMJESFE2cAYYZEFrBBRldEMKQ GoVwAZIbccRRRxlxnFHGjSRqCCE7jkQySRhWQBIGO5w8cskkCRLoyBWcJOjKLBXiciEvFWIoooc2 ssghSCwiMyOMNuooTRc6+mikk05iqc4mOpgJpptqEmInP3USaiifhirqKKOeQnSKOqaYilGq6nh0 KkkFoYIsssCyNKy00FrLCiTiwssGGyoIJpvY3OLLCdr66mswwZxobIHFFvsngApAkGwyHy4bDYrN fN0MM9OC1SxY1VTTAf+Iy3T4wjJnJcumrdladeK33rw4AdvgetNt23R++/Y451T9dBAbDIEEEh94 gKKOQsAjD14JrOAOvPHCw2YQ935rr9/12IsPvRwwEJi5+wbe5gYDcwihQIQPhtAJAQt88EEC/Quw QgY1wKTDCj/O0MIQKxxRgxBPNlFEE1dkYYYjkDzoTEhoNITGmW+08WYag5zRkBoMgdHIJJu0Ukon pbwy6SefvJJpJ5NOOksmtRRogxWstvpLrV0wqAZJKnJIEp8rkiSjNLFIc6Mm1N6og45IUultlFgS ogmXYGqJT510oimnP4MaNA8ehlIKikQVjcopKqLioo7GqZCUK6+y4sr/UlvIskKsTLdoBq22zIEL sltBCKYCJPTyKwDCBAuMnX9iHSwAJEDIJl19JnOW2M6KBS1YYIlF7dgvmD0WteE3s0wySEyfrQcm AsNNN2ynz3Zb669HzonneoiOLhBw/fXd7LKrVzt6yTu/O+0kWKOQfJdLb9/55pdffvz6e49h/Aa+ r78C7TtQDhbEoPs8SEIYCsOEHJQDFgCoQyHbEMgiWCISkUgDYlAZC47wMoRAIkZB8tGPZBRCnvUs IkEb2pFeBoMjNO1oM1ja0ZbmtKlJSSBSylKV2nA1GBmEID4siJca0jWJSMRsFRnbEdfUprSJhCQf wcJHVBKSudHNbnei/0kWs3iTv/XkJ4NDylEMBxWnlPFwZnwcpKaSlUpV6itkcePmLoEWTrnFjqOC hAnsgoS9+IV1g3EdOw7jugDgUQcmgIRkfLArYn2GWKN55GWwAQRmMatZyMoMs0yzrONJBgQViEte aFOtbnmBAic4JQVSiUpWXs96t2nObKRzrmxUBgjXwQ68vFOv76hvfb8kj/sGAT/hNIc96snfctCz nmUmrJk3QE80+wOxAl7sPwhy4II0BjJMgMxjGmABycLAApOlLEXnNCeKYHgQQ4htRjx6J81KGCRD +OyEKXxZPl0EJTvkc4ZOatGRYMjPGDJpSW0o2gp2uKSr2eGHVUKI1f+65MOFdA1saCKSRdakUTZh ZG0cCYkUU1InkrYETzDRWxVu4jdADU5QTYFpGZnCFKQ4JaaR2kqlwtIVsLRxc5Wj46bSghe3jAqR FVieDfaiOr+sbjD4eAsIIKGPPOZqMpaEZLE4o5lhfYEHyAMr8jh5PGc5yzSVUV4FpDWbf/zjNrxZ 5SlZGde5ttKVzdneICpgAhdUBhvteld4uJO+ePVSl/cKTyGgYAhKyAeZyByYe3Jwg33dDwP8C8HC GEagyfoHmvrRz32c2SACJjBCFLpPyEA2zgyRc4IbClE5M9iyF7FznvGsWc2ARM+xCW1oLIxhDFu0 wqUF9J9Oo2GUqGT/B4RazUo/hNoOKbolhyKkSxAhYpkuIhElYGSjQqKISbBAkvGSFyUhVUlKXGLS llxxi1vcm58EV1OYHsVQYYypoyiHqa0IQiyay8ocKadTtMxREGqpY1HnAona2aUCYmhV62r1FnVd 9XaK1FUXjpea0mxmk8Zq1vFCrElOclgHrSHrJZHlGj2aC1WCuQFwsJVKuq5yN3J1pW/ENZsZDKIu QtABu64jCAmAx8jdmZf6DHs+XVohC3X4giGqdcxkUlayl+2PewKWZWn6h2AQCxBn/WOx01boYhZS oAY8tOZvdiicHwKnykiEoiO4bJ0x+5kLanbbef4MIlUSqJOOsE87/wS0zoTeZ4sCKsOjNS1KjrYh Q2+ItRvy0LlZYmiXtFbRiFg0RkRUwtfQxCZSg5dtHjEJ3Eqqkjvh6SUnhW+fevJSIExBUIQ7SqGa Ugf/ZsHJCCaL5v7bFWIPONg61RyC1ULUuVBVB7dbnunMYccK1HJX97CqVSlDmRQLL3eVDLFqzipW ZKnY3OBGN2V0EG1pMcE2cK0rjeNdY7tuq2Hci0tdJPPXIfNSl7tkMnnIMx54uU/K9Jls/e6Hn/yp 536R7TKBLhta/RAQQgREbYAQmIMLVQhAqyWnNz1EQQ1q8GV3XgEkcsvneQbtIEiCIQuK+8KjEVfQ wWX0kwYapRkyzf+hT4PBBoLOpIXy0KHMTUhFC7J0JWSNog59SNcsiqY1ca3qSjBJDbLuAvHObaRf T+962+tqmtRkJzkBiuCeIjiXDq4oitqCr9cw9zX42u7+xbvmvrJGrAT4p5k6i1mKGoxEKnKRlJkq 7iyzSF1d9arq7oJkjsdISW643MTzQSe/kHk2dAEbmSee5tE9PMmYIDahFMxucEPvuNrYxr3BMbdi 2QNzUUc1UBgy+ZzMviMLll5L/nd4BAEESAwiDPVDvsEIpmVM6A+aDCtQfg72ZQj1L8xjxr4bBmSx DnWMBQSykIfECU6SjVyDM4BhbWGUZ5bLqGZFMhKTCr3PRMNA0Ef/kzkL6p/zm0PJ/492kg2YIYWy AwEkuqo5Oi8xQBh4qC4RiIR4wOoKk+watYtQgo3oru5Kk48SCa47iVQbiSoaqTpxCT7JCZ1wqfny EzrAg5qqAyejuyyouxmUQfM5sLCgiingAkeBnEtpo5zCikq5BALbArmQPN3ZPHVzDc9jlm3bNmy7 HShkg1zxgSl8vCn8vF0BN9fQvM3LwslDjdFLt0PKI7XiowBIDthDJVViQ1Wat1aSN3gLjuZgAtrT K1ypDtzLpSOTl14CpvA4H8TKAsXiAUiYAf2wH/p4OCxzuMzisstauAbprAYBkDJToIv7mAZiMwQK GTfjkJWBoQdE/wigUbkZAYGecT89AxoUgjnhyjn9swOZexmZsz+dgwFaXDScCy6iWahHQ7qqQRos YbqXeznoarqEkKikA7WKoggi0cAMtDqtu4jwepOQYJP0wsZVOym7qQKVmjWkGJz4yoOtoLsYnLs3 qDtpqME1cDKvcIod5MGqWBSukJSpmCOf+ikkQKTM8xXcwz0NyzA2AL3IizzJuIdEMgEy1IdsiMJn Y7zJuAfG84Eu4DYdoEgx9MJ0C55Kao1KgpZPYp5/6JY2ZL2ShEO7ij3h0B58M5e+YhY93MPfKx8j 2z0kixfx0I46gAIdMIRDpA9mAhgty7KhjKaHWb5owhhqSsox0/8A8EutjgmQ72MtkrGQN2MRKwma dqqZGIkRn9EzVdQziHi5QovFFqk/W2wZJ9E/WLzFWHRLmlsaXJQhp2m0KBFAgpASoXuoNgAihRqI o1MCg5CuILq0vzSIZMwuhuCaT8NADLQ6rtM6GekIuRmJkVibDmiClMhMzKybLFIpnAAjwfFGHpiC V7CCuVtH7WgGdGwGc6w7QVg7M1qc2XQcx3kcyMFNyKEUoCoLtNBHEPgVf/wdi9QVyihIg9QB2tGj vdKjPGIwq8K2xyNOi1ykKUzCcavO4SHILPy81Di81LgqqbqLvTCOGZsrkmTDNWS9esOx9sQrWRKV 78kV68AlCSD/MoHjPfNhH8HyNXsphDpQluJ7EMf6l4JxRP6BD0ckIPsYs87yHwU5INOCkAKhkDRb LQvhkE90kXUaBHZagXrKrQ9NOZ+ppzyDP/kTqCOhxVh8hIAykVi0vxaRS1qkvxblP12cy15sNGFE KKVRiINyKOdaiALkob9kkr6cKGUUkwt0iAusgQu0Omgkk6xzohroCJMwCQ9sNSuiCZ/oCbbrRp2Y gtNcRxqUhhlcTdVcg3mwKTQqI3jUwXesTUmpCnv0qUo5CxtIyMz7Ag3rAjaAAs8TyKs6TijMIxMA ybmYC7tAVIakQmwzTuKMvMOjzkUiyOJEtyxcJNfIQsfLBrUa/4S8eCv0XMPzdEOSLFUao6sb6w0M 0J7nQD8fw8MgA4JahcmY9Lft4L1eIjLFUhYdcIFBmIFl2hd/CQHK2rKE6Z/ly6wvo77/OBgyOxip NIIJVbMJSTNODKc4oy2U66AVKBsRdYET8iARFZr0u8VbHDQZhVETUUsXeQQYiFezfBIafUsZWtEb /ScDRCjkIkC9fJJjNAjAZMDqaoMN2ADp8kuK2gBj5LQLtCiuETU16S60+Si0gcyMvUzLDMGRuqKV 8tLBwYMwBYJXQM3UTMfwUEe6g82aalMzIiN4DAXHYRQuyM026kF8pAJPSchf4Ywu+J2GRM7b0QcQ WE5FRQEU0P+rRUVUECBag1Q3yYg87STOJKykiUw3gaxCLiTOh1y3pBID2mBV9CTVU423ukLJ60mP lcQ3Q/ieWZW8W7oOXCqEdxGfunUX3OMBTzIEYT2+YypWoJQs9UBQ/eGyhQGQywKQ52vQjsNE/2ig BkKz1moZ2oIZGFlFPRNReypXVpw/s1S0fco/FHHLtYxX/WuReH0EGp2BeH0SJ4nXG5XdJxG6I2ku 5irAI1ECHMpdJUAoYww6hD0IrBlShyXe62KICtRAjdDArWuTrOs6rluJu7EJOrDenTC7GkTZNXiD ZqjBM5VB2CwKqHDZmIopLvAFRlGUxmFfqoCcnOKKIcyUvZr/DN3RsM27qoiUjNtpVJBM2kFI2gAm FdrZXwzTgYiMPK2VVKmtpMhDjYo8vC8UQ8ooWlDiI5FUT7JN1fTk4FRF27FV2+LIK1Gpp+/pKxeA 273lAWxYYWXZW761ATtgggL5l39JpgLlshxW1uWbPo1rPowBYogxAkxwAwaC3G1wA5LZ1pRRNCvp UMw1V6DRSpeTPxg6NFuEUdBN17Wsv/yL0XRty1pcSyzWVxnq16WpXdq1XQK8mt9lY8EEzCNlrr38 kuqCLk7TrouK0lJrTGmsxsiszJUor25cqZ7oxiwaUxpUZBlcTdRcA/GlL8JZO/qagjtw0zjdwZm9 WdxkI97c/wL6DRagBVrkIdo8ygY9QuUKCOCkHQIATtrS0aPkvDCi3TZMjdQFJkjGK8jhWcJcmdQp jNoytIF+oITqIdtjbsMM9mB5i73YsxbeGA4HgQ70s4EZEBUbWIFzIWFtNgS4qOYZ6IHGWo9iip/6 gabLIlDCVef+uY+JywFqOj6Lo1AJbZAKRSAWQT+yZJJBEMVRlAQPdQh7gpEUpb8ZyD/U1b/VHWPU vcXTTVcWhd3UhWiek9fXzcWciyEBlJJ+bS4oETrnAsw4DuljHEzf/bmHdajp8qFRg1jl/aiMmExq xNLp3RtDxl6amAJHtrt56LUyfWQoeDu2o6/5Gmry5QKogP/Hx1HfNOJknfKpaqsOQAVaYDkkM2wL tzAHMTCHfuDq00ECA0CCfkjaakOqCztgx4vUSE3gSB1U41RrMdTaTc0VRLXgvshgZEbm8zxbuUrJ lJzDYlqOV3WQB5EYJwgQ7bGPGlbscf7Jx6rho8xh+2DW6PMy/2DQ/ghiCNk+NQuQpkyZcTLoJNln GHniUaTigSZLF7HFWzzoW2RXd01oLvZiWNQ/+1vdF1JdWsxXHF0ahHIS3/a5JRHAHQLYLNmhoytY vxzpI1U6HkrS6SISI4JGi8LYtTm1y1QJlfrME8wiHjBZ7XhNW7NepziwGiQKpfAJpVBB9aZkSj5q TFbf2dz/ZJwVsC1AVD7tR2DRBxM4HdVhhwdwAgAH8EDyI74IaxSYi2xw2mfLldvxgehc4Mab1O+8 ZdKrwqvVwgzPlWhzCye4Mbw+5g1m5lV9Pb+2HuL4F+HIgBNY8QxA8XFGcXJ+7MgS3PVgGMKNJkh0 56K0ODErEAjVbCMYpxAJ7XV6kRd5Yjso7dOmYrL8XNZuaBk9aIVOmXZtS9mu13d1UftDtNktY57z bYJogwD8xR263d012JE+usE8bt/1y+N92OStiJXWiO/y4y3FiZk4O5kYx7qTQTb1CSyiA0WxAjYd by9Fii9V9Pm6L/N9WTfdwdlklHq8U7KogNshli6gSBP4/wZzYIcFwBbc8IJRz5YFOIFP/28DRwIE V/ACZnDK0N/Ii84q1AeJfDyJ1NoJpwwFXuvXONTxXD1VkgIQV9VkPtX1ZNUcU/bdWHEW/40WJw4Z r+FiOg7FZsQriw/MataipL4sU0rRIuKOAT+SQT8WWAEjnxqXq5IOXfKDeOJQVKF1dW3RXUvZBuN6 b9fSDeP8e138e10vft2AZ7Ta9W2ABdKCNfMCLFjBXFg7ZsCkKek4/qGJR1johtiBWEzHdFIr5fiP SjWVsN7qrYmWoIMDe+Q6uImRKsEqGEfBGd/rhXnrlXnrZW/2RhRLnoJQgG9NbpxQoJSmrvRYvt8+ Lb0AYP+HUUf6pFd6WfGLrR5rp51lRZr1W39wSr1UinRrXabO4tzaw4ta2jkVJPBwkhz2YSf2EGdm vT5JZW9xFnd7t2/7tg8BF9ex4TBW5HDsG1bnhcMf/vEPb8cYaPIfH+cQg0Y/GOJnJFfyFeDnxl/3 qRGIDlVygnYZFKH3djVdg673KZ9tK29Rh65tG4XF2BV4ez0aL+/tIxE6orsSqznu30W6366hH1qS 3d2SoSPS3f1LxKyolQ7MwHzSaFwTPM+JPjlkIbiCPjmwzMmDkrIbokhvopA1mdfunQCKFiyKL02K oU6UpkjfxqnZSa8DTb5ZoNJHKtxfGwiAbBl1RvACRqD/APh/f6X/738Qg7dAgVPGw1pHa0LtWq0H CDY+dAzsoqOLD4QGD+pgONAHxIcNdegDUeGiDSQ90p2gQEGKx5AiR5L02JHCyZQoUXY80dIlzJgy Y2Y4UdMmzgw6Q+AM4fOET54/g/rEEBSTTyc5QmDIgWFbUKdLc2yjGgJqVaxXqXLdto0FWEozWMyw U9bOihkrVqBl63btikFu1Z61Y9YujBl5YbA4AvYvYL5/+QouDJYwi0csEMMgbIeFHcIwHsF4vLdx 5MqaNUfObKdN5A0wVoAuHVkJjA12NohW3UYJaTtKZMd+DQM26NkrcM/mHVtJb9LAdxMfrqTGihou jteo/4FFiQssTVx06ECHjhDs2Ks3EZJH0JosdXhcqd4BTocmTazTqcIjD/bs7avQr9KeDh4e+ffj z+P//xT+BTggF1MUaKCBdXBBBYMNUnEJFVsw2EyESNhggj73UKSPDQak4wWIFHjh0YgjeiQFiF4s 4EQABvSDBAoXmUBRQw8VdJAPbBj0BUMIQWQQkNjkqAOPQBKE441FNgSJCZBcVIENPThx0kcgSWHl RyWFROWWJq2k0kstsTTTTTWVmZNNZqbJU01DEYUBUEQRtVRRUxml1TZGYdIUn0tVFUYOYWwTRhgs FNoDWXfdNcgRbA1ixyAwPDqpWWzRxdZdMxxh2ViF+f/FqWCHiTqYqHuVmhhki6naWGKYLdbYZJY9 Rhlmm33WGWeVdXbraqmB1toKqX0W7K0bsIWasW2QJtpsyt4mG22o7aassaztBlsNsB1nXBPKQVfD etoJQZ8Q613hHXhZTEHHFeVh0UF5641LBw/tzTtfffe5V0V+VeSRH3x5vPefgP5xkceACCJYIBcK 1kHFww9H2OAWBiBhAgjZmGBCh+yAiKKIKFrpBcgke3ECO/8EgEQ/NqCAgsb60HiPRED+SCTOBt0Y ZEQCESTQzjjz2NDGTw5SgRgBpCMSliCF5LTTJKm0EtViujTmTGTS5JKaZoagpk8ZCCVUnEwFZZTZ TEn/hUGfUYXQFVWDyh2GBoX+NdYMZeUNaaNqQTrao26hNbhaum6qV2R6jbUY3qMG9riqiqmKKl+P gapqZKlWtmpktG6Wa6643poa6cieJmxup6FFbW+3CdvsaqujZa2ytUdL22vBbWAccrAt11y361k3 7rjwlkfHFIJYIUgeQmARb3rRH59HffbVN671++LnHh7cU69fwAQXHODB5E+R4IILOri+hFsE0E+M G6Ngjscij8jIiSM2DSLK7ATQ4otiVAETaGxmFGFDzoiEEDZ8ASI6+pmQgBaRCfYogQPRgZMqcDQo aQROJ6pSlq70QS2RsEtWewnWsgaTM+EETTb5WpvE/zY2OcGJhmd721Wu0hSs9EkpdAsDJcCCt7xp Sm+ZGk1Z+pYWSZklUnmTVGUYlZbEbcovjItcqEjlOMmB5RGdOhVjKPOqVrGqVpRBHK1o1bnM2KoN lQFNrToDR9HIpnS+6pWzmlWbOiohNxswzWys1breREtbxdkWdL5FnQ4IoZHVKY91prAFQdQhD9Sp gbs64JwOYME7eBDCucglyurRp3v04QF9/oVK/9RLfAgrGMKmcIcEhcJAB2pYgdZHMf/Z4CIo6IfH RBQyqIFwfyBihxNU9iKXxW9j2QCBzPQBkQrq6GY/muA0dVZBgwBNBz6jiAmepMEKIMEcTuDIB5s2 wv+olfBL7jxhTFIok5uskGtpuqfXgBInfc4wbWeTij+XopQbBEpQhRILWYhoxCPoLS9/G0QSl1iW KUaqUpmyQxX3ohewWBEwHp2cR0PFmFHxRTGIWdWqZnBGxkwmjo2hjOhoEJo23so0cEQNH+1SGtW0 5lmpAw20UoebYZWGNMRRFmqCY5zdNCeR5qHDetbzLuQJgpI8wAIWosNJrU61efGCarmaUIX0jJWU p+we9bznLzzAZ2CuHFAs83BLBYXiYeqTGITa5z/4oQAJASiRyNIZQhFiSUXsSBkAYSROAmJIBxry wT0QiE2BdIFHDWQgQ7bpkGlGZCIZHEQvM5I0dA7/NoQjbKfUTDimL83TnvU8U9fu+bUXiq1sQbFt UaJiFD+FIAyYGFQQg0iWhC4Uo3vTVFqcuCiMVqqhzq2iWTR6hI529KPW/QsXDYNdMK6qcouZFaxa 2jkzVu5zbPTMG0WnGTriVDRscZ0eTXMrnCa1MvUdVrWQCq3etMFY2qrdtbLlgk1WZ6zwehfCqjoe 52DyeVl9FxaAQAetgmFc51JPuTpQ1lGaFZX9UmX4CAZXWZ6vlgubAsSosCAFNYgLEorQAlb2ywDs gAL4w1/TrqTjHYPEZIb9HxIs9LInYSwbkJiID6RJkIT0LCFIMtJEFqLNCzZEQ/oIJ5RQANogBwBO /yYSWY5Ny06RUAlMrFXh1lwYW52kKYa0HRs/T4C2n6ANKkzZxg3wPLchKjRvCWVoEY2bxEU5lKHR VdxdDM3QvBwhL6QaS6M5et2/aEC7Hx2pdjEtxjK+yjGT+S6s1EgZmcJApjQg3Wd81RqbfuaPrq6p q3fnU6Kupr+9atar65vUFagmqYXUlremAwY6VAcLNfBOHerAPCE0x9hbdbB36JBV+5gnelEla3fE mi/60AsPaN0P+OBDB1cCKJYknkJducAwFtehrus7AS8s5iGQqVPHVboSI3jcYy8cFoD9GMSQszHA jUVTZo5tiM2c7KMh1SiyCEeywyUCggxq2QaDKP+nlD70NCsR1rSn1ZLV5FnPNgOFzWbSyU5qe1s3 sfxNTjEb23KYZx/+9lDD9fMQ86I3hh4O0Dpn9BOD/nO9TLfRG1XcYBY36Y9qAKSQO+nkMI3SkkoG pokZb3hhWivMkDpXpkkv6ZhVrDv+UaczTeqqbz3rXvuU17u5DVJ/E62mVjs6x85Dspl3heZsksHP 60DznidWeEX1XdfOdrk4XMpSotJfjqeef8YtvgC9snwKYxiKQ6E+9u2AHebgBTtOxHF9k37HPl5A yvphABsMAeACfGY2aBTNn93MSBKkmWOTDNmHE0TJGiLaRSwUZC47YUpMC7M6s5TaMLWWbEJhmxP/ oJIOprCt+k6ofhiq/5SYG4Vtedr+9vNk0LkRylAs6AElKNGDGYiFiMTFOd4UrSnmFlFxOje6pm4+ XL/wHzDVXXrTNR1gCOAjBKDjoFTkrIpJLWDVvYrnqNHnpNHnVMapnZodkBqrZWBrtFpqlJ2v/crr hF2r1Zdr4Fp/9dpnaIsKQsciFVsn4Z0gBAjfGZuxNYcLuAC9dMuxVUEmcZL0RFUVAGF64ItZeZt+ +Av4DIzk/ccs3UHBcIEvFMgs4VKKVaGDoF4ABBOODRaP4cCOeaG+/dj7vMgQDJmMONOMGBzNGEnC dZZESMTv/Z7MXJA+UNzw+VUP/ANHnATU2Ju9/32casETP2kf9WFAGDhBGPyDE1DCITJiGKAfI0Ki +qlfGDBB+jHiIj5iD6Af+j3i+QVRJ7Lf+8HfzeFcQumc4ixaEU2XprAipOENoz1G/0FaXywdpYGF Ad6iAOKidjUdX2iA5BiGSbXK1Gmd55RRS1EGBJ5X18lRZMgUHGVgr6RdT22gNObGHYFgH5VgUPla UiGVDQoPVnUAENRBIayL3dXgDGLBdTAYGBSbDxreFTTBPFpbeiReEHJbffQLv6QSv1APWwHMWyHM LMnViTEMFbJPipAMYeGbQ3ahjoGhvR2TyqxMAL2MO4QTkzRJGtYMQ3TTQljZQBjcRBgcHWKQDv8Q kAZlhAH0QABIyZSUiJjN5DqRmcjBBPQVn0424iKq30tuovptolAOJVEC5SaOxfolJfsp5fqd3wyI AVIOF1SywFSKwfslFFbWH881DixyJWDQonVZkXCFxQCW5XWFii8mRlqyQAtwVxhJBmEwIASGV2bQ StdxHRutFwXWFKzxpU2l3U6FnQiWBuxgY66lIK/1BnR0wDt2iwvA4Lo01QY01XJMx3VglQsIQXr8 3bv0oLXNY1ghnlhhT/WY0hHqx3uEm0AO5IhBoYrZUkI2CIowZOlFpBR4IQ7kGw7k5m3qGCPwm/+8 j8UgQRkK0MYwFo0cic6AZEkeyZHsnpI1BEn/RhMkWERfIYEYuGQAKOKHUEmOJd9IhFxMPB8G7CSh EIoTFOUMCGV2CuVT5s369ZlSrqdCIUp9kkX7+ZlV5s1+2mf8QRpD7V/86V+AOtr+1SJY+h8LCNdY lmUu5iIL5OIHRCiFCkYADiNiFKAYbRrVxWV4waUytpSI2gqplegFfgYG3go0cuCr7ZSt9ZeqsWh/ neCM3tpqiB2zPEtSAUcLDlgNJFgd0EEN7M7uIJISsKMmbdI8ZhW4QJgPziOUHl6GiRWVmtU+8kv3 eBtbrdXkFWQTGmQtrVstqRjEhIJs1uaVSGRv4iYY7uaOiQi/PcD/rEwSwEj8VIDGQNMc5gjN/0BE n1bZBVmZ7E1EchZqRRQNOSGBAQSATrIDTJjI0wwWySxf1oRAOuQkIlJCAGhqULJnD2QnfNInVCYl RK0fVPZZfsYnfJ6fUyIUojQlooiFq1LlWOwnVepf/jWOXywOogyXr1KXpDUoJTRdEDXdVzwoLibr pP0iW05OW0ZOpRXjGInoYoSoHRyjrbyUiEIgqdGRqV3gXoIGDVSjqoWdBnagYI5dT2mjT+3oblCH eihBE/CAsk2BECgBaxRpgOEgHWyAsxFek25VJhke4aXHPGIYwlppfZwmWnHPewQkucFV+SBkw6jY 5jXIvelbm94mI3hhx6bpxl7JMT1AcL4IX/+9Hgg0CUl2ls746UkmmXTGLEnKYXJCQjA8iUa45D/c wDmh08lEKnja5EwwxfTt5CL+ZHb+pHsqJVSCag8MAtOK6lOKRVJS7SdO7XoGpayK4nq+6tWC4oIe AULpH64OVw/sqkeJbbAuKNsuqAaMJbEqa90IIIQK4LOywITu4uMAY7MiRgtgaLWyCoeSUUmNl7Vu 3TMmbmOkKDSmxoqKa0+p6Ik6bmh0q0yxqGAGEoy6Rq/hq/AkKfLUwRQ4Q6wp1XFcx+7UwCNBmLFx FSfRYzyaS1RN6T1mGyll6eI5XkCO27ixFbkVpOWZ2Lqpm8RQgcb2Zpqu6W2y6cdKJJweVkX/WowN JAEKZKTGEFBF5J72sgHuVdmgJud0GupEPFPRbJlfFR87LMCjkshI4M/yjYmlss2l6uQNMIETMME/ dConDmV2Oi19HiVRZu2rTiKiiIHWQiICL2isph/6LWhwjYWsiq0oUoJVUoIEhy1ZjmVwqW3bpp9H vW1ZFmuE0g2FBiAJl7DcDgYwVlq0TuhIPUILSEbgdte2lpHndNriTsapPYIFLm7iWuCKPu4Flh3k Pu4GjKvjAuYfjeu4bm5p7JSr3Qa2wOvpToHoCkG+sgZwbPEKEBu+qu5mcpLqdgsnOak8SpXBGizC qod65KOVmlLDQux+dGmARCFBno+6GUi6/5Epg0Akxyovmy7vbropGP6mYfHC/5isGRJQxgDqkkFW Z4HvoM7e7MXsoD7TzaJARujsitxAOnyyS/wspIIc1kzf9LFDCDgBz94vIm6q0qonAAul/lLtJBKw LUtiLUfiJe4yLjPwJTrwLzdw+k0wfhazKPYqg5JlBgfX2zYzCR+rCdMthU5ztPpi002oqvCtYBSg qjxrSQEjDLRlOCvjtBKutmrrI6DXZnSdiZZaZIgrikouPMMzqZ3oPDNxujpxrfFlb4ijHXTA+VjS jLraNu6GdWQLgWHmu2iSGUcH674ulKox4a1HWdmuwqaV4z0exJJb+UyhXEUhijWM5rEYbv8CMiEP 8kkHciGDSOfJ6Rgy0z4cJwHRiEQsGUFoiKAaHCVb8k5j0IykrNH0gzkwqio7aiiHyEmMspfMxKWm Q/GFADLx7CEyARBtqpQM5SSm5y13IgED0SESCgZQQqaOtVejJyNuwy6nHxClNS9f4gI78AL/sgcH 11/QdTIPK14b6wfrtQZgQoS6gQa4AQsYQbIi6zTDwDUfxgoj9jfLcDgrYHeFaKh1qGSXmg5b9iTA Crg2LoqaGqoVcWmcGoy2wROD6xELpmkgMR21ATSWLnW4QBNAR0DzGpFmcSLBa38pB3eAMVaRMVYJ 3oO97hhDWFSpR3qwse1qG32AQT9iaT//Qh5b9Yfv+kdBytUd5zHD8PGChGxJE/KaojRK59tstvT/ uAhxLjIkPJPMPBbN0KzMxN5OU7LMQJMO0Dd9zzfsVYAmI4E6KKITrAgon8zJnMDPksTPErhLwMn1 3cAqS3XxHeKmHq36He1Vi/UhPrhOIiIiGkX0QR+Hb0P0RV/2iR/5ffUhzk1P7jIws3Vw2XWLs+1c w7jb4jXb1s0Ia8A22HjT5QBgs4Bg+/hXgAVhG6CETjNYYPNiaHO08sXfTiuT00o5S+CIxgqVU/kF ZnYPu/OpvRHp0AATkzY+H3HisvY7p5qKunOpweiXs6hsgPHv8MAU8MCQDrSr1QCxLfQX/4NLsYlj BwxYEziYQ18BoJuxwcJBeUTpFfBglbrxG/ejt/3jRr9SHjjhpJMPwkBhHlOBgTBISXcs84I3qJ+0 FBgyeauD9L7MN2iMqhPq7t30JDOJDhSQesP6fYOA7Nk6JNRhylqEfpcTo67IAnhyKBN4ioiJyHHE pZanKi+7VCvihSuiph6thl+4E4TADcgJzM1Z2qBNtReFIZJ49HmFV1BFngkK+Q2KQf0QI5qfWr+t WqP126L1V8g7C+Q4JXzFD+H4sR4r3QC2EdDNjkeoX/s4ClOzsqolY4NFWxYgYmtopZnUkgPuZPxt 1iXjOV8211n2XlYguA6xlp+5a6QXDf+UBgWKq8m7c38hsWnDgMnnKxjHtp0HyDeyxriyhn+A8RYv ZnWgR3S4y7sAzyaNoxkTej0e3honnnI3tylB3lrJsX/4rqWTmEFitx4/zHeHOqh7Okrr2DGxAyKP 4XnDzMBVxHqLL41wpMzMdBqm5NmzfdrfOn7fLJSIgSKyA8+CMkfwTzyJyYDvIbLfACrzLIMvu4Zj eIZn3yGW51DoUw3VEOPHSfe9CVHkSQ4MlE/cANtQRVP81m/JzaDguEHVjVcIytwKygh/fr6n/tzu O1h8RQ4Mdl/HftP9uwEagQbcfhgMOQrzbVu2wIXibTcHP5P3rRhRfGMYf7VuaNZhXUv/0YDnPKMP aznHuxESj/wzMrFpe3k8kzn3x7Noh3kTr4bOZ0sHvEcNdKCLqgZ8qG62FKlz/Hm1lbEmBQ+49N1v C710XIGhG/qfI/dxIzdANKkykGAVPAMPJqySBw8PPAwf5pE4USKXPFym3MEYiguXOlS4UMExEoeU kSZJjmSUMqVJKVK8eEm3g92/AP2Q2EiC4ts+E9lMQNKnQ4cPHfd0DFWqD4RSEzpM6IMUFerQqCCS Nm06dWrWbFNNVKgwCEkAJzcWLLhxIt0JL27ZvpUL90RdtmxDpAtx42yIs3/5/j2L4UaIECcwGD5x 2K5dxochL35sOHFiyoYp5wiBIQdn/wzb9m7D5CSHE0w5RG/LEUb1NtesYbveFkbD7Nq1XWugvU33 bRbb3IQxAhyTht9ujLBIboS2Bg1uirMw7ka6cevSHzlnIX07DOswWHxgAV48ePPjx2t41ML8o/Ew HsFv8R4GfPv3idipv58GDCL9AYQhQBg2EFBAO/rbgAYE20BQwDZoKHBBGiaEAcEJ+7OjDQIXPHBD Au1QooYOmlBigyZ4yMOFBttgcQMX6ajBhQ5M3EAJEV1oYsQOsODxCh2xwKIGIYcsUkcXhGwiSB57 /NHJJp6EsoorBhLIyirAQEhLiAx6KKKI8rhjiosqumgKXzDqqCOQTmLJTTdXIumlmP92eCAAXgxA oh8UUKggGBNAyKapo5IqdKh7tLKKqWyyqQoqoYJSVIdAJ1WK0kmzMSQbscr6xwl2bkhHVLfaeosu Cky1q627QliAnRBAZYcwvwjjay/L2mKssboea0zXxzBYTFjIMMPA2MS2qcyyzpgNIwdMtrlhNs5m w8Ta1lBbLQfdoF2tOGd/0wBa3XJgARM3eBNOOHOHY2Fb4Z6DbrrnrLsuueukI487fdM7z7vswGvB PfDiC8+++faTLz77Fo7PYYYthGGS+hDUr0IFLdZwQQgV5DBjAyWEUEMYGqTQ4gNJ3niDGprowIUa lOiABzperJnAkmuWEYsCb6xhBSD/eewg6CCvGNIFJUp8GUiWmQY6SCV5VPLJH5uo+kqBCtLSIIQa wsNrhiiayKIpQrmooykwQnsKkeB80+2XGJGJJl4CMAAnG3jyCSihiDK00Eib+mlQQJnS56enrio8 UUGh0kHQvX/itFMn0qorJlLfWtXyzFW9K7FXF4BV9MKE3dX00+vKwFdeWSdWMcxgj70zY0GrPQTR cujMtduzZW012bLtDbjdMGFO3NuKO9cI54ZbHl7gnMNkO3rdlY66e7m7TjzjsstOPQ3+DU/8D8xT zzv5zm+vvof3W6/9AOE3MP4M4Rd5Qxo2lDBkAEs+MEAGU7Yx/C1oAyvrEY9uJDQJ/zGIgW2omdBq dCMRiaMGI2pCjnqUpCJhYYIcZJmIkiQiIGUQC1ArYQfgQLUfTclqVcAalrSUEK8ZBGxemsgdKDI2 MYmJI1wIRR244DYhumlOXpjbTXCyE3d8I1CB85vhFBWVxAVFiobryuHA0jjEYapRlAqUpsRig7I4 4QFOCFapSgUXmaixMas64wlCl45gLaYtmmsMBU6AR9TtSnWqc8wJVEcsXkUmdrBLjGYMg0jNJOt2 IVgk77DVLdighjnBc9bxigeudxnhXNtwV/TcIC7qaMB597IObVgQSuVghzssmM939uVK9JRvYK4s mH0+EB/zCQwGubwPL9nTsPUNU/9A8ekQ/ComoI1dSD8oS+b9SEayC9WnQwaqmAMPeDQTmYhj+LMY xjjGoxfBQIIiquCSSngFLCDpnBts542SpoR1JilISEKn1KBUNapdzYVZi2GXFkJDPOCQIgTVodrW hrYgDpGhUogbI9LxADvlyQZ4+wajsqEUQxlOi4wj3EepOBXDCapwVFRc4biyKEABRSwVQMLk2FGq mGQuVZfj3KrqeBec/tEteKSAHn2ax7rocY+A5OOwhoUZYSVGMoXZzGZA8xnMqCYErHGk7bDVmuFk NTXDSV5vakOb5gmHN9JbXnFI2RztAGd5xkkOd7b3vezIsnvfQ494ujcfgYHPlfD/AZ/7bnkf8i1s mC0IEBHkJzEDLfaYDxKggSAUIQpBSJkW8maASjZZ/kVoZUIr0TihuSEGFYhjG+BRg2x0oxWA0GU8 YufSPChPeQpJCdpUgjiE9LQh3fOeLcun1VrYhCzBMEubEIIMF/I1r30tTGMSG5m4oBGFLpShQpzT EfvRDxsMoU8+SZxGSwoUqBxOUIczL1AEB5SSnjRRTgQBJATlJ8kFIACekulcOIffzu33MHq5Sx6D 6tMAD5XAp/Nj6oyK4AwQUjKFhF0OCoPIZEnYkY1UDWpu56ysZmsbnFSNbjxshOFsa1vFOWsoh6NK tMYrlKpMpXa0t51XyrIF3zGO/177hbD0LMx84DMPL8nHSxjwMj4qIOwj7IDY+/THsv45GYAsJkCM 9QeaCaIQMgF0zGuGSGhCg5nHPEaDH+hHZPjrwAY0VMDUmnO3GexAkUQ0QZjN+bY9yy3SYDbPErbZ hE+LEpX4WZCD0GETW1tuDcNGJuiaiSNoq64QvRC3mdDNbttFgXf5plETbNpwINi0ecHyOE+Xl9Qr paIWs+I4rJAUUJGTXA/MQjm3yIWmapxLG3G9Ky8EWMBCHTBRUXfg1GWgj4AkdiAZ7DoHZ6bCoNGM 7nKHLQ3/TlupyZZyWMNJDZRrxMop17dJ6dbdYJuU1lulBsAxvbnOZ198LY+Mu/83nlzy1WHB7KV9 xnPk9rFnmIjtzyMCFJ//UNN/lqUsZSHrPwf9b37UrLKNZkQidRZwgJtVpsZgIAQslFa1PdORy9RZ JG3GFmZxzm2QcpvnD54cg/dE4T6B20+sDRchdABoHroEEYkQtLllShsX0PToNzk0JuygdD920qcK /AS8VTHcpoGCXvSal+pS93RJoRL1RD0FpU0MSxiRkCf73nfWtM6jTe343zv6+qdtB/Dbf+3rYDem j8VesLGTumzMQHiRnLkdtTDx90VymMMf/qpWMVmbHIRyk7zpzSfL3VbumHKuMLZx+Pj6vSGPZ68B W4/4fhwfIA/5EUE2JulhYOT/+zCWsU9WZpYrZrLXO7ZjFZ89hSCboB61TGgv698ANYbxDQQJQQVU AjnLybIeNa1n5Wy+PIdvTnnCDEjwVD7KfZTCFOLTalcAA6BpnqWDGJrQXrJhRAyah7JZJLpqEjpL vACTHcjDTjfB26V/kmkofpr/nm51WFiKpdLL1FhtKhgFK7YIca6ovIJBLFDgpcqivtih7GZq1izQ Am+tMWZKwNquAz0Q7uRu7QxMwYyN2Erw2AhJ75jN75glW1zwMwivNYpnBmljNVIM3HaDlIADOXSQ O3hjO7DHrapjfFig8ozQOMpDPPpF3n5sfYJJr4Zs9dBn9dzHsODj3+LnP5DJ/5oqLrKorLISi38I Dn4IaEdI5AxPq8lwD3+UybRexIGMTwlWq7Y0SEdKzvnwUIJK7g5v5M6mT0lQTmpKqIR+y2rAwEqE K2sUAg/ogA6W69ASTUwyYhIV6v3kJG7YwejwpB8GYQi+AQUOR1ECBeo+beo25RShbuk2JXI+bdQQ R7xI8Yrgi4pGERIasAIqCglgzQlGZaYq8HJQZcDw6y14DcA8kAN/yhiFqsBMR9jszqiOLRqjsZCc qjOardmoxTNQg1pi0JK0ijfeZVvAcdvk5dvMxTpMTDm0IzlU6QOuo17mY3u8Q/N2LDzcQ2BsST3q sT6ASfTWg7DIB/USJiANJP8/qKmZKmQNbe+YEnKa1hBlGg6bhEYIOoAOugwLLoSy1tBiaIRCjK8N VmDN6rCCKsj55jAP+7D55oyC8CxI2gz70qmEtOC3vM/7qmQgwEAICs3QEqKGvIaggJJMMoL9LJHo jOgB6CaJPnEfxEsf9o//Nq0CVlEqozIAVZEqqVLrrE7rnEi9RrGJlk4syEJPzKG+nKDs8GjXYgJV do2N4u4Y4fID3a4Yl3HuoBEaTbDuFuzuQmDBVNCR/O40rgqSsoUwp23bapCshkNcjKd51NHxnmN5 sgcIhzDGvsc4sqeu/kXzklDe+oo9guze6iMgCXKwnlBADAvg6mPgqOk/AO7/IRmOfrzwfmBTfrJM IWEPaTxrN2kksS5Es0bEQ9TsRXomR2REzsopJLfJRubwJJ2Pg6CTg/4wEAdxEAsRuGJuuMDA5hJi ExzxIBANbMqkucQkTd6PEYhOEyuNu1Ag6mAx6lIxLORz6QAwLOVzFeVTPg1w08BiKtyLo7SivMKy AvhEjHRRAleFLRWUGI3RpxgUGeMyQnstGesS2EYQL08wGhdjL/vyLxVJ8CoMwzbswy7pG0msebat ejYJxHoDXZZDCJHQlKpDrsBH8/QRx94NH+vjrrqH9Hxpl/4xCoWJH4kJ4JRsQGBPmWgzDMkwy8Lw SfFnZVjmCnhzZ3CTyRKk/wMmq0YcqGeob7eGxPhspIC6VAm6tEvXDA/pzCWhc4NQzjqx4ApmEuYQ UTu3pgocsUsekbl47qDW79HgRm6OztKY8ieqAirzswL2ASu/rj6nEhWDAT4JsIq2ThZNDYwI9AH7 wRzUIdYWIC5+atfSMhh/DUIl9FTncsDs0i7srlUzFAX9Una0EQMEEzW6xdlqpxs/jMQ6DDXcANx4 I1jbanmI9dxMiXrsanuqY3u8JzvKQz0QhnxcSWDIZ7DAx1qFlN+IVD5UYMhoQDWJYOD8zT/I0DYV MrKqLLGgNLHGNUPkybN4D4KssEkF5MzyBw7jsLb01ba2CQ7bgJtSK7X+Ff8lUTI63zRqnoYQsbNq DtGFDjFLxK9LNsEhlAuH0G/noCsjADVudmAHNhEJuOsbQnGkfuIb7FNRQdEEQFEqxWJRo7I+5/Nl 95MrTGoUrUiK9oZlK8AdCtQc+gHWxi4YAUwt5xIEk7HtpOAYk3ZpJdRoK3SP/KhVpRFWOZRDZWfv +i53WhBbUGPaXONddtWTSOw2cgBFq8eTWox5pGM5xMc54sp79KXG5mozPc8eOc9gpjU+ArIfe8kf U08gSa8//A2xjvT0nDRJoaw2FXdw/UNA/C1CcuvN8olHcO9JBWRIWkAF0qxmQFKCSqREyglf/1XN zJRMP5JMCdZzQeglUU7/nZTkded0YWEIhhRCT/c0TDAWh3CIKIVoJWaqY3lBHbSLu5iyUaROZXui Ar7BHeZzecPiGy4qLE+RZU3gTyKVKqHO/0xRcLAOUMbr6xoQBQYBJ+jLLB7ALkRVVNtOfUkV7jqQ aZP2p+IXLhtU7oBqVaMW7/Ty2ACpL4kNkQppVp1NRFUDBglTNWrwk3jVCLo2RcsFOIBjW8KN21ZJ MutlMpUVCbGjRusKYGjs3vINNGVpCsHnNN1nP1LTCsnVYQQ3C8v1ym6v4cS1IMm1cf8jREZknbpM nKxw4ODHtAbIdOFQgvhVDtXMgX4AdeHwB/r1I7l0m1BSHGaLz6rTdRe2/2pcSCDsVPy6k2IPDUyE coeGiOgYwWN5AemS7njN66LCwmU/UVGXzmT3obtAMRhMNmbtMyiw93ghJ3AM8CsF5U8y1QbMoSxg zSxGhVR5LVXZLi6X9iUoAH6Pke3slxmPSsH2F+/8l9hugNj815EiLJFAuZG0JdpMOatGbMPQZVuW R4JZGV20o1ycI9ysI5Q+gG3jSjrEQx5ptMbIRwOqNWBsqQV+eWGC2ZeAiUiNLFz5kcnGtVsBpF0b jg1r03GV6TUfF5ut2SPb4JyGpmVqQH4YF/esVEA4Nw4rSIr51YH+1V9LN4mJ80z7VYKYmGDf9J6p U06bQAu+DzsPkWGJq//8GPGLbQh3cXd33QY9I23S7I94yevTeMIdCPQTVfbSlDeilfd55bM9VTYb 2pNlUXEAvU57TYqKHmdAHRAnDIC+nKClJ3AtI1R96/d9I/mnGEF+axpVnbYuR9BV95dqc4CTg3rv DAM0HOnZeAcGR5Twtq2pedVdVOM3lkc0noPbnMOq1TEIc5lGNfh7auw85i2v7s3degla0cc0TZg9 unVcH2Gta5hwC3J+pvlJfXiFoXmFvxVAhuRI0FAJaKBbSaCF/cOwhqQNGwRg7awkbyREiPOc2blm 4hl1C4iJBdaep+9NfyRh9UlhsxMnZ5c79/QnGYLnyERM4GROythj7Sb/CWxgH0QWPrNBZBfVtRVV jt94jtuYjj06tjv6okBxZauSPqFSK0mx6sAoGPhET5DACejrH2KqLRT5VCmZpnMakiWZfo92GS0U wRKMVTP0VaMxqD152ZjF71pD8C5sqTsMW5y6Ns6KlELJvTtsHdWWXq4DAmbUOeZKPOT2e9zRO4h5 yOSKWv8lCg0mmUezmQOXl1SAl2gArh98m8fZNsNwwo0swrt1mVGTBgwrQmprSIKGZRTEsOD6wvtD S6nMgSJkiKfvDs95zB47xmtGD9q5dLt0ERpbCRYhD/Ps5O75dQlx+xZ2uA4CDMBAIQgNIgr6oPNA Y1mC6CZtE/PmJ9AL/3olmif4ZFH5ZCkvenmXDv+Ud1HhWGVNgI2t17zO/E+GmxYFFBIGlE/4pCxj DVQ+FaY7sEEXGc9r+pEjmWlxOi4rmad7+i5/emr/FzP8MvCejRsvjHdi8DSg2lej7Ve3DYIZ+HiM Z1uQQzok+DnW1txmeYPrilk5WAPmo/TuSj6gUGBaIK2zFbD47QOYrK3Z46/hY60Pi8KvDIYVklzz +lsz3K4Ny8igmcpsZM+ChkbU2j/C9T8M6wM6wA6g2Q7Oec0U+/i4ya834AcaJIlpwK/NVAmSOImR WNxt3ESYeGDtGZ+ZBMihBAxm0hANkbgM4sgH+nZ5TnenICUYod871v+Mke7SQBG9cHuJBN61UaC1 l/cTbxvLTVZ5T1Yq2/O38ZN6Q/rMp47/JD5Tdza5xaC5nXsB0mED11cui9ZU+dy6/Ry7Gfl+LxRD NVQa/Xeox1uUAROpmUW9CY+Bd7XbyhZaFpOVeWM55ls5UKw6wME5kj489NttNdgd3eO/gdk7gsyV fAxheizIWl302AOYaIB8+kPWa13JMteGGzfCG66yKORxAcSw3P7CMxea3Z7Dzdmc5snLrowISGCb DWv4AlvKVrycbItzYVzF/bpFXkSyEH/cObd0xX1Mw72eeRyfMXufr5hhtbje8XQTQnugdC7fSSJu jMiMG1pvWMpkvRz/y+F8juF8eQVeZRc1eWPfovNm6ZgXZmF26dS81bBXZ1sKzjN1U82CFyjnU3sK aSNUGbM7p/e8z5t/5e9cVYkK2A7sGfPS0D352AD4BgAYME+DG0mZG3VV2yjpw+ablZu6lZ0DxX6w rUYJruCKey6zrthDPXZZM6X1mEFzCk2Tw+l+PQCCxgcYNGB8KAiDRMFHKmAQofHwUUEiDx3SmHjx IsGLFSsWLEhCRUOFB1W0oHGSRpsNSmo0qdGhA5YOSlqcPKhQ4UkYHUQS/LFh5YahLJUYNQojaFA7 P34wbUMjqJ6VbYC2mRqUhhKtWoH+UNJGydejYo1qOYrFKJa1bJtg/3HbpMmVt03AXAFTNy5eMFXA 8KUDBg+eTXQEG76TJw/iO1Nw4JDCaMcOdrx4Geg3BEUFEyayfauwD4W7byhQhK5neghp1aZRkCZt wkZo0hVAozABujbu2tk2V+jdG3dw3r+FG8oGorNvd6WbI0ESIMA/duxOpPPihUJ2ChSkcP8O/gQF 8eTBc/eOPj168+y5lyd/Ir58+RlO1Ldvv34G/fn3+8+AyX43ZJBDBiEcmAMGOYSwYA7bLPiggxJO GKEGOeRgRBgSGvEghzlYyKGFIrJghBsaGEGiBhqwYKKKGoCz4osqPqLiBzNqYKNBGjzSAo4waABD Cx/QyOMjA33AQv+Qj/zYgpFBtgBDkFF+0BBBSgapgkRYwpCllQ1BRBARdhCxEUdlkgkRDVmqIJBP VLJ50kkNqWDHSi3VwBZNF8WJUp8nYbEBCQSt5BRVR9VwlFAr0dBUnYWqtAGjdUZFFaUb/KBVWISW 9dVYR52FlhJsjaqFW2vZ1YQWeMXVRBV19VUFHn7FikdhhgmmWGKJ3eGYFOnssIRl/STh2j7ZZGNC sTaQhgJqKGTW3BDMMVesa6W9tk8F33yT7GebuZYNCuF+Ewxu5v7mG7LpcoasCZDgFkxtzT07SD/m BODEP06kcwJ22Xl3nnbhuTdeweJ9l1533QG8HsAFf3fwe/DNRzH/f/pd/B+B+xWo8YEMfrwgBg9+ rKHICVJ44YMqc8jygxq4vA2HbhgR44kazGwzziiiGCONNdPIAo057kh0C0nuiGSPUGqwNI9QfgCl QVIzNJCTPGbJZ5RQVjRQQxTRIJFGD10U9kZkjs1QQiY5lJCaBpnUZ0lRseQSTDK1wVALJqlA5U0b 1KD3RZESShRZKygF1aJVRYXp4G0wBZRKKjEFKaGagoX5WGMt8mmoo75VqqlwybVqXH29yldggd16 a66IORZZZcMiMcFtyFobWmmoZVY7CrX3jntzoQ1fmgnuVDCabcYnG25n5H42nAnBeCs9ZyAgl827 x3bWHLU2ICFG/3TTsXMddgGv154X/cr3MHheJCwF+u1FbLDBE9OHH3779Zdx/xsb6LEA5gATIdhG AVN2IZR1aIEJZCDLQCQiDD0wDCriGQtUdEEIsMBGK0KSjTaII6IZiWlG+8CQmLYjqTVpIEJSoZOG 9KQl8QlKNNSaRM4WJosQZCdjQ9NHfLgnlIikTzTQCUpIwKe+FcRORnHBTLAAuL0d5CZ96kCfCLIU Qx1lBUpAXFQuApVJSc4pjMKU5CLVlEt1hStbyZxRNkcWJYjjLGf5nBJStZZUxUVVqrrLqlLXl9TV ahO4Eswd8JCrPDhmBw9Ax7CIZaxtteYbvMuMJZ+FSWn5DpOvuf/WtfZhA22ZRl672Va4xIXKbxzP Ne6oHrKyhxwd6EOW7xJOBTQzr370IDpOWIB1srMdhc0PmP2qH3jgp7D4JbM9BLMfxZ6pP/1ZLGMc C1AAEfQxAyawQQo6YIIihLIPidNCFBxnzGLmohTRjGbqTFHN3OAzInUQhDlK2o9oBCWh3bOEMOBR P20iNahhKWpRExSZBKUTi6Tta2nLCJeCmJE+semhfIIbn/wEt48MxSh1ewlK9DYQJErRBWo6SVaW ApQ4VmpwkgPjF6EiOaZQbnKYelzjJNfGTHFKCZzjXBzTooXPvSWPdGEVGLBQur30RVZ4iBWtWLer x+zAkUlIwmj/TEA80sAjk6WBVmbc4VVMhqZ2YCVNaEQ5G83s4zW26c1axeWbbNmSM++SpV1pmY1y yQt5KPieLqWzL34B8zuMEOZ3siMe9bHvYOxRj/zmR7D3ODOa0dyf//pXoAFdE2Q3OJmCDBih0KLM QypzkBFCJE6aYYgFGLKZzWhWs50RTUYhxBELSrjB2+bWRkdimpOeFiQgQW1JLCTulQzatUccNEpS 6xNFdggmgUCUIIL6UuCq6ychTvEg3P1o5ZpYtw3ADSdxotLfMpoUSAGlKEqww1AUJ7iLiNFKLY2o U8xYRkdR6ottHEtY3BhHtXwuqHosVehUZdRWwSp1qzvMYRKD/wMvLGFYxUqWtYZwyUtuFcPUymSH oUUa5pjVWqpk1jeylQ0bdOtb2bolvNgFCX3MUgc0tqs+kmPLW94SBc9BggGiw44FCHawhnWfYq1D MYEhjAKFXeZjmylZaD7TYv3hn384dmUCYRObFGIQNxEoIQttaJymHadrzzyzC5oIZ2644AeNgCSi 7TaE+7xtnZ92W34OCbgC3bPe/PnnnSBUoXwryEEs8hFEQ1dNjFaBQkYSt5JmV297AykY3VuUl7ig JlTqmxRN0oSQmBQqg9uoErjYhkVJjr4OzYgdMpK4+pL6Io1KYxrDotOv/NcsSqBjHUUl1KHukVV3 ycusGByrwP8QxpCHkcIO1JGZfbSSOWS1ZGYwMwgMY/JZX4VWs3QnmuC9ZjTBS1ZtznpWc4eGM+4y wYz14YN76EDes2z3bqQ3r++BD7Dk69e/ioxY7niBX0gmOPvMo8yGMRPK45GYlC8mzcv+LwQd43IB t9wgTJQ2nGLWgIY81DLVRlBFOTAROmV7wXWCEIQhtJE8hSbcHfXIIBsMqAqbZBPjAhSgLKShcqm7 wz+DiUxZkm4RHxrEGbZJiJNuk95sYhIhfYlSHHUJFrQbdSR2+upCijWpqcISpbD01RFlNUwjinaY qp3WUHnUVjb1306VZRGg6nWvgz2qK+yxdMYO5FIb3DrBMOL/Af04MW66isl+0EvbQ1D8ELL9+Ax7 uDS9Y9bwbDBJT9LGNKG81vE6c6wZy9vGOkCOPjhTAb3eMhjzQkE/evxjJ8gjPtt5rHzUxy+CGzzg AevO+4TpMPbQT8rxuU9l82NljWWZ4gu6ZoMu7iAvD/BCmABzac9J5pGfKOUVTJE7ceazm8XzRjbq EW/viaOZ21PmBvGnQG2Sz52EtLlTFEg/Cw3dkzyE0m4rYnYhKlEjsTdw82k3IRI7YSks4QJNABYg 1QIh0WmOZgc1MVFfJHZFQRWp9hEasYGt5lJlgnZpxyhc0RSY0ilMsVNlcRQ+RUfANipw4BZgYGB7 V2x7URfH/8ZUhjEOiHQHO8ALmZEsGQZ5jadtmOF6GJZtXCUamcEsTAgP3/CEzcEsojFixkMbtpFu 1vNuNDZLN3Zj7QIcqfctfNUcNqBvSGAO6iB7xbRMh6UdSBYC6ZAOGGAdBNc+bdh7C2c/Dddw0DRN VeY/WGZNIMNZDfJ8oIVAEeIh4nQhFuIy4/RALNMi67QiNPMIKgcjs8VBuOVBRUMjNNdCQrJCMeRz N0d/NkdD2kUQ9YcmShcSISgnGLV05SUSnhaBQkJEVNdEW2FCfMM3EfgBTWATB/FSNFAnhiJ2X1QQ bNJ/zHgRc9JoXMImKrB2I3h2PwAVYNEVnXIpKthTvGZ3Wv8QVGthYFhQKqCzd3pxgwsmSKuTB4Yx VZxnSZhBj673LPWIhBgWeZK3VbWzYa7BO4gHPKAkPDt2G7f0SjFmYzJmAjrgbg95LrUhL6x3Sx1W GmbYY/hyHQujTBCjWHIYhyF5AhhgcO3hMMH3MFF2P/NBZRB3WYI4cR7zfBcCfeAEZhLCQNvgiEaQ A6x1IicnIuu0DSYCW7CFQenEQUDTiSVUNErjNPtkEE/zlFDDc//UflAiKDwCNlsTJYJyRV+DdP0X JxmldL74dBb1aVDDN08HRkqhBAsIFp0ml7/YArw4RDDwdUQRdqrWgRU1JyIxjX8pJw81jWhXUzQ1 glzBON3/qGs85Zh2d3fjaI6gI2ykUyp28UcLxlSEdCs9aITXlo9IgGH0CJqkCXlJeEmZFGJfdS3/ uEmuYRvWQm7cgiwyZmMNiZtfCALFES/AgUo6pmMW2VfPgS/FFD/x02TjMXBxeALsgAHkQ5IYQJIH d0y1t3AqSXzFV1kYE4gGomUfEwJOQIgDBDI54ATUN2YV0ogYck6RGDMpsmYqVyIncokyAiOd6HJM A0L4pGdAgiM8InM1V5VNoiQmISgPmBBvw5Y4IV1eSQQnoRNoWZgqETiAeYCA6WkQ6IvAiF5tKSo1 0Aa/2GlIRAJUohUPSCZhpKJgB1+ESRDMGDiuCJhqYqFD/zSjhlmCa9QpcseNmOOYLXh3bHGO5iiD MJgqR2WDfqGkspJseLCDeDBhSUCE/WADjzQsV3qEjpdtSUCaXMV427ZJqZmawMNKCLk92SNLEOmQ 7dIZ7BKRuoGQqyeRyGOQGbkv7xM/OCBMiGUdGNBLTgCoN+CnzBkfd1hk5jF8kzVl0pR8/4Fl3rkg 30mT0McgnyV9Gyda4tSekAiUQKkzlegiPnNBc8ZbIPQjHtQ0QuI0TyOVfBaVr6qVWJk397cTaYNQ jBaL0pigFpV0vHqWHAqsZnlpQwFFWGAQEKiWUFOiTdCL8nVGYbGXLBVEByhEXDKYBDiW2EqjbBKi 9WVfjP+CRrjmRnBkFCxod0IFg6VyBUaaYHjBjqrDOkuADlx6pVyaBHtQVaRpr40npZCXeJKXYWGl hNtGVlK4Ge4GAgx5Y23KbsjBbnNVLvHiG7qBAhRpkMOJBLt0pwvzGMr0kTfADjfgBDcgsoDqBNJp cIWqhxBTP4Xqh/jTko1aIAVCcZtFiAdEQA20TYsIIg/iBo/IWiIntBbSTionIzRjIp24W/tpWznH NAOBQqOIcz3HI0ciJTv3CAd6JHyzimgpXRDaNgzqlTDKdCB1oX1jtnMJNc26Eal2RyDaaQ/4gMpK AhtgrScRa5OCONIKjTMEJxcqRPwXo3AiRBaqJmcXayb/2HYmuFNh8Y1k4WukkirrqneqAgd6p47H 1qTw6oN7UK/4Wq9WKqWYIZr1iI9a2njcFm4A+yzM4W3F8g2ecSxpimMPqy63iy4vxhtw1RsUS5Eo MAg85mPqwG9seJzegXsjGajLa7IoOx8rOzAS04csqZ0S5z8DQrNaNpPjOTKi5b1jxpMiEpTiyzPd 91ofVCMrl58hxJSlqn4bFH/DCH8BxWdEQDX2ZxKHZlBfe0VGVFGxaKFyApiUJmoksaEHrKFvkhJz swFQpAQm9AEkQKISLGoPbKLFCK3rFWvQRYASKieetjchMYCURq02mhFmVFP3tVNdURaX86PhGKQv uAlY/wCDdwEHmJmkSgqvTiphvDCv/YCvQXyv9nqlVToEUnqE+/iv1oaa/9rEXloa5aIPMcYZp8ew wxEcemUuehWG0qMbv9scSYAEr2cvPaCx+2Kcx/mG6QCyJasvb9y80plk1xlZ07uox8edjjpx3ylA B6JNESJ92zQhIBJm2QeJP3lalMhOMQIBLVIjLSdCdGY0OcdCR9JCwqUkVmu1XKvJH6VcB5pdJgq2 fxu4bfK32UolEXrAqbyhJepogYOXUeHAbSLBD+jKJoQFwhpTivNekRJRF3qWweyLCVxpvnihA1yj zghTTTGCJliCYSF330h3vCaO5ggHkstHd9FHSgVIfv/BVLGDDntwGQZwr5+7r1fKr1MaeZ+Zbf4a eagZefe4bWu1D6D3sOzmG3OVuxErHOcSHL17sfXyHAbQAwYgBmVM0PjiBGkMMMpbsvmSL2HAvNJJ h4uVktGrqIs6Tdarx8z3MTnLvTmgIQ8y0hiCkz1pWmEgcj/5k0SJQUh7M3C2yI8AAZEMyT0yQgKV fjIncznHqnxWtVIzaIJCjH/maE1XUSXRNiWczBpKwMO8yrdszAtMN1jQBiZ0yyQawUqQECYay2c0 FNgIRndrzAosEiEhalDNyiL8Jsns1t/azF2Bgk2xU49rruM4jtfMFjAIB5sAg0i6FzrMVGDACBKG Dgb/sAfT4Ln9MA39AMREzKWNV6X2mgTZZoSXrY9HSNliXFWuRyypWZvXwy6bMT3pYtrnos9h2Lu9 yxztrG8G8Bzm0GPPIQbq0AMbq8bqswALANFOINEQrS9xfAIh8LyJ2rLEZ3wuKbP/wzHNN54gMzKC /L3hW2YjJ0Exo8iKzAI13UG1xVvp60F55lv/eSSVfHPDRYo+RyVZaxDSxULFfIuBW2n+l61t0mny Haz57WhK1BB2AkUjitURHMF1idVYFF+XwqIc8ber7GifRsz6LdVuLRJtIAIulcJl1BR6QNd0fTmc 04LiiNd5dLl6RBcIxs0MFhiQURniLM5JEM6MPSyg/wvZRHzERAiaj6d49JivkT0sQ2AD8Wwa7MKm xaIt2TJKqZQbqITa+VwBkCCRfZVtz/F6sj3bs03l4bPQeOod8fGcIvvGlPAPvx3mgErRGEDcFh1l x40/yJfHHK1lHaO92QTd0XeTG7eTh4zdRPsh8GmUOOMicRbeSUlnTelbJZQ0rtpCfYaVT2N/RO3e /IuVbfO/27rgFqqhac3KmQ6BFHyLcDOBLdEGJSrgJUrqLYAFFMyMVpJqSkFGGoHWDD6isC7rr67W b91oLqUSmCIWO7rr3viY4TiZcCCOqXK5MIhUMXjsgc0XsiIF6/AAvLAHjuRILe65QizjQ0zEl43Z RP/o2VY62Y59xCjwhJvBpp9Rz9pSG97iGWqlG+Hi7qctsadUGq/3PVV6hmZY7/XeY7edDhwpBV4Q ArxtsgqtL2Hw2ya7L9J55kk2fMhdvdupxxoTIB3zfCB9iNtUWiDHnkaACT0rlKf1Mkb5Wtv3AewE IxpEM/iJNCgkNJQcXMP4JCukyTY3aI7W3tyFlgdaaGlNwpQWOG9i38YMmK8OjK4s1RzKjP8VKBFM 6qkcwUFB6oMSU4WSFRqBzBGo1cMM4HzD6Y529A1Owm2dzBSuAs5cRiO46zwKFj7l4b0WVNVsjgYm g01wzTKYwzoMBhHmg4jN9/d6GY3dD+QcxOZcVY3/p+OhC9n1aq8//knbg1byokpJblbobi1B7mJz SrHNMQhiXKXDaYaa31c85vnPsUsYoOVvOLII/w9gDqgSffBhUObEvfDQZMcVs52NqscFMojPV57Z hPE62yFkxjIfwjI7A/JpRom1RU+z5TMuZxM37SNVk+ivakJXyV1UYyQ3kRBJFDeFZmll+cFqIva1 yPVpC+ubPuAH3AJ0owS/eMsQjERKQOoO9WrZqJhQ0eDKClIitelzy/VcDxAkVHwYSNAgiRYCCSpU 0ZBgQ4gNaUhUQeMHDYttLv5Q8oOjx45KFolUokSLSSVYVGKBo2UlGC1NYIJpAofmzSpgwOCRwmgJ /y90ewwIFZqm3x50SfYk6WegH9OlT/tNZVpVqlWmV68iGYJiHwoTJrJ9A+uOLFkTKCqgUPt1bQV3 Fb6aqCD3W7BvFbLphcsWxZBBgJMM8kvY72G1KAZVQGIDiZgAGE5IoUzhxIIbTjI74cw5jBMmnDF1 7oxBcogMGU6sXm2Z9evVqk+opj079e0MOW7rTo0pdY4QuoMP3xYixLYcyZMjN5IDOfPnOYxg0iDd iIbqGq4b2abd+/XvGlhAwP4B/AcN6D+wQK8BBvr371t8eDR//vv0MO5/0M+ff4v5VGiBBhLeo2FA BAcS8EAGE3yooRYiktCghgRSkCESDspwoA0pfP+IhjawUKKNDD8o0UQUscgQAhpgaAMjEGnYoI0N ZIQxQg9VYOiDhXokocSCMvwRRQVzxLBCCRtqQwQYNbLoSZCiHJGkkUYySQuXtLhCCziugAOLmMKk SQucdNIJBy92ACqooZxyU6mhlJLzqais0qqqPZpK4k2qkkiCrW+yySatb9zx6ysUDC2ULLb2WYuu tRyta61s2HprLbYCQ2zTuCzddBDHIJOMgspOSCezGzYjzQlM/nHis8+cCMEJ0zAI4YRbYWtN19hm s81X3HYTVjfhhsMEOGSTOy6HMJZzLjkWnp1Ou+Y02KZa7a71zo3tWDCCBfHa0+AR7B5Bj9xx0xv/ Vz1z0yMXQPfW8y8+Ht+rbyAYCpz3gwPzHZDfFvwVcOAIHRxoIgoZ0nFhHBf2UCGIh1R4wDZqUGID HiXm0UQSMDJRIhjsANGOH9og+UWMIiwS4oQ4zpjjhH6U+UcOdZS5ZoFyRnLniEAUYaOMPPpo6I9C GukkpLFkCUsyXQIDC5hkqkknmXJixCegiBoqKHSOirPrpLbOyqii+ul6qTz7mcZrOQ2oKtFA92H0 q28YJcsGRNkyC1C46yILLrLw6mtTxAyNK65LJ52UrcaQeMyJyUpNlbNUK5+cMwwyw+Cz0TC3FbXU eH1NNmBtC/b031ILLrfhhkMWOeWeVQ72aqVD/6667bLrNvfcyftWA/KAx05d9ViYL14NWiB33//m q/f5/Qzkl98CD04wwo6vp+Ghh1QmiEAJBfLe4SJ11PBl88unoaQNbEYxYwh4xGLjAZvEiMaLUoZw SPMX6nBDhAgJRTLjmMTSB0CaJXBhSaKIRIAmNKGFBCSLoCBJkAYmpYGpJitpwia6NBOZnClNvFgT m4gyDaGYjShBgVMKDeCmfqThTehoEwzd5qeufGMfdPGKX4ZgqK7Awy+FQgFZzNKpHhZRLZhCnN70 Bhe5TApSdQlGBapYAcNgUS2gapwYIOcFHEjBMhj4R2YWEIIzyqpynJmVZsIwqzbWyji3qk1tev9F mzoGizfESp1vgMO6HNwgOccKTnSeVZ0cVOd2icyBt7KTyGzljluOHJ66gncudS2vBclLD30A9MmA fSCU/KmPvaKnkO3l6z0/ctC/BrYgfg0sltxzSC0horMd1cx/EOPQxz4mEYttT0gCRJESPhC/JsHA RjOK0Ysa1ksCvk+AEhvmAGdGTZr50kK4XJiFGiKChvxABRvxiEUguIihkYQjVbrSSlriNDh8CQ4y mSfVzsQINa0JKejgp9i6NpS1takpMlxhU2LYphQmpWtZ6YrcKnW3CfyFcF3pyqbwdpjBGQpTltKo 4qxIxY9eMaSJKQwWHYMEyJFKjCegHDtCkI7/1cA0BJ/TjKxEw8bSpGOOuIlNHYEVOtTpMTdDdV1R nxUcZz0rOtOpne6oFUneeQcCbkgPuDBZVfW0gD3Ge1e69NMuczXPPqf8j3+21yDrEexACrqQLWkZ kVzK8kIQK+BBYAbAAW3gYkOKAYriB4EY/MAOQlImDUTWTBu1qJZEMtF8qjnMx0J2mgW85s1m1s0F MhAi5IwS0SRIJaRdCUtN4JKWYtIE0j7NgzfBAT5/QkJ+ImWfsjXhP2WLUNy2iYaxBehTGoUpikqU osGt6F8MRbchJnFTjkLBXkDq0SrShS57EelHJ5XFxQwCCZRIh0rHyJkzmiqmprqVrWx6A0xk/wYT swpDrT5nnNv8yqdB5SNvMuDH1hEyBxiInSFl90gAJ5I71brWdag6Se8M75LDU0+5krdJeInyk+gB pVZ5ZDwYlJI+/EHlB4gwPVhu718DYitBEiQ+CEGEQrds60Kwd6S6BrCtKmjDxQrS175CQIAb0DG/ YDQyGZksfzvSmJCCNEAkT5ayBLyZNhXITZ1JiElTxghnO9uRH2hhnRZMCdPAxBKYsAS1NQkhFlqb TxLCNms03Gc/kYJQNvOzKSvc2ptT2I8hRNQu7hhuYDQlXLYIETGC5vNhDNXDxbElLc1ViwmiG9K6 QMrRiktMXZaIBMbQilQUoMAC2AjT1+TqBP+nkdWszLs5VMfKNHMEXVBNN9TT1fcGxkEWUnOAieIM cpDQmV0jGYm77GzrqbnDDgSsCi5wYHVdnKzPuvTDHnrFJ3rOkw+A8DWfBhWoQNYuWIoLBj4Ulziz cYXyLiV7TZdVRK9t+EAM+kqC+PFVCcOMUWFfhDL9xYyxRU5ykn8UAyZPs7LXtFkCdSaCKDewDeO0 yM8g+BF0doSCVUpalsAEEyyp9ktSs0kYd4DmNKcZHfrkWsn5WfJ9GmDkJAwALwLQz6f8SbkUDQwO +/EXP1eUuGwprkQJ90RMZcMGllYcpKpYReceHdLXrYvjenACL1SmjbfygmUs4wXW5MpWo7b/aaq9 TivTAKfVQY31sHJDLNfxt9fLaY5yAoy760CyqbvTgBvIgy7yoIc9xEuPViEcYQnXxz/Km/C+6nMg V1rbxKj89jNJbGIVs9iWbCWyzSxv7siWr8YbEOC7/+rjdvv4fkCu0UQcQtcSTXaaf41fDFr/ehK8 e2ZLrmzBbQbOnOEenFJekkYeHkEprVPLF8ySS1Sy8ajZBAxhXAc7XhvylfNiDyEvIW2BUn2Wi1z6 ThlCV/bWfa5IZQi+xbOmdg5o9AfXLxpVy6Hrgrgp8qUCU9xL/LNhCI8uxgaDSKkYO80Z1rA614CN l5qjWnGCbUBABdyGMGBAWdmGzzmdV4O1/6HaowygNdepNeVolltTKg9sKgHjju9wJGLzjvbYO72T l0yaD/b4j73rD+PZJHoZvOY5ELMCEAZZiPcgGAV5JoWJsgdZoITBEB+ZvdkruO+5GAKJPXiDNxPR MSUArO/BiMJCrLXqkX7bmAzxvBUREh3zPBxrN3eTvYHLGcuCMp6RkIm4CCZ5OCyTEnYKLYs7vpj4 EjL5IDNjBC9YggegPj+8PjX7Q0FMs5dziiRoKBugKK5AAj9hRBvAs0cEDEnMOZ/TOZ4zjB8iHEtD HMWprmAwBOcCRSu6v6SrAPy7Lu0SgxNQKVwBwFXkNAEUnc8xr1ThHFhJwAZEwJn6I7KjQP/d8COx Qxb+8i9GuhZmaY7m8JZrcYNGGrACC49v2Y4GGw91QcH8GBd4+aQWBJD3GLxuNCVtwxeEQJiDESUR 254eNL0BsZAg9CbKwywoM7hsmkfI4hgF2YAZ4ZEcK5EcM6aMocL7ERl8WyzKsqYwbL120zHAUsiE 3EKF3MIwLEOJ/BFCuL2FqUgV2L0p04hx+j2Jm6AsozimcYmWIC042ASVAAObgAPm+zhe4MNB/MPo yz7q68M+BIqp6Lnxwwrx64dItAGmGAKuOMScuzk8QwGj9LlNGRyP6ovnKsW9uD/5I8XqWgvt0rRN w5zWgEWuHEBRK8Dg4K/RYEAGDIPPKEv/CBw73LCv1Dm7C2wdXXsd2XG7Q0oO7pAOuNsOI6CqqKo7 vzzBvNuqBoMw/sgP/3iewTMXAOGw/xhHCUPHxus2WmLHxarMBcIeeMSlhwm4geMRGtMrmdGxJvwr jJDCH8O30ksZu5qsvjomJ9xHhvwreJNCKeTC2gQ4wJrIH0E4M8SsjHTHiggnIvg9CNKyoqE40fIy laiJplk+KUiTJZCHn3i+mKxOm+SFm1wT36qH7sMzRrwTrVhEpHxEpBRKSUQCxZBEpFzPijq0xGAu v2hKxam/SRkUUARFuhDFphyEHuiulcIAWnnFrlxFAh1AXFkN07CpzmlAs8zFBoQv+oI1/z7SL6OC nV5bql+rlgGzluzgy2gsNuFBD2MTnnTJKvYAkGbzpHMJGMMcvIB5BOvJHnQciH/JF3FrmG6zEJXJ rHGDx24yQ91kMnvkF73SEdGEPXD4gCj8xzZQJmW6N8XCHpdJvR5zvSd8Tdl0vdGENxxTyDB0N9H8 kS8cuIKTGYTTkTMlAXCqSHASgZ8hhB9oQ+L8gYmbONDKoKVhCZSEGjM7syVYAnZQkwdwPuzEzp94 gOl8SUMtVJhcAkEtVJw8RLa4OTvZE614xEesiiQYShQYyk31k02dxIr6s0SJT0v5imBQi1S9IpFS OlKcP6mkrlP8REujhFVcKVfkNP/jSv8C1ZXTMI72CoFcpISyZFBb6cXU+cUKLCoLTSppWapFMoIB k1ZriSrwSBdsxaTBNJ71gLAU1Q9qQ0x6qTB0BBj+WBCEwFGGucydeZCFsKVt+tEDsrwgNSCOEKYu fEgImLd4+zEYOSzTuxAke7dj2pgeW8hjstKFRFgIoE0u9dKGHFOAK0MdIQQg/U2e2T0aAKeNcLgo Qac2iDg7XYSKw5IveYl4CiN8+rg/JVREfUl5QFTpZIc+nFlABVSZ3YGbvU6qGC6qcAoUUpupWJtL lYp++M5HNNpH5IqcI1XCiYuhI6m06MRIqwtRhIS6sM9XxdpgwNpBGAR1wIBNY6ltEND/XYXFXh2d 1Siv4ki1BiTWB4VQC9yNdugNtAvG4CAkC32O5mAO52AqqNIdA4uq4DEC9DBcq8qkvosXUXqw+uBG UTpMwXvcswoYhPCXcsWRieg2x2MrlaFMiPhcH+1NgtNNa/pMEpnNLSxYFqGBfo2RFoFdGDiyl1kR 1h3NhGU93T2mhk1I11vILdXX2HvIeq1IM1VTNIUIjdzYKpvTRdAIKhGJivsyedKS5WutddBZ59NZ 7b1Z6VQTPmzZ8EXU7b1ZXsgnOaOonz0Kg3IKgwJPpgBKP5GKTM1UpBwMUXVa91uivkhVK0KBqkS6 +eMLrH1VUjzFuhgEVYTFWYGpTetK/6tLWwLEFVuBQFx8FQcMJLYUlgoEJFoLJOSwtWc5Fme5S2DD y1/TDm/pFhIlURVssAbrxm79j+TxD8btD3DdtsQrR1mCzBx5qwXyJiEe3R+92HqlPRpTgu0BQwgg AoU0JtGMXdhFGRZjstyMvdDLMYX9q9+dTSf+3YZt2EfoXTLWVxyLvTGsV2460zPNyI3NyDiNY+CD uJCtIApSmmPAoKb5EhxorT38OEDmXkd11O4t3x1wPue72e7Npzw5xKvQGqDVk6dw36ywE6ooWkYc BEfGueLqOcRYnFSdoqOjiyoSRVEEAUcDAVUelE8MBhBw5QqghKijAKyTjFc8W7Q10P87OlDjQDWy ZNDiCAFBktC23KPgECSkKiTlOBZFko6//TVfg0ZpBo9kA5fgKVHBVJ6q0sbngQFsVNF50TYi2EEQ w0EOS5BXelfIa1dxC2IkicfLksgYoxkbccjRfOLe7Rj78VccST3b5d3ZzF3dDWOCLmjWBd6F1FLh /UJ3Q+OJtNgzXBjdy8glYTiP8NhzMhp2OhqSVJqT7GMpyN4dEGlCDmRAHuRARmmTNl+z+ROrgGSt 0RqpcIqkveSseAokoF88O9r8BYxSXb9PthSn9KjpyloQ0Iv7FAtDwFoTgISmPmoxGBUEHRX/w+UI 1mVfuRVaw4BtcMBfHuH04qPUWZ3/DESq9ZrLXkOkuaNWaP4OvlQXEl0e4oGwTopc91jMwxSrsjIX fbEeBHElxywfyAtCIN6ZeJVXi7U9IJVIgJtYmsFH13XChzwmIiAQHasflKnC2RXY1eVS2Pxd3m1Y cGC9DxjtMA7tgSZo3r1d2mzoNHZsiD5eNZ1tiY6INh0njH64Oq5j6R1JprHDPtZDn/CCKBjpjxPp 4jZp41budfhjne1DQ1QKs9mtGvonPYEhS3UboTWogNJp8kTPpLxEnjO0tegU/6Wi5rKuusDa9Xa0 pjYB/HRqUAQBSHAM7upV0xDQB+ZVrL4jtr0BBgVms9wG9MIEP+rgY/Hg2Okvperb/78NA9xpa+8g Qeww3LprDwzHKq6SwXRRnnpZl1EyPIJRCM2FPMtdK8nk0XcVt4eIx+Q1uDLVTdF07CRWgYeMAXCY TdeLwvip7NOEkdmNJjHFXTJ2zdMuY9MW4zBO8jI2ctd7coZUaDRubCacyG4y3uRt0411uNxOpzq1 IC9rCZUIbkZo7uzFJ+L2guxV8x2IAjZ38zZn8+Eu6T48ivmds5KDM5UzG69p36mwoT+fiqMVdJ/E 6fxVSlMlKVOFLvVm6vljaki4v6bOBkhAZe3qgQAoW1oGUKqGYE4rULX1FVwxDgsWcAZlgTBAdQO/ rw7WQAwkRtpJDrjTFhEcNmkm0f8RDR653iT14BFQquHCm8HHnTAD2TYB6evBlqvyGeJ3NmwkSdMi XuwydOwq7xglvlKF9NI2kE0gf5EqJEInHM0xzrGF/SsmL2h0T3d1R22CVl3AGsM0vqzYhvE2/qY3 ltM55QjeriDf5mOV9QLhXgJ8am43L+6BB/iRxqc5J+7j/gl+ggqh4KfrO7ndivimAHSMN6g9AUqf /FSjJM+b8+mb+7lOqZQmuiJIoc9PJMX3rgCnVmWnxiLtYoyn4zQMoAR2uNUB/fT+xqPZAFZcZEBi pQRKSPWiZwED/8W7/eBmPZZtwAQHv5ZFErAQvBYKvw5vWY9wqUYe2ebHfY8YjLb/fenGx10QBCGQ hpke8IE8FAs3di4fH31xNDVD45WZea8sLdXSDAmy4U3IHG9iCIABIrDSioBdjHilIXEZhX3Yck/3 c3d8dF/tyJdyhBReJqT2mUns3eym3fumOP0ZjEYnOqXTOrVjL8MSkGaEKFB9NU9zPTRzNX8HhU9z 2If9HbjJOZH4kGs5EtKt6Z6zjAd0S52KnC70UMXfP1NPJ1L0SeFEkELg+otVQ3jqbACB+3MMG8A/ rLVVmw+DrTzbVwR12KCNXgZhoSd6SmABold/Vdfg3EBm10HmZv0vu7QdadUWAfuODwUP8ggea4Rh gNDwQWCLFhpaPGrxAaFChB8W/36AEVGhRBUtaJCA0ULFBxoFLXIEuZEESJIfVIAMSVIFyZUuWaoQ 0VIFoZYkbta8qXMniRg3fd7s+OMHjYcQYhz9ACGpnqUQSNCIGvWiChgoT34ImnQrBKVLvXoF53Qs BCNkyYqFkNapWK9nnSIl8XRujLp1efJkeVMmTBEoY9IQ8UOw4KGGf7RZpCTxIi2NtUCGowUHZUaM vFi27GUdoyiaM3NmtATzu8tRvJxesoQXr36u0cFezZo1Ol4Gat/ek/u2gX7ofPdGF7x3b9c2+h1P Yhw5kkHKUfSDjmI69eoo3FWogCJ79mDcK2SrEMyQCfEmshnKBkK9CUggyg8SD/8JUjZIFSh5oXAC A6UTFP4DCKB/JxBY4AkZHIhgBiGEgME2mISxTRhhUFJhDyz0MAMLGm6TQwg5ZACihyPmUGKJHebQ oREdbrOiETloAOOLGhgRI4031mjEQBrw+AELEPD4iEAsFCRRQj62IFFBGijJ5EJJRvQQEY9wdNFC HBW1UUcbbaRSSX+99FdIMLnkFwl8nTkTCYToZRNePsXwQV1P3UTDBm0g5VNXS8Uglh09PRWVCh61 IShIWSE6155fMarWUmuJZRYEOaSVw1KSSorWWWKBAxYERDglZ1dxPXUXnHjpZCZLfIkpAmGHHbbI D4vQ2oYStN4KGWSU4QCaaZ//YXYaZ6hhxghn6wi72Q4P8PJbGrDNFq20/djWrHAGGKCbcL/BBptv /fQ2DbjjItdPEkiYa650KAwyRLvtTjeIO9Npt5299YrHXXnooQfeeuSB8G927YGgAwiQOFOBE/+d 4IQT/gWoH8MSG2hgBggyyOA2IWzTMYUVUsKCGBtSkgMmH46I8ocdhmEiikZgksOLbsCYAwsy8ygj jjwCqcGPGgg55EBDCzk0kwpFqVHSD2l0pEcieWQlllx6edJIf50UZtZkwtTXSmi2qVNOqAJ11F09 QdXGBnLpuRQJaakA6lODRlUoDW1QvZOccomq6FtsTQr4o2xZ6lSmfyOe51GL/7PNtl1ArYlT5KmS xJerfw32KqxtMEYrrY7pyqsUlo2ememnZ7bDZZiRJhqzrQXHi2zS8hJAtLXZvkftv7WG+x4BwEYc uUgo1xu65x4nXXTuuhvvENZdp10wKEwfXnfXgwceeelB0l55FUBiiA7qGawDJIOEoF8ITmAAccQD 6lexggpmjMH6OTghoYQshKzhDBx66EMfwkCKRsSiE5UoRi1KkRFmZKMcGYEFOeJRA3ekox4J7SAf SEhBBiIRoC1EIhuEEgkuUpAThmRLSSphUUQyppN8CSVX21rXWuKXVZHJTGxaU9gmtxPIgUMuOrED Ufoml1BBQA9eIQINBkU3J//qBVFHdMtb1nIpxGGxcIHD4liQ0sXFKQ5OjzsVXthUE5n4hU0o8Yur BmMYWcFqEbbClWIaw6teoS6PmSmWZZYgGmPtYAerQcceoMUadqzmAcxaZO0a2azaBeB31Wqk7Wz3 reII73jHK5cNkDCETjIPXtSJz7yyc697Yc87JkgPeNjzL/vQp2AHKx8kZjAg/rhvYhSrGIHmh7EG BTAHBJRQhfjnvxlEKGUmMxEzC/giFdXsZjlq0QN3VqMdCSSbQmLB0D5oEA8q5Egi1AjSJKIRj2BE IlHDEgu1dKirxLBLJOkSStS0RpKocVVqchOqfoI2cEDOJypQAkaO8ogp8mn/A0qJE90ugk6FpJAE D2HbQpXiqbFYqlJLsZQWz9JRK27KUWMRS59Emqe3HQWgj0MbUMZmw5vE5GsocaPmZKUExHjuc4+5 IyNKp0fNeKYzm7nMZwK5hEhmS3ayY5YgefE62tmONVGtpFRZQy3hYWtcBlBOuZBwnOShazpJQEHz mhcv6mAHBdmgXr4GxspgrBI97QHfeQ5GMPfQUgcVEMMt+xMxiu3SYgla0Anqt7HDEpMS/7PDDGCQ TAGWiGMIROACF2ijFk0wghPcGQR+xAIMPgRo31SSCDm4JHFGiQgl5AgMWLgQj7S2S1Zr4kpg2DWu 1RO3Z7qtTdQouX6S7VRx//GJnX5wxMUp6gOqdYqg7lYVMWVFooBaFBcxOtLBTUoslPLo4LZb3S96 EYykGqNwxaYTltSEJn9hY0zc+MZZDUWOOVWM6PDYq9H59KepS91qfFObpSISkfJYwg6cusioVtWR VK0q8ICjVXQZAAnFMRe6kqM8G8ALXs+jTnc4/J22yhWucn1PwN6D14K1x2DzGcQ2CpQ/98E4fvJL 0IEKm7GMCTMHN+hYMY8wA8ayABPbIKBkUVailhWwRCuqWY1qRqPM4oibPOIZ0DBokEc8RMrkdJLS xrkQKlVkS4fCiDu7RDUY2nZMYMpt1yxXOfVybSbp/e0PbzIXO9+kUCxJbv8X7eAUlNDAKlaBp974 hlwqQiq73yVLRxGX0UaDlCzh5VNKyWsXtEkuvZrmYUxi8irNDSUxi6njIu44uvtmBtU9zWNpMqMa 2/yXFztA5BIQ+YBaK/V1jJzNVKMVVQO0xja60aprONkP4nU1edJ5F7umM6+0Tmd60rteXMUDAvDx q3uxBIE+ZJlXg1UAAxTwwvr8OjH4zbjGF7uYjesnTBbt78f/m0GMmnlAJ8vMsi+SIIxupDM35Mho RsBylbMMkSV9mWkQ8bKRLFIQKs1WzBtprUXIzE54einjYZLpbveJJuD+cKV6IoFq7USDRnkxLUpg XBPFlJLoZoVUgAMpOA7/t9Gbb7HRTimczhd9Fi+G0WxzGuOa6kIIyE3ujDFlI2FqKgI4xtdzSrgj ZaSAA6tX5tSk0y8jlsUL3S2VwLUeOyKXxQ6nsuapT6Udg23TjwAYIADEFh6Fjb0uT75rw9uJTwXm Rb3tfLit9jHBtdnjHhPbVcUmoGU2ViBuCjihB+2DGLp5qe51Yx7HRPZQx7bh4xmswA4sSOaOjZxk mOFbRtt4MjXdsDMegQODoB1SC4gkEBjcXuFeZkhEMuJwj0i8zDIc1DzZvBLecs3NMb3n0t1EEzrX +SegctxNCGpnpFARAj/w4knQ6USMqCQocWrUW3Te8/JvEf0+x66kU4pc/0tf+i41ycmmPc3eT7sX vrPqnKkZcXX/r5p9ZUbp8FEfFRhrLMGAld0OeIFq2Jog3dquvU4APEAlMQs7/AOvVQvwqEPcjYs5 LEeFLcdXDQESTMfyDAJZpaCHTYf1XE94lEd5wFJcrUfiHUzBmA8kmI8OmM8gEAgFYEAPpA9g/aBg KchgXcyNZczGeEiEUIKP2cEg0FuSTRYCPdOMYKGLPBmNSNCNAMnPGA2SHARBoBaU+EgIRYlFSAQR 9F5FcIkJVZw7HV/xdY1tbdwNdRwbvVmZpAlMAZcYDZecqBZiTBelVZTcENegUMVItEBQ9M3fRJqi WVfO4dwkbpcVXaJ3if8U+3GKo1iRSqlFn8Df0ZlX0uVhp7VRYcTXKtbK1FEd1lmd1QGg1v3UATqV UQWSUY0GgQkSOxRYgTGSBMoD2jnVVEkStcgdVo3LNGhSuSTBIHgSCuAds22H31UjKn2HIWSHfcDg ehyeethg95RPwehgLQ1IhSAIEVre/CBhEiqhxqRIyMAA6GkIklFhkrHIi8BMzjyQZr2ej2STz5yh 7TmERuTelU3ERGCZOW0JRpBZOlkJOtFhCq3ZbSXfHnZaRi5fH8ZZGenEqXSKntjFD9hBQdEFckHA yWFfy7VcDX1kVmxFpIFDz0GaJ3riJdrkzlXX+UHiz4kX/LWU5KDRbt3/X9OBWqy8YtXd1/+pGurg QAPKBi/m4jo0YC4aVdnd2tm9ztnxAjvoWlc+FVUBm9wFQDISG7qIoDM6x1omAfNAD71oR1t5R3hY T1ylB4nhFcGMYzmaDw7ex4D0gF8NCC8doS9l3oJkTMwQmcdsiB2EHgt0TInEzIPMiMzACCY8mc7o zGZ1VkACidFQRDaNEEVECZSIkJW0lmk9FDvBoZit1sv9hWwhH5jgoZnsFg714U64VJ0FEZzcGckN heK831IUBdw0ERxqiU7AJBYZAUiZH87xHKPpZPqlnxZpUSQiDnaGotA9Din+1hmlCdN52lAUxtPB l6yUWlJeXWUspR71/0pTLSCBrUMgpYayBNI7YCWzLEEwzsYDaKVTcaUjxV1rwF0HEls/MGPdWVh0 IAc1+l3fUYe0Bd42+otcdc97LJ4N6kCG6iAPQgI2GIK4nUA69ECLUZ6MGaFhgsiNBRATpsg2PGEU rgAyuQwzqQhmykwDUdNm0ojr1UiPXNNnVRlCCE1C4h6WTQRDIARDVlxGYMVDPY2YpcQ7sRnyfQ1R vtka6VMNxdSc9RNQ3MVR9AQR/IASOA5KigUREMFJAZrLWY1EjZ+hjcXhFE4nUkpGcVFHPadOyuSj 8KTgCA44EAKfqJSljQ394ZPlqEDmaI4qwhfV1ZcUxCIeOWXpACMvUv/laExlA3LqfOJirTEVrnkl WN6aPExgVakDJL1dJkXYsbmq3SkPu2xYvdBLrX6Hd3jH4FUA99Cge+jlLM2Hh+6g+VRA+uxHD9xA ERJmLxnmut1AiODYAJlMGPjMj80oDFACihTQAdkIA2khlP1o7HVm0IThGEaEQBzJCTEklBREURSF OlkNxc2WbKKZmByfHXLp8WnpKeIm9JXiTwBi/D0FSfYE0FEaUpycWEBFy3EJPz1iT05i+c0kJUbs FqVFJ2rUdAIqFqWFcB7sUlgDdxpdDCDq/NFEGqUiTc2KecoKpK5nr8Dsqn0G6VzdfMrOZnTqDniG 6jSgaHDqaASYU+3/p1Yukn7+J7P0WiRV0tuBCyYdhwEcR7lcmDSaFbtY499N24eZgCrBlfd0D8H8 aoaqmLCajy0RyIUYCIr20uVh3sUEEINwnmSxSP+swLWGwZKhXowsmc3oaAM1GRf6o8+Ipjbd3kEU DQflHsNFBBG01jk15JO25vBhHFZgTW7NoZYqn6vsoZp8HHrpJkuxFJwEEVQEp8GSRcI+BRFI7ko0 Ikwi1CZW4p5OrHTenJ7qpHWm3+xq7OBoZ8h+LMiG1xgd3aXNX+SYLJswHf4NRsu6bKSazg6sA9bh UVVCb7B0KmpU72hEQS7y4n7+4n6OnQI+QC+u3VSV5duhA1mCC4S5/yq6cJIJomDVolW9SKhc7iq/ 3CUN6qVe4hXZdigkPAwFhEBgWp660Vjbgog7RqsBxaOP1a0daACKbAPNMBmNOJkWAtyNZNMFSdkZ FqmSqOvSGAlDOKmaJgTUmBCUNmlK0NPlcikO7esNddqZmMlQeu7n+lPB9okO+wQRbMD2eWzKYQRJ MRF0cUShkZ+famedWuye1u7uUmfuMnElrh9KwoVTDKpdDK93Fu/x2l/KPp1gpCek9tR67tcA/h8j LKBlBNIfcapp4CxVZuoCjJ3Z4Zoi+efQot3ZJW0jdaBZtupXQS1zfJK5QKOsXsco0SrgfUe1hce/ qEd92JU4epsOAv8rD+6gIYQAgQRhGBRwYTYrYsItx3yIkMkttVrrjLqBG7xMh2gAJmjhzexMF2pw wQXJ4OIekrAAQzLcR1TEIzzNxKWwljzNlBKfy2Gcvirq8ukhMzMfXxyqD33kTYyuSNaJcQ0dSvaw U+grDPGTEH0X7vJpdQZOdDaa7WLXWtTpdVYsF/lu8C7FoFaaKHan8Z4JeLJR5qjsYFCd/4lOHqlO 1bGxfDLCO4SG6vgRQuPsLv7sVUZgV+La0GblrlESL3RgB8IOuWSScngV/KJAW1JjIs+vd7AVrlZA ebCSthGe1x4M+Yhjh2KyEPAgNpyPsW7DDJgoYYZyiLjtDXiIT5P/MmVpQBiwgIyuAGTSTIfQzIzQ jAYDHC3ryGfFntAUDZFwkwhHSUKMsGmW5kVYxUVABVW0lgpbTeVaZEVqZAxnZA2/ROQ83+eSIskG bAysaZn+BKWRRVMAVBGbxDtJUUglGjh84kZFGp5yCk7e6Uxq12GXc+BEoncpNsbCLhcJ5zvHgDVo sVz7RBfT8OW4SqMOhcvKIqWiDtYZYEJrRkLrLM6ehrCsttgtS1aOHR6b6h1rIFUBD9ypr/EY27lI LXJIoyhxmLOdEnf0C3rA1dci3uFRMg/O0iWbDzZgsg4gQTqGgRDO2E73dIjcAGRhgpB9N4vwiLUO wlHzLWZiZpAZ/4GP9uiUuZ6QCkl8D2nSEKk5FaRpPhwMtBAwB1o60QDjNhH4Bfj3PREyo7WWrlFR oqJ4fvY9dyk++ZAeSB9dv82aksAP6MF/A9SGgwMRCDY4/ICcAJS+rlmdPYVgb+LFEs5i36RiOwpH WVefMrFkJzalMLZki1Qnst+jVDZcKA4hbDiQF294EgLyfrY+l2c/AyBpm846sGfX8eJQaW/1UuX2 TuU7eIEgcW+A4bHQ7rEidSXaGWO27LariourftUzbtjyNFsip5V3cAd2wHn2ZMN5pAf31CD5dFtf TnefYzI2CIF0C0EPFIhibbJ2r1sOtENPe8h3t0zLfPcrUytR2/+BY9YthwDc3WrAU2/6Z3m6G3BT qFd17RXELhMJDGh1RGh1kmh1f3+1fgsaDYAZE8EAE0kFOuG6Q0GRgRs4ey14G3w2KrocHvarhKuW 9IGDHvQJIaypmlpfn3R4h4tih3v4XhsK10SXh2v7h3N7t9t4t2fXJQr2t384udd4ZI+7Yie2WnQ7 uKN4unM7u8c7OIQsvaf4ZYeiYCu7NSiXNZCcHjC7hKfRF9PUIggGGTN5zAbgQNMnscjxz3adspwG 9H4qHusnMfantOB2VikjbxPPVznjurQ5XJoS/X4YXd55ntdg/5Kjn7u8Dkg3zGODDwx6gfzPuh1I PmDeoiu6237/NybcQHjnQMs8yFCviKc7sCGEnugRtc+AOgtAvacLpKiLlqkvKQxg/ZLuMtY/AtZ7 fX8vaX+7elToN9lLRVVIRaHYjdrfet38BbDHBLAHxg8sat0jBnm2AXkOhv2hhBqpkR6Q6U3oAeAD PiFIOAnoQbRj+FBsO11zewwowYeT6dm3JFSo6eUL9ra3++Zzfuebe+ejO+eTu7eDPuizu7zT+4dD gDUAFGbXhYf3hLITQZEDvnGpbBgbhghQhpOfjhz7lOoAYB/JWiBlKvZmr5ZXpWpoOTAqFe2sHYM1 WG8MW7EtRxIkAcjbgFtSx4Y9jzXKeb7g6tZ2z13WeTZE8g1i/3I27KA+YDJM/7kO8IB0Y4P8z78h UMICdLcUPuvFLHr/g0g7AEQOTGHCZAiDCSHCMNvCsGgYRgMLhyxm2FmxAtIKOyxgRJTIwiOLRyIl wuAIwyRKlSgfwWi58qVLGjBm0rBTk4bNnDvb0Ghz0+fNnm1+/qCxwSeNHz/aLG26FKrSp1CpVlX6 Q0RVo1lV/CBi9CsJPSR+jCUyVg+Rs2rT6vmhhIZaItYegdNjl+1ctkZ77twpFxyRwOAGFyZ8GHFi xYhzLHb8+HFjyJMhW1MsGHNgvYL1dD4rllDZq1mzLhKx6AeOdaoZrWvtJQoj2Yxi18bRegmvJUt2 8Pbd28vu3v+9d7NbYnwHL93KmTcPwOt5AHTRpfcz0M869n7h+iVJYqN7EhT9UAxBcR49+gruUASr sL5CtvcVTNSXbwISfUjZ8OOHBAISSPTRQYdsCDwQQQSx0QEbbIRokEFseJBQwi9AuOGGBcKYYYZ2 wrihnQwwaQcTEEskaCCCGmJiIogamkiiI2CY4aIaXNBoho8+Gimlk2DYKCWW7PgRpSF/1OkmoYZE yo42YNjgp56g3ODJNpCyMkorf7BjA6a6VOKtDfTo8ssfyHwLTTDVTLOsqsDUqiq35FwqrTbbWqut t5Q4axIi+jwrsEnSmiQwMLscKqmc+tRD0EkEBcdRQiOtS1L/wgi1FNJMNT3s0k4x1dRTUD8N1dNQ N71UU8vAscxRS+/qzFFr+GQUz7TOosGtr9yCE6rVonAtCtjeoS2KYhlZgjba1nmHOeN+8023B6Ll JTlppW1OOQN4QQcdXgzY49vrwrVuj+y668eGJPoZAol0xRtiEPPQkxeeb9jbZz4U8DXhvWz2qwAS EwzJBgSCCYakQAJNSJBhAhdsEGIGI6RwQogr5qGCETccZIYRUzwoDCY+VpEgFlg0mSKJclzZjpYv gsQFF2pomYUhNwLS5hltbplnIpP8iUoom2xygymNPhrpoovWUwk9lFCzaTXbWPNpNqm22uqqlUBt TafLArMz/7Dl7KwzO+Q0m1E6sQCzUUYZFVQPOxZZ1I40nW5jzJzqjttPPx3tu9VIJQ1ccEgjBacd wQ9P3PB2GjdcUscDl1xxwi0/HPNJrKn8kVbftovQQR1ta/S2yC6LbLLBRO0H1BYxdtklfjW2tuBm /xWdPZbLbXflrsVWuW67Za4fdLArF7vr+tlD3XP7mSY876SPt7zqz/sGBXfsrWCfb7inLz767gvG BP7KL9hAfxcWUIcBGybQBx18mB/C+hmcEP8vePgCGyD6BwIIX4DChAbxj3+0YwUcYwITCMIED4XB HBB0iDlEQkEKcmhlK9PZEexAoxXEzBk3atkMdPajne3sJ/9P+tEGuMRCFyqtaC2E4QyLNjWlKWED SrDh03L4NB/+EIhBBKIWnkZEIyrBiEZcBBKJCCYt/ICIS3ya09RERSo27S2pUx0WmlA2L6Itbk2L mx6IqKep6TBqXnTbGNtWOTe+UXGIg+Mc6VhHO2YuVpEiAiz2uMe2rZFsYnKa6q5IRj0s8YlPLNY6 oiA72c2OHlGQgQwe2cgHpIEXe8jd8IA3vG95S5OaXJ64tAM970RPeqmU3hBsYB5Xnoc999IXfVAw vvqUrz7BMNh+/sNLHSDMQARyH4L0Eb/5HXNiELOY/vj3hS8EsH/PBGAABwgFAQphBgvsgSFskCNz WNCCk/j/pjjNMYNJcKiDI+SZRewwiIvUyAVCuAIdMrJOjWiEnRtYAQv3ObMaKMEOSljB0wYq0BwO 9J8EDWINsFADhiphbRCF6D8jKkSJVrSJSNToETmaRCZutKMbRSIUkXjFqJ30hkDEwhWmWLQxdUZp WojbBjIqRCviUGmTsAMszKZTWDTKjd1QXDfA0Y3OCdVRSE1qpJRaOaMuFapvJOpTpyq4bmxuEj8V 3E+1Gimu+m2MG+DpmGgIQx7KlKNb2+gSJjlJtrK1rTJAByXj2rxNlqtc3zKeKJHHPOyo65SpXFcq hzCEd1VPXvJCzz5QYALG3rI+9MElfygbn/IFTEAg0Idm/9vX2WEeKH7YoJ8yJaZMiDEzgM6U5jQB CAUgWLOaAnztF3TwTXMMwgUVCIdtyxmOGZQTgx0cRDc5xLEVzGAQyXVnAi9iCEPADBJCEMKN3lnd Gr2zBivIrkO1y12Hfhe8MhOvjWwksya4AAvoVe9Ka3CF9GIBCx1Y6Xzd6176zrcJ8NUvFuCw0v7u F75a+C98Byzg/WoBwQlG8BUU/FEEw+LBNGXpFarQRFjQFMI5vLAWLixW++rXh0S8wgZYqgRYWKNo Fx6TifXQ4Qu/OKsxhoVQm6pVpW5AqTmeBI13zFSd9nipPOaxoJBqB0dx9cgyziqSYdFisYrJxSkW ExFPLP9WDlvjCtbg8IO5rGAvTxINcg3zHsKcBhmEMsy5S8IQ0pCGJLjZzW/2DpzlLL04x9mwhdXz nqtXryEwth4oqAdj99G9enyje/twbDYQrctsPHqyj2afgQZUaR3cI37y07QPMH1MT8+vCzrowhdG rVpTnzqAqRbgqmErQCjAFtZAgEQ4DBCOYLiAm90YRDg4Fg5uGsLXNrBBN1bgXG4WG7fNHURGIPFc mAlBBzxwhhBgRt6YlTdmV4jZtrntgg5w+9ve9nYHyF3uDjQB3d5uArmvYG53t/sK65b3ueVd73PH G93n7gC+8Y1uf6N7E00AAxiuMPCCXwEOm+BiE+Ld8Cv/MPjhEZc4xCEOCyVUAd1XgLDGWQoLjkfc 4vWd+MRNrPH2epzDsLA4LGogVp6+GBaGEOtOubRyQ8RcrDKPucprsPOe37znK2A5LIR+c6ETHemG 2KnQV9CNGjjd5zvf+U6B/vKZi7XlQ5fyi11uYpVzfOVK+DiHKa6FiW9C7Ahu5CLXXqxKFut2jJyd 3NlOd7nTg5Fyz/vtZreEdeA9CpGMe9vrDve2v93wiVd84iPZeMEHHvKLl/zkDf/4yFMe7n4v/Nof uYTH093wlVyH3TGvd77TXXbrkJ0MGOn31DcykqAHveFnv/jaY57wbL/85JdlLMQ/8h2N3I3wh/8O 2QU//wrIRzzfEz/8t+8d9W+3/CJvj3q3Xz/yy7e84LlfrO57H/xwn/70vQ966eO++aRH/+KNn3m4 q16Sv9qN6tfB+vjTY/Wub2TeZSD/X/W/9Yql//oP/+RP9Rxp7frP84ZPAQ8wAecPASNw/xBw8AAw 9Zav70LP/bBPAiUw9zawAzlvAuOPkkJwN/SvAPXP7xRQBScwAuGPkiTJ+SAw/hAQBl3QkeBv7vZu Ag+Q/lRw9DSvBYEwB1dP+O7PkTov9GxQCQOQAtuOkfDPCeEvAl2PAouQBGWQCnEw/m5HChcQ/v6u CI0QBf1OCn8F+uZODdMQ+gpw9NAQDT0vA/GPCPOPDv9H0PXuMAfjsP5UjwVdkPjcDwElgBALUQLi wRATsRARUREbsREZ8REdURIhkRApcR4O8RIzURI3kRM70RM/MREp0REpURRFcRFDcRQ7ERJN0RRR 8RBB8RVBcRU9sRUhURMvMRZTURFbURZ7MRJh8RdzcRcr8RSDcRN58RiH0RWVcRKDERklgB5kIBrj Shqr0RqpcRqzsRq18RoniRvjKhq5MRy9ERyxkRzJcRzH8RrVUR3N0RqjEQ3YcRvfcR6/URvTsRzF sRzbSh3RQJK0McymkR/pER0Lch8Jkh4FkhoJUiAV8hz10SEbch4n8hzd8RsZMh8X8h7r0SAHkiPt kSL/u9EgQXIf/fEhZQANliAl43Egs3El8ZEb/ZElMVIk2zEkL/IdZVKSWnIhPRIf52quUBIl0QAN 0MHMivIoJ8nMjtIoURIdkNIpifIpw6zM9kAGjrLMrvIqrdLMNCkNuFIrpZIq5+oorRINvPLMmlKT zrIpixIq3xLMnHIptdLM5DIqn7ItoTIN9FIov1IrmxIvwzJ36JIwzzIs0TIrmZIpiZIw/XIu2VIx hRIy7TIypTIpGTMrJ/MxzVIpnbIw8fIy2xIv9fItwVIy5aort1Iyn9Is0TIyQ3MxR7MtETMx09It RTMyA/Mxh9Iu3fItp3Io2/IzLzMsb3M353IvmzI0/4dTNS/TOKOSNpWzLxtTMsfSL6lSMtfSNjVJ BurhBb4TPL/BO19gAr7TO/cBPNHzG8wTPL1zPF/AO8UzPV9APl8APb8TPdXzPNkTP+mzP/lTPdsT PvlzQMtzPN3TPhN0Pf9zP+/zPgcUPRF0POtTPxM0P/3zPg+0Px/0Qi90QS90P9fzQssTPcvzQzFU QdlzPC+UPhEUQjf0O+szRlfUP+uhQRP0PzPUQlWUQXFUQlt0QOcTR3cUR3V0Rml0Rx90PwcUQe+T RP2TSH80QoHUSDs0RgnURGm0PIGURh80S6+0QicUTBUUSSkUSpd0SOXTRb3TQBM0RGE0QHOUPOW0 Rf/fk02/syeLsq2CcpL4dJKsciH9VCipUU/lihqDMs168swCNa4AdU/7lBod1VAhta0k9VEnNSj5 NFPbqlDjElKDUlI3lVIpFSj/9FInFVBFtVIblVJDNa74NFFJlVAlNcxQ1TMx9VI1VVZPdVIvtVYF dVRPVVVPs1dxlVd1NVKFNVfbqi4Z1VaLFSUt1VN3dVEHlVBZtVoR9VRr1VShtVe51U9T9VLF9VmL lVy1tVm7dQgmYF0Li13ftV3h9V3lNV7pdV7jdV3fNQ3k1V7xdQL6dV751V/z1V7v9V8HdgL2FWEJ Nl/bFWHndV8T9mAB1l4V9l8ttmH/dWL9VWMF9mL/JxZg63Vh9RVeOXZfIzYJJHZkH3ZlN9Zg3bVl U3ZkZVZiU1ZlCxZkLfZlDRZk8VVkCzZj8TViWfZm1xVlQdZjgzZkedZn2ZVjiZZp+RVjl9Zi0yBj 3/Usv3IvySxrs3YPtlZrvxYNwlZrvZZsv1Zs05Zsu1Zt0fYrzZZt39ZtubZtzxZsvdZs3bZs1RZu +ZYo5xZsAddv0zZu63Zvt7ZrC/dt4zZr1/Zry5Zx+VZwHTdwF7fNJPduJVdx8zZzK7duB3cv83Zs +9Zu25Zz3TZyOzdu7ZZt//ZvyfZytbZ07fZw9RZ1iTJ1PxdxzbZ2exdzz9J1FVd3hZd196BNB21O /5HXPdWUPA0NQpm3TaMXPsUzPqu3eeVTeu/UQEu0RJOXSZm0eydgH44Xe723TdUUew3tTg/NPSPU ednUebNXfeGTe5MXfde3fsV3TvUXQcVXPstXfwP4fdO3eQtYgPe3QMHXgAdUPOPXgPM3f6e3fe23 fyM4gq2XfSU4gTN4P7P3gRG4g+MXgj/4gEs4fL+3fZn3fc1Xg5HXQAnYfwdNPMuThrs3g2uYeeG3 gOEXekn4hHV4ewFYg6XXhndYPNeTfZH4iNcX0Zj0G8h3H5I4ihHt0Jz4R3P4iKdYi7NUiadYgpe4 i6vYi5d3ig+tjKfXiYP0jJO4ir/YiceXPscYjf+rmI1bmIrp00S5uHrBGIXvmI+Xd3nnmIqV+Iu1 2IzzOI7rmIwPuUUJWYzpeE4HGZCV2IyTeHrHGJKhGJIPWZIHWZAr+Y8vmYvhOItNVIuB9IgvmY1L +YuZ2JCRuJVhuYwdWZUTWT4jtInpOIt12YwFeYsbWZVTGZTfGJK1eJBn+dD+9UWFFEZ9IBJIrUiJ FDynWZrhFEapmZofdEi3OZu7+ZqxWUhZNEA5FJvf8z/nk5zDGZyxuXsQIJrPuZsXlJnn+Z21+Z3X WZzB2Z7n2UHP2UrxmZu/WZut1J5ZdJ2t+aCluaC9GZ2HdJ/1eZr/OaIDOkWn2ZwnOp6ZeZ8XGp7/ ifShOfo+vyAeuuAeHhqfJQAXCwGl54ERLxERsyALXsBmyzMLUJoQVdqm50Gn40GnJQCnfZqlU9qn bXqoXVqng/qoVzqoUZqnV7qpl1qleTqle1qld7qnpfqpb5qoc7GnMdGrrzoTj1oTiboQkvoSq5qp rRqpK9Glbbql1bqpX3Gtkbqpy3qpcxoX57ql0zqpi9qoM5ER7Rqpw5qlV9qw7Vqri1qqlxoXczqu CbGnrboQfzqqqRqynfqo4/qn3Vqsd9oQI3uu9bqrNzuuFxuuu1qqE5uwGzuzJdurH3ux/Tq2GXGv ERGwUbutc1upiTqvJbuyz1qlsyAe2ExjoaCm//natJc6SBMaChLWavX3O+8BCi4anN0ZPK37uhNa u7f7BazbnbE7u78TvLs7ocebu8Obu83bu7X7u8ubvLHbvMWbvOf7vLE5vul7mtsbv+07veU7v+sb wM97vO+7u6k7wANcv9m7vuH7vRs8vwmcwA+8vxFAvSMBHeD1PbsgEuQ5uwecwj9cHz78BeIBDfRs Ano5xBEgHvThBVL8wxHAxV8cxmccxGs8xUMcx2W8xmfcxWP8xX1cx2mcwnM8yHf8x3m8yJNcyXUc x4lcxnMcyJW8x4s8yo1cyId8yavcypc8y7n8yoN8yqFcy6f8xbvbyqHczJ9czbEczGk8yoncyf+9 nM3lvM13PMZ9PMzdnM6ZnMJfgKTfrLDq4Und2QeUYcv7/H0LjX7XEwrGll1tFDxDnKSlO4UltNDU dEpXWNHPM9PpN9HpV4EH7dNFHdMXvX0z3dAundRPPYftU9VfPdEbONZZ/Uc5vdRtvdI9XdZNndeV N9VT/ZaDfdV1ndPd9NdvXdV73XmTXdQhdNl/fdOB/TxLvdNxndlBfdWvfUppndm1/ZZ/HdQTfdux 3X0bWNbNXYabdNZhfdRXeNjf/dqnvdKlvdsxfR+6IF5l+Dv14R7uYdKj/duf+F+T+YkF3kbdVdD1 AT0pvN8boQu6YHpPPJnHV+DHN5kn4IkF/eL/BZ7j/7XjNb7jM77gMf7ET3zkRV7QOV7QKZ7kSd5G DT7jxdflk3njJT7jad7kBz7mL17QXT7n2dfnCd7jS57mhf7lSf6JxxfjV77lqbfi/1XpZd7mib7l lV7gWx7nhf7pl/7nU37qO57reR7ph17plR7orx7sBZ48Z7jmqz7s0T7nRf7tSd7ib97twf7sh17o x77o5f7lQd7jAf/oZd7gh37pab7gAZ/tEz/ng/7p+57od/6Ju+BgVz7NKZykNfzje16Z9YHfZfwe 9CEennvQWNzzYdzfOW0Y4qHFQ/8eYPzzXf/0Qx8BZJ/GX//2h/z1bZ/2df/FZR/3Pxz3aZ/4//nd xYt/91Mc+Gv/xl8/9p8/+ZGf+ZF/9o2f+a/f9n2f94/f+n/f+kP/8z+/9qff+GW//Mk/xM0f9dNf +buf4Y0f+sn//YWfyF1//YO/981/+Jsc95X/+tkfIO4h0CeQIIJ7BPUd1KeQYUGBCA5GjIgQ4kKE FxVW1MiRosKBAy0a9HgQo8SFF0OmrJgyY0eJI1vKZDmSJkuUGXPe6zJhSL0JL/S9CHqwC4IuSO9h 3JhwgtOfUOv95Dmh3rehLyZORNoFStWnX7/+FFsVKlmpZctGPav2rNm3aOGGlUs3LNu3c8HW3Xu3 r9S4fvX+ZRt4rNm8eBOnVfxXMTzEbheLZf98mPHievAA0x1M+bLnuoVDRx0t2fLan48NFzbtNzFr 1Z2rfts3FObBRl2GdV1Ldt++2b9f/Pb9YgJxhwIFGs2trEs94cCv+o4OvV7w68Ola5/O/bp24d67 v9juHbr54eVpR+dOfv106O9/W6eO/rt87/PPz6Zv//r48flhJ1128NWnX3zaPZdef/99E2B4C573 n4EC6lfggPYBuGB9FEqnoX0eYnggfumVeKGFES4Y4IXxDSchfwWi6N6M59GW4lXKPDUUQx8dhYAP SEXi3InBZQWRRkGNR1tWWk20UxdfDGOSSAO9YJFKWt10UkQGdXklSEFZdI+VOFFEZpNobhn/EVEq adQkRHDGNOaVFZ3J5Zd3ahXTm3Y2OVKPWHJ5pkN+PoTmnGmalKZCVgJaUJhO9qknAmxOtCeWgFp6 5JdCBconnH126qmZHwlVUJahXmkqRZQmxKqoacaKZpdswlklrQIRteqnDE3apqF/UorQpU2+UMhs wsWqlG5dFGITSK3a2uaORAnkAwKN7IQbFMosxapER57k5puWqkmuk6WC5Ki66Z7qLpfgmhvuqdCq OtBH9NabJUjJlTtvvOrGi+ehJ0n76qy2Bfzuwf3iROWW6QqMLqt0QvvtwgQn12O/4zYE75aK2uZx uQfr+y+0+K5pq7fvchzvuBR/3LCbcsJ7/+q6Bssabqu2vQvFc0Lh2whB9wAZJBSyIhDPPPFIIEHT UD+dp0hK+aDbME43/XTWWc+z9ddah8012GOTzbXYZouNdtRbq/2012uPHTfZc9d9ttxyw53322ln oXXbXaeNt+B04+12234PvrbegDdut92BRx223vEkTjjkbF8eueKbSwA35Ywv7fjdYIeuuOma8z33 14QXjviYKg374225ffFG41/X5qRWUFhZNLYGLXfPF19AEcmuSSev/PLMJ13xt5k2L33zA08vffTW O59o9svjif250lfPvc7jly++xfuWr/76uzdplFJGlRQRV0hB8X7SmX6kmw+4FV10I0e5R/9zoDCM L1SKe+cDX/q2R7D1JTB5CazeA7M3QeVVsH0KVNMFu6c9CmLwWx1knwgzSEJziXCDFkxhmuJxlC7c AzcB5N9OIvGFSIAwUkBRkHBeoKAhQAF+LgziTq7GraHQRodLes5QlMhDI+7QOjuMohKn2MQq6tCK T4xiE5lIRRs10YtUrCIWx8jFJTrRjFlM4hOJo0YyShGNOrxiGLuIRiyWUYxdJE4c9XhEMLYRj1hB 4g79CMgtDlKLd9zjEc2oxzrSsZCAvOMYq7gkSCpxkV9spBobmclFLqmNj5zkc6D4RkfC8ZSJZCQm xdiFRvhgJ9p6Ze0I2AVMdrEeQ3DKN5z/osuvCIl+XBESFGq4S15OoJhPcZBsoKJMY8rGmby0SjSL uQ+nVJOX17zmMyfwmGVaUyzI1KY0nwmVXGaTnMnEpXGs6ZNpjmWb63wmMq3yFmWOM57nhKc0DWPP YtIzl8yMJz/Hks9djlOaBk0oL/3pIHOm85vwnKYu1XnNfSLTnRC95zGN49BeehOfGKWnN5lJ0LM0 dJ3vFKlKmznOazJ0LtSE6EuN2dJkVgWgI1WoMSv6UpE+dJkd5elCcfnOCXQBG8yin26AMAxlQCGX HJUoUHp1L4wk5B7Gy41WC6iMYfwwIYRySK/+VCqwuopHw5JdWu/FI7CmVawc2Qhb0doQ/7p6qa5u hetCwvpWs5ZVdnBV1Fr1elazDguse/XIWa26FLeGJLBsfSuw5NSQh1Q2rjziEmQD25HDLnauVLVr QRab18TC1bD30qxmaeJXm7RVdqnFVGFdW9W7itWyoB2tWF3SpVLptq846a1rOZLXu7oEIvHY6iyd 6tWsXHW3A5nMaOIyhKYyZ5he9co+XPOatGxXuo2Zblu6e5rSRMY14+0MeU9DGrjE5TWauYt6x1ua +e5luuxtzGREo1/8nre9reGMWwRMXtHI97yr+S9/8Vte9h44vAOmb3wbHOH3huUF9nNqDbVKlQr/ xD/fcdB9XlA8r9KQh0ABkYRc5MUUKf/pKiACsYxmXCT1vIjGE1JxhRBknh1mSMdAHmSQU3QjIul4 Q0VWMYx53OIcm2c/4IGxj6N8Yy/2R8pJVtCVD9lkGNkYPRNycosHJCMmexlGDXqRmcFjoSHHGDti BnJ6jFMcpWU3Ej7IYXhULKyUTS1Y1dqYzFZbW77azE1i4tdBGtWzznbsVZCi2ab0hbKESYu23nrs xSL2Lj8fqSaNRomtDE1pYO1stJfG0qnTxyl3hQm6fhaXSNgEalFDF9Xp4zS6vEWoyG4202PFrcMK jWqqjprXuD02zHINLH6ZardUGpe0UiZcXVNa2ndCklB2tNfGNptn0POVnio2MoyJqU//DbPYyCaV KfEhenecwiC90q3oSi/QX+3D2QJXTbKPIWxd/t5ZuBOWMEDpGmYRIxi+qsUwm13sZf5u4O7KXTDm NSxJY8LeskE2ca2gG4Tfu+HG6/08eedpUs9Ll6cZyG8/r9tjVpXX9u6huCykLmyJg5rl2FY3yskt 51kDOtgsN3SowU3oh6uczuu2c5v/7XGdS7rhdu401q2O51PHHOcq1ze1NX3pRMdczqmu9M1BTnBl f9rYn25zq5Ou6lV/Oul6jjutu33rWVc759Qu9bQvze97Q5vmuL50tO9d56VjEgRvKPMv0VtcD5cg y5Ul8fatzOKYZ/XkLV3CzSc6Zyb8/yADKV/56YGefJR3POMrrr7LLx5gqq94omW+7wY27PSllzie xJdqE8Z+9Lg3eZqMNEIVZr7zxU8+9Ty4evahMPTQN33rEYh6Dirf+NOv/gglf/3fK3Bg3tcZeLxo SEa+0ZNf5DIP+9jkPaYRlYF8/yMvqX4oop/8bQSlIUdp/vQraJP+l0a+wUeVlEq2hEXod0VupEZl 1EemtIBZVH5h5Enk537p90mq9H6LNErtd0psZEb8h4D7J4HmF0fjt35sJkj2d0j/Z0eGREj3x4IX GIF5VEr0V0gmuIEo6IA6qIJvREpb1IH0Zx25BFURpVHbdFAXBU0b1YQ2lUwAtYS4VP9RHRVPUVVU 6sSE8KRNvGSEN9WF/PSEFeUUVahNVShVVuiEBoVTMPVOqXFS2nRNQ0CFV/hNWVhNFPWET9FOHxVR aHhPYehMSqiHPUGGaeiHg6iFfghVPgVOX4iE0BSH0eRRThhVxrSEfghOJOVM+wBVXAhNkPiIPoGJ B7WHNGVPYPGEgHhRQtWFprhNo4iIJ9VLr2ZsmfVYofVXoPValTVXxWZaxfVcvCiMdOVZbdVbx0iM wnhYyXaMTOGMfvVavhhWtjWM3aZWrXVaksWLntWNePWMujVW2lhbe4VWu0houfhc3iiO5phZyUhY xWVZrvJYjMVZ78iLmlaM0giNhdYljux4W/fIjHhlj1Z1jKt1WumYjLjmj3ZVW0ZxWprWJvu4VggQ EAA7 ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master32_image004.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhHAIHAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAMAAAAW AgcAgQAAAMqbBM2aA86bAwKLRIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq5uC7+OQNf2jef6zvf+ DwwKh8Si8YhMKpfMpvMJjUqn1Kr1is1qt9yu9wsOi8fksvmMTqvX7Lb7DY/L5/S6/Y7P67mAQf/v Fwg4KFhIeGiYiLio2Mj46BgJOSlZSXlpmYm5qdnJ+ekZCjoqWkp6alpYAAA7 ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image005.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhGAI9AXcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAAAX AjwBgwAAAAAAABgYGDIyMkBAQEhISH9/f4+Pj////wECAwECAwECAwECAwECAwECAwECAwT/kJhJ q7046827/2AojmRpnmiqrmzrvnBcEYGB3Hiu73zv/8CgcEgsGo/IpHLJbDqf0Kh0Sq3mDACbdcvt er/gsHhMLpubhtp5zW673/C4fA7Faun4vH7P7/vlaXd/g4SFhoeIe3aJjI2Oj5CRQ4GSlZaXmJlt i5qdnp+goUGUoqWmp6iJnKmsra6vZqSws7S1tkmrt7q7vLWyvcDBwp+5w8bHyIi/yczNzoBZz9LT 1GPL1djZ2krF297f4DrX4eTl1N3m6erH4+vu77fo8PP0rO31+Pme8vr9/pH3/gkcWIgfwYMI8wRM yLAhG4MOI0oEs3CixYtSIGLcyBGXmo4g/0NyiyaypMlRH0+qXHlDI8uXEyvCnNnQJc2bBGXi3OnP Js+f9XQCHfrOJ9Gj5oQiXQrOKNOn2ZRCnTrNKdWrzKRi3WrMKtevvbSCHRuPJNmzycSiXWvPLNu3 vNTCnUvMLd27r+Ti3SvJK9+/kPQCHnzIL+HDBVMiXmzJMOPHChVDnqzKLuXLhARj3lzGMefPYjSD Hs3FM+nTVUSjXv3ENOvXTFTDnm3ENe3bkyTj3j3FNu/f4nQDHz5SEPHjSGQj3+17OW7lzmk3jz4b OvXX06+ztq4ddfbup7mDH/19PGjx5jmXT78ZPfvL699Tdi8fcvz6j+njX3x/P2L9/hHWX/+AgwFI 4F8DHsiXgQrilWCDdzEI4VwPTgiXhBayVWGGa2HI4VkbfkiWhyKCFWKJX5GI4lYnroiVii5S1WKM U8FI41Mz3siUjToilWOPR/EI5FA/DgmUkEbyVGSSOyHJ5E1LPkmTk1LCFGWVL1GJ5UpXbqmSll6a 1GWYJYFJZkhjngmSmWpylGabG7EJ50VvzmmRnHZKVGeeEeHJZ02W/dmhcIKCGGihIxKKqImHLpqi oo6y2GikL0JKqYyTXlqjpZrimGmnO3IKqo+fjhqkqKYSWWqqR6LKqpIAFHDArLTWauutuOaq6668 9urrr8AGK+ywxBZr7LHIJqvsssw26+z/s9BGW2sBAQgwwLXYZqvtttx26+234IYr7rjklmvuueim q+667Lbr7rvwxivvvPTWm60Aq77apKv6Qplvv1PyC7CV/w6cpcAGc1lwwl8izLCYCz9cpsMSoxlx xWtSjLGbF28cp8Ye09lxyHeCTLKeI5/cp8kqA2pcyw2/DDPEMs8skp82O7NnzjqzzLNAO/+cls9C 9xN00V0RjTQ+Ry8dDM5OP51y1EwrTXVRU189D9Ra69J017ZwDbYvWY+tjthmw/J12nlZzXZTZb8d Dtpyp7J23ajQjbcpd+9dit5+h9J34KAATvg+cR9+jtuKPzN445kYDvklj0/eGOOWI1N5/+YAYc75 MJt/7ojkoo+eeOmge456XKevDgzprhfWeuy7wE57ZrPfHrbqus8Seu9+2A48H78PrwjvxrdVc/KO I8/8KcU/P4fw0kOzfPWaO4994blv/7f23ncSffgPgU8+JuOfH4v56leSfvvWsA9/YN3Pj7789jfy fv5eUM8/RfX7X+euJ0C1BbCAo8MfAnFHwAXaQ4EODN4BI1gYCFJQERO8YGYsqEE87K+DaOAgCK03 wrY1sISIOyEKNeG/FS7hgy6sjQhjuAYY0jA3KrxhXzKowzi0sIdEsCEQffDDIY6Ch0YsXw6TWJkl MrGCTnxiQZAoRTIUsYrioCIWw3DFLe+2RIte7N8Mw9gbMJJxC130ohCxmMYtrrGKbWSjGc+YmjHS sTVzvGNG7KjH2OSxj63hIyBx8cdBxkaQhqxNIRPpkSgychOLfKQMHSnJM7xRinGEYyQriUNOSpCS nowfKEPJxU2SkoiIPOUOLvnETGLSlKpcZSpjiQNWMtGVrYQlLWs5y13aMom4vKUud4mAYAJzmL7s JS2xIAEZOPOZ0IymNKdJzWpa85rYzGYKaACAAHTzm94MJzjHKc5ykvOc5kwnOtepznay853ujCc8 5ynPetLznvbMJz73qc9+8vOf/gwoQAcq0IIS9KAGNWcEAAA7 ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image006.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhEAKZAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAAAP ApgAgAAAAAAAAAL/jI+py+0Po5y02ouz3rz7D4biKAKGiQbpqrbs68bwLNf0bef4rvf87wsCh8Ii 8WhMIpfKJvPpjC4B1Kr1is1qt9yu9wsOi8fksvmMTqvX7Lb7DY+/VfK6/Y7P6/f8vv8POIcSSFho eIiYqLjI6HbQCBkpOUlZaQnpcqm5ydnp+XlJBzpKWmp6itqVmcra6voKG/gYS1tre4vLtZrL2+v7 6ykKPExcbNy3e6y8zNwcNuscLT2tnEx9jZ0dK6zd7f3NaQ0+Tl5uCG2err5+J87+Dh8/xi1fb3+/ gq+/z47O/w9Qm7uABAsuo2cwoUJfAxc6fOjKH8SJFE81rIgxYyiN/xw7WrroMaRIPxJHmjypByTK lSzXIGwJM2YZlTJr2rRS8qbOnfl4+vT58qfQlTSHGtWY86jSjkWXOn0Y9KlUqIOmWqWY9KrWgE23 eq0X9atYsFXHmsWX9azadF3XuhX4Nu66tnLrHjxhN683unr7AgvrNzAxvoILb8NrOHExwoobowLs OHIrxpIrb0prOTMpypo7S4LsOfTHsqJLd8JsOnUjzqpbI3MNexLr2LThoK6NOyXp3LwBge4NXNDv 4MTV3C6O/Mzs5MyzDG8OXdXu6NTnIa6OXczy7Mifc6++/Xvv4+LBTy+Pnor39MnDs49N/n378/K5 r68P3D3+1PH35/+n71909wVYm34EetbfgQUCqGB3DZo34IOqJShhawZWWFmEGIp24YaKUeghhwyG uCCJxHVoYmAgppgZiiz6peGLkbkoY10r1ugYjTjKFeOOhunoo1o3BlkYkESe1eORfRmppFdDNqkX k1BuleSUPI5oZWNPZhmXlFxKVeWXQmIppmBblokkmWiquKZlXrb505lwOqnmnHaFaedVb+Z5k5x8 TrXnnzbhKahTgRbakp+IKnXooiwR6uhQjUY6kqKUxlnnpXRqamOmnAJ63adrTSoqR5CWWhOpqGIV 6qpiqerqRKfG+qintApl6a1EmUBCr77+Cmywwg5LbLHGHovsCOobQcGsFM42C+2z0kZL7bTWVovt tdpmy+22MhQAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image007.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAFEAAAA/CAMAAACvr9QuAAAAAXNSR0IArs4c6QAAAAlwSFlzAAAO xAAADsMB2mqY3AAAAIdQTFRFDAwMADMzADNmADOZAGZmAGaZOTk5KSkpMzMzIiIiMzNmM2ZmM2aZ M5mZX19fVVVVQkJCTU1Nd3d3ZmZmZmaZZpmZZpnMhoaGlpaWgICAmZmZmZnMmczMsrKyoKCkpsrw zMzM19fXwMDAy8vL3d3dzOz/zP//+Pj48fHx//vw6urq4+Pj////uo1/FQAACDlJREFUWMPVV+ty 4ywSjXA8XxbYeCLRlmwhJLC0IMT7P992I9mxc6tU7a+lZpJYRoe+nD7dPKXfL+/DtC3vv9319Dus adBQCsGvS7yWdWfD7xHvLQiDAclwcS4VGGM6XKapy1culLG/R5znGdEmfcxo+O4Qw6OrfnFNdThd foNIYORqK58JDbT9NmzjuTzbnxERLZs3aSUyXB/TZvHXKzjjwg+I25sW5A7xlP4Kzm9PPK5EsRmX Od32PH0Rw2CPZJ6EfiONfz/qc+Z+kZkJOGUWpt/xaup73feT/wLRb3hkH4PxB5jN6alvQcq8nQnZ TldEf+W/p31aMgygRErM+VU7PpTHzXe/snRHa0+Qux2+hBDznY24eYR8XhvoEx0V/5y+iJm3WnK2 rRVyv9sxuXyKIxmIX/SrLV2lU6zdZ7r0a6CFUJUgn/e7/X5PuO3HOLZst98xiJvB6slk19N8H73Y IQhXbb+EgNIRnVohyRZ4RIzAyHyDXi6aysCZZQObbzGMRhQcMkvzY/qm4yzbSIj3cVwUncI6CqBi IqY7rJu/reCqi9vzOY02M9wgInnHjveIkUK4Y5osCaIQ4Qvia8GBKny+ngQqIy6CZcR9f+d1wGjg Ie2a2Ba0/yi26YJ4Y8ayjV9tNCJv83KN5L/DO6IHCi8Df6X6WMPwqDE1V3bLzsCHOdvpqhVRESJj fS6SFVEj4J7JSEF0GvPSFUz7O0I7IVwK55jfmV/bjW1qdVBSIDGKV0Sfek5EXYO4cIpw98/LOxF9 AH5Gj5a/27MafBh0e5RCqdIkyymKMtyqkM7AMOxUdiFytjumeLmEW7YHIVbSl/Wq3SCqw+FVKQ4A py4diXZySu+IGg18JhOxvAaNNrYPIewOTRwiIVImoqkEl+1lCWlcbRgp1fT2TXt8rr1s9YBw5mbe GiQQHfKpI0QrNJp3tnDMXzVnyhRmdXcHSIgXDOL+meiZeqTQY9cIIG3a/PWaCxjQrvpIxlkVcxLQ Pd4+KC6dgYia6FAwpkN8J2MoYfIb81wl6U1sACUFKAJMMZcG492dxCPixiayezlTAoW+sjqemjAS i9DfGkXudM6iLJqmxGgKigcyGcWKvL8hBpHrj/VrYqdrZlAeQ20w0aR6XggkYyobbH0geQUGqmGx PhwR0D40nqcUCZE9ZxvnEHp2y7U3HVLrzZAucUWVB/IoXkEg+WOuKao1iB87V7aR7YnyyUopkWN2 jYpz1BFq4Zeq6VCNslToYFVIsdKrAPIsBf7BxqBWRIlPycD+KmJx9WbkoDr0RHeVEmR9jZ9KklF8 U/afuu0T5nHtPzs81W2IWyfLcfBQOCKtUJ3HAklO+VGd1yZnwpf92nLqBnui+FCq04i8Q89X7cH0 aMUxP4qTD6VLUempwtCGJovR1xPAKctbFo+rljB2rQKnJs2hajUGcqmWZNoeSZOGSnT+m5nCk9yQ Bq/iM5OHu1uhhnpAJ4o+hUNHDmtoUTZiI0z4dkoheSZIQsHEIVOzghIiBTJgrZjXKqQKErQWh1Lr u7IZv51+VsV1FMpnLBwgOs/VzWt6yV1QGSvfyklh4wfrGmyS6cvxz6+5ztMdhu6ZYilofOkAzrfW mreNfyt9MGBaN3QdKbnFiReLylPT3hZ+8Hf9OrSk49gacMj7aqKNr6ZDlBhRF1NT1goqY3RTwglK JEZ5ApzMHRnxPgEs7TpxoDbJxj0OUCn4uNDPkMeKErmEbEepEAaUUAXnShR1Od7PFJTk4E5im44Y VuPxqPUF+5huW2gMneH9OuadW1M3gzUNPr50tTmd8a+zc+GLiTQMXY06xVhB6+Xl5c/boWqMHuJ3 95MtQ+GnGXcOy3BxaFzn3DBGvB0RAeKAF6Jl8WM/2YAl78dIbSnOcbLWIvsvo//hPnO/nOQcUCaR WoOAI815fSWs5Z0HXohLS1cA7eh7Gkjnp68vSOjLoAc3OBv+yFaoUSgnuP4Diredi28F6KIzXNeF qZlxbnkT7RuWAYb6extrJQTwU3gthOw7JHxcFo42YtWMh4IBbwWKxxhqyuJY4S6d0nc2bohKgEB/ 8aYkARH9MmyI8Y2Sd+SoVjGeCDHQLk5d8wfEccBkDNH+PU7YAws1opM4RPAe88KhxcFIFHrgTc36 GC9vMKli+Mnr2z0rHpC/R18WL9zYF4CC+tAb+EPh3D8FE2NNBKbRlx2/z0yKSFbql8To2DbOz6E7 43DmFkt34ehssl1I9tzGdGnxyRIN7kqfbMyPEskZeH/fj/z8oZv4ddSlTesAuN6g6dP9XQHloxFV 53H8F9WAtw95DssJ4oj/03DS6VKWmCsD2ARF5VLXhAhuAFVVF98Idclq9XBDCkpIXmhscapcNMe/ jzSatnT3wYe+e8PrU8PFhHNHwbUQYWDnGo8vLXC5De8PiN0L2gFWcbo6YqHEA2+QJXR1GJEu2MsU n/xBADbMrgBJiMeG6X5YMHvK+E9VWL/Yy6s0ivOiarEDphPHoQG5J7CxHOkChIjhgI4sOLkqKbxl bc34ixg1x3tO/HR3bQrTqwI5d7Fx+BfOm0qiCCKDxYT8LcTkCVFIVWgNHGeu/1hmGtbbJTaml2sj ebAROzco1ioGR3CvhUT3dQH0Gxgg5dpUotd/hf4XXQw1FEqy/sQUgEE1kWLxHxBnurOI1jcHwQ82 lhzlxZWXSptTjROpfe2wH/iAA1qHnr/UY8lxqDoLcRAXd/hb2fSR4USqcKenIax/vF+z5qvEYpMa LLWJXAiZl2ErtQ+It1+0cc6MpX+Z4f6643bFxwd+HUXn9JOG/4/r/wHxv8TKlf2v3UVqAAAAAElF TkSuQmCC ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image008.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhVQBCAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAQBU AEEAhwAAAAAAAAAAMwAAZgAAmQAAzAAA/wAzAAAzMwAzZgAzmQAzzAAz/wBmAABmMwBmZgBmmQBm zABm/wCZAACZMwCZZgCZmQCZzACZ/wDMAADMMwDMZgDMmQDMzADM/wD/AAD/MwD/ZgD/mQD/zAD/ /zMAADMAMzMAZjMAmTMAzDMA/zMzADMzMzMzZjMzmTMzzDMz/zNmADNmMzNmZjNmmTNmzDNm/zOZ ADOZMzOZZjOZmTOZzDOZ/zPMADPMMzPMZjPMmTPMzDPM/zP/ADP/MzP/ZjP/mTP/zDP//2YAAGYA M2YAZmYAmWYAzGYA/2YzAGYzM2YzZmYzmWYzzGYz/2ZmAGZmM2ZmZmZmmWZmzGZm/2aZAGaZM2aZ ZmaZmWaZzGaZ/2bMAGbMM2bMZmbMmWbMzGbM/2b/AGb/M2b/Zmb/mWb/zGb//5kAAJkAM5kAZpkA mZkAzJkA/5kzAJkzM5kzZpkzmZkzzJkz/5lmAJlmM5lmZplmmZlmzJlm/5mZAJmZM5mZZpmZmZmZ zJmZ/5nMAJnMM5nMZpnMmZnMzJnM/5n/AJn/M5n/Zpn/mZn/zJn//8wAAMwAM8wAZswAmcwAzMwA /8wzAMwzM8wzZswzmcwzzMwz/8xmAMxmM8xmZsxmmcxmzMxm/8yZAMyZM8yZZsyZmcyZzMyZ/8zM AMzMM8zMZszMmczMzMzM/8z/AMz/M8z/Zsz/mcz/zMz///8AAP8AM/8AZv8Amf8AzP8A//8zAP8z M/8zZv8zmf8zzP8z//9mAP9mM/9mZv9mmf9mzP9m//+ZAP+ZM/+ZZv+Zmf+ZzP+Z///MAP/MM//M Zv/Mmf/MzP/M////AP//M///Zv//mf//zP///wECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwj/ALEJHEiwoMGDCAvSwtaqFaJWghINSuQl 0ReKDRkm3Mixo8eCrWi1ouiFxgwWD1qoVHmlRcsrM67IxBIx48ebG10NvHawlSsvXmbQQNAigUk+ WAYJgpixYcOlggS1wHIlqk2cWDkmokgjgVcaLbwsbZWVIStBMpeWxcqT4EgsQ7/O2Iot2lqQraoK 0nj3YytFJb0miJlIZ9+NTg8X5NkWm06gCRQYTTBxMVtsjcka5KkZs2K3g7oK9jJoIcfGn1Mb9ILF q4AWczsrRj2QbMhEii5+UZSIb19ag2Y8EEyjt+qDtFxJLElDtOAZM7KU7pmwscXICYoOkl376kbG PVsB/x2OXYF5BRAQJEBgngaWnZ49BhX8AIvhniz2lm34Bazg/5Gd5xUE5iUAgRdY0dLcAJLRgKBA dglUVW8Q6XdTSIN4kV12sM2ARUzQDTCggRBAMAAERg1yYQvoNWgcSC2wwN2Fgszg1VQTXdVQIq2R iF6ACjzwImKJBIiiF50lcpUg28UHH0HgYSMNTAhgURFZ99HWUFEJRFCiAgsMMAMintE2kDSDAJkA Fp2d0pWF+wWFBU0zdgcSiQQWmIBxZgrUyheRESAZkvElggACD1qGGC2staBkXU96RguPA9klHgIE 5pnADi9GWJAgXhXIJkhW1slRNFLNoJZbddbInYYG/v/4QBmIpRlqAoQaRFZEcHIkCBYtNClQY3OS 1dg1eRmUZqZezWAaQkWSaNSQDGUUTRcI0NBZnwwFdYVtM7bSwoyUFqThAwR6pUhCyRV14qDwwZXA FzrJ8FpBntY2lYVVcSdeooV98UWwfCiFmRfvSjadqV21qIAL3GEhgIE6QcQKYkF9IRta/nrRBVpX zAlsSVTt5QqL6dK7kSA0MIguZc+SZeMANXRmKkM1PjosNmhZGJVQMygFkSu/UpgRrBEMUBxiDUs2 7UBwuWelih2BvCu1VyCZiExi0aBybb0mYqOLHLUSKopGedZKy7j6trIOifbr2SxehHVFInuJ90VB bGb/pqECSlN7EKzoDUe1Y14NkKivpBHkqkCC1B10zFisO1Dkz2JjawJXnNJRK61F8KODtdUNF0Y3 R/UiZ2LlBZQXV3za+lKszSCWn4Jh0VuUB52s5p5uueJKjzRk7vhYvXqhw4Q8f+unRSxkXaOHkWNp I643FyQ2g+Yh8MDhBHUlwKgGWcVQVQPxOK5mrcyl1BU6qLoURXCu7ZWwHrUyXIHD7Z2+RSbxkDR0 tSpsZA1ysCMfz4QCN5KYJipusZGjsNI+7CTgAc2pTVea4xBIsUo2gxhXVPYSG/HoIFgUMlhDrhAz dNHgPji5QoAMZBTNuEIwXzAeYj60qpL0zEqGMRjR/wKhmUmpJIdrGQT3IEAAFGmMIVgYQFhqIxKR +KYzM2hB3lzRnFElSyD2gYjzurWmXlGwKOYpkVc0w6RVJSJ+JskVQWjxhUEUC3QfYqN+mESRMaIl WJ9pSazyRANo/ecBOmSSK2gBmyso53YVwgYiBjGIL7xHQgdMTQUjoykv6HAQLhidv9SSF0RJqAvY mAWb/gUUhpgia9nbD5fS+BVXyMZsKApS5jozQkHICBuncBYlM6TFvHEsX6rJy4BeNhidYcMUEqwh Qmziy4YkJUMD012FYvmZ5ghgOKJTAKJKMwue4Q0i+fPl1iInEVui0zaasyI856kRenLTjoJRo1Fo UP9ArFjFX36aCVX0ApSsGTQosOODQeX2OVdAJ5/mEUBzVKiRhXgKS/W8YkHO0oIuBs0lMYkIVaCD gCiEBQEy8c7n0HI9AO3TC1+oCFS2IpEM/RMxbfxnL53Sy56q1COcqZCHsoOAGRS1qNFLakojIriy VQckxwmqU0ZyzrEwxJ02a0pIsIEbnySGLyIxlmOwmsqfKsZTz2rL2oClFpjgCm9zMclg2MQCJImr ISGETisGUYPJaAxUsGkFeJB5l6lOlQXu8VArukCTug0CJnVzgdBawQIEEDMqwbpCfkBFk+34snZm VAxEbGe7YJXSJIpgGYJsI5VEuKA5VmGBVxwrFHj/1ghXxfNllYq3M25RMGTQgQ6CfmUjB82LIB/q j1F0B80semVghfQTqJpDqA+l5JLHwSvR3hkyLrrgQzMgmpXqVgYPGY0F+NwTbARBi6rABAtW3ANM DTVGtx2HISxYiX26wAIWROFbkC3uVPigKso6SrfNBNVgHOSFonYUfH3hjJN6C7qoPPBXdYEILaJC E6hg5p15oSRD7PirHVXlcHbx7ed0d98Wfy6gENySXndVvavZuFpkasgeKHJOCm3NFOAiy0OewjGB iEVFhOVIcLJY10QUhQZVAU4WYZNalEiktprraCuiIcgHeCgsP5mBA6q0tdi1TyzB7deHshNajjS5 /314c8EMFFGa0NgHWFqcWB0HQxYZDkBJoJPzLKanIbxdAQGAmgFZ5hWU4uwFWF4blz/z80yxSAUm QQuhZloCK/8oOi8b9BMgKZvFS4oLLjNgiHukAuVviSs7LMaJIBAQkUEgijVRsApboRgs2GRrWtMt am+k8p4aNacFInFyfwiVAEEQmJ/GnBP2cCKuFsR0MCHUnZJ8SQNKWntgxQXWkqm02im2AlGabY5R +mNZDYllTVtpBR+Cleis1KhKLSDaocECFQS4QIsjyQ8LLPnevbBUkgdEC5Lyqx4EwFVpuTUqTKKi WZhoRsUGwduqRmI+nDXJsLP4arWugSw/sa/WgikwBc7Yy5CtmG+bUOpIkl+8mUgdizo1/wjGXczz nvv850APutCHvpGAAAA7 ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image009.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAASwAAABlCAMAAADAgy5XAAABgFBMVEX////4uxPv7+/qth3prxLf 39/csSfZpBHQMCnPz8/OrDDLnxrKmA/DLSa/v7+6jA62KiSvr6+rgQ2pJyGfn5+cfBecJB+bdQyP j4+PIRyNcBaMaQuCHhqAgIB/f399ZBR8Xgp1GxdwcHBuWRNtUghrJSJoGBVgYGBgVB1eTRJdRgdb FRJULCpRHx1QUFBQSBxPQRFOOgZOEg9ESjFEHBpCQyZBPBtBDw1AQEA/NhA+LwU3GRg0Pi80DAoz NyQxMRkwMDAwKg8vIwQtIyIqFhUnCQgmOTklMi4jLCMiJRggICAgHg0dExMaBgUYNEMWbK8WLTgV ZaQVJy0UICITX5kSWI4RUYMQEBAQDAEPSngORG0NAwMMPWILNlgKL00IKUIHIjcGGywEFCEDDhYA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABMDhQlAAAAAWJLR0QAiAUdSAAAAAxjbVBQSkNtcDA3 MTIAAAADSABzvAAAE51JREFUeF7tnY9/27axwBk12qS9iLEiTpEXUS9iN2qJN7ZzXyO2m1pmrbqN i6tplcPJtuxk4///N+x+ACQAko5MW1v6FOTTWgYBEvjqcDgcDrRlfUjvJOCMGu8s86EAE5ik6egD i+0IAKvU3q7o3pcCVnF77ylsBwDH4AeNtS2r8INYbYfK6oaDLUt+KFYk4IV3lIq3dkYy8XRiy18t /pBLuCzpiCt41cmri1uL6nZ2n+z+I3hAXnw0sptaa5wwSZNg0LAmHubn1RytVtbaZl5CfnLohuG4 X5nmTx5qKa0u2k9LYHkxzLtpGmFfCFYIvyXeyBrhhJwmWZecEZaMPYDlJaKO42BpzJVmDteaACy+ r5KgiCNqcm7sZTdvRPCoEG8WpSHBEu3C5/EzjJs1qaFaoopW2G9VptnDe1pKq4u2SmBZVgN7FSgY R2nMk4uDTYmUiSbgjmh1CE5Xq56yFsHOxF2bEkIlng3kPIKcLlZMWBgsZIWXGyO4LJ8BedwuEDkP b4I1BsrNRnQHfgDe7j8Ay8Jnqr21ZXMtD0FMchBOZifjFWEGYp9o5IgErPkT3je3qyfiMyLkmm3k xg8eZF8XZmY3EpfTlJUB3pCr8s1srXWD/xgs1f7NYWHr4MvMONhZ5/N2W10UIAVWlApx0WE1EgaX wyLJ5ZoAXH5dQECBRe2S31f+0EYGS1nlRLlkHRz3WkfTTmcKQ7IzPWz5s4PO8bDVKhuGw2nn4P9+ 1RrODlqtw1mvM/1tqzfrtcqHofKFcStVWKScMpKlsCwcxoIP1G6miRi4OixrJPSvckO8OQmNeocg FZosY6PSF20JpWQpsByWb9RZvveqH8WHs4nfavUn3/Si0J8OZuWwZoOZP4l78QTrDeaHk/jwlQv1 SnXWtbC6SCJT8uWwUECiTLS8bNwasEQJRbJyKVPv0JZfTgYrNOnhTCGGYXH9TLDs7rlrn3s2wnLb 88CeB1YVLMs7tyfnbZfqDc677nkX690clk2KRSr5cliggBXpS4SCMXSWLcVThYXqjvLxQ6YbA2Gu KEOdQZsZqLMyWE0p3AzL8gZ2ZDEsa+BaMGdVwrKihjuwGJYV2F2P6tWAxVOi6EgFLOyEnE6dXMg0 ycpsCwVWE29NY5aUoxQgKaQ3g+WISZSHoW01mlZTwrLa8O8aWFhUwmpAqg2Lp0T+AitgNbCEGCph rr5UWI1YioACK8ggk0GRiimgHqzQgMUNZsniVC1ZdFlIVlavjmTx/MWTVQUs9L0J4QP1nmmvHFbb ibPxksFqIis5GdBoh7lRnZVvIFnNbpjZOyRZLg1KGxV1f0Kfm04VLI+GvRdgPS7r4MRQDxZajGmC d6yClY8nTzG52PCQSZWsgT3y8KZpmFm8bfodhnNuA28FK3+AJllhBL0eeCHCCkOYDZxBWAUrHEBZ WFEirHAChpJL9erBYusRlXwVLAuFhGgkcjgKRRTium0Cyz5NsriHIX+l2ahj4Uoy4doKlngATNo6 LPzVTRkWqlEwWXNYH199fp+WPbjcmYUpDFSQTIIlPteHRXYnqvBKWDgv4fhzsiYLWNmSUYMFE1U2 cHNaTVo55TbbVrDkA6T9Luys5ChwYTCdI6x0GLq2ezwXsB599ofTxeq7z/5XwpofeW4QDlOEdeIH XhiMsV5NyRKz1agaFs39IMyKejdMB7IiMbHOImHNLVlxjRhmZt2NYME4kg+ATg97/TAKA78HVntv 2AtSNzzqAAC04J+cLjAtPxGw/M5R6KZBvw9W+2HHD8DB08d6tWHROEu7lZIlVi659Y4N10yHkTEb OnhDVZ1TVxvss+Bu3wyWrcJqtcZJFMSAB1M/TicxyBXD+sV6DazWq2cf8TCE3GSSJsJX4SdBlFC9 aljql6wikd1hJT8oWxtyz9DSt3PrvQArG21yNiSng7A3FGj0rdSBlT+Aut3p+8d9WO0xrfGUPwOs 52frzeXZxcXl6cv7Alan5x+CWHHq+WP+XA4Lv2R11VAGi8dNUg0L/AYp6HFVZb9juYP4xdJAW1re DaxyR9Xs4fOz1Zv1erO63KyB1o39WYanA8VfytlIGSiow3OohSHCZiVMO3kyYTXJWMvtLKzBhn9m UIrrdSWLLF+c1Q7AbUBeh0P0Ogxb/m8O8Edr9rvXi7erq8XbxRv4ufoUYQ2nBwcnx7nX4WQGXge4 R7lk4dpO9bHE2fSvwkKf0zWw2NDXVLYJK6ClTW7BE34S6UBxA8F1YdfeTGeRkkPBJhNg8KofR8O5 C5qqP4n6sfQ6PD+7XC8R1tn69O3pMzId7Dl4HfqRx/UOg/A6rwMZ4Hk380kYnq6qYCyWmwKmekbD VNrjuWSoHhQ2K5TlDlmtKG0jtnkxoYTWUvDgTGTKvDa00evg4hIHvA7fhuB44OXO4z8vLtYAa/lm cfWEhuHMcs9tV3oduufOtV4HqwkNzGzBQd5woKh6UKXvF1uE4NRrnKU4VQmBogsbIHlETvU60IIH MIHWlM+Hu0i1j7KqbXNhcfWhaP7JORDMzoQHtVhIu247ovUgrA0dxevw+Pt/LQDW4u3lx8IohSrN 3OsA2wfXeR2EgzdA9/YoUlhBHyJ1CwagCknBOUG/Rk5ezRSwaUrwaOsloPUlXtZqkvs/6ZLWTCfA oQ08JDaqry4WyTRWGtQkq4wfQIsERitgWQ34J2CBUwH6IS34B3/bvLy8fJxZ8CDOWFQspNHpcI3X AR4gjWdo6kQuzsTmSaz419u5cGA7AYUYPPQjVBUfLJ3NBIMk29yJeNjx+jmx04DXiigqfCXbupHP yKqKsIZ28QGsayUsug1LFqc78TrQnRpd+oYKZqJKw7K6111vv6OyfivtN4xVaOKm4kDfTLymSuUl guWw1wE9DXfrdajTove4DrtoIhiS3QAXz1t4HaBsEPFCOoDB4l3jdXiPO16naQxLeB0IFhpGsMSv dNGwpyHKvA6wPVq5kK7Tove4DsF6NQ4mrnf8e4QFXoeJ4x5Jr4O6JU2mw/xogt6sc6w3Hwaed53X 4T3ueJ2mISz0OiRB6KOnoTc8AC9VOJVeBxMWFCKvQy/3Ohz2wPKvsODrNOn9rcOxDsMkmiTHYh2t eR1MWCBbqep1iK71Ory//a7VMhEY0h/7/Y70JBz6Pel1KAsM6fggSTKNx/xpjySryutwyyiaWl/f e1xppyFH73G/azWtLJorW0yY8VmFZYaSUevpP7JKoQFEH3jb/7YfOkuD9bNSOuW5P9GV/49MSGo1 V5OsX1/++UEB10elufe/2HzBu4mc9kyyfnG5gW2vi81XGi7KXZq5H282y8VyswEn137CeoR7XpBe arBE7vILLffjFRVd7S2s5+uz1WL1evWVOrrulebe/2S1hn3q9epFVna/hiHvEK43b5Z/V/TWs7Oz i6uz9cXV8qv/yWTr/svTzRnsJp5tcDdx/3TWR89OYYfwbLO4Wm+WP0hakHvKuWcXee79r09fX25W 8O9yffq1oLVPkvX4FHcIl4BlefV6+UKIy5PT5dvlG8p9c5rlPl0ucSdxQ7uJy+f7J1kPr67WsN+1 Wawvlv98/UzAengJ+4aUewa5Ups/uXh7enoBuRenp28vnuwfrHsPXy7OzgAA7HvxVg6lh1/D/moh 9/F3i6sV5MJm9Q+P9lBn3bv34MVfEMDi7WdPFSvhwed/XWLu37Xcx5//sMDcHz7PuO6TzkI+P31x +cV33+dixcwg99Pv/mbmPvjT9y++/5MybRZgtfmUkEzV+1COHsZQWa2ZX9FiIGN1T5FXMUpRrHRn p1F3tpA23Blq4JG+LqO4zDzpng2lmhJ0m2+s0261sdkvognzG6nFa60JZaXw+dPq9FPNbL93Tcmn xWHY7FL0GG2f29WnsttwXd1CbXTlBjIch9O61rD5hmFXvRvkFWE06EwcpaB7+83VDNaxX5lOTH9W dVG/VGcJYSgEeKoM8kB3mUuhgIi4KAUorhx3JROFfpfhcPgm1RJdQ8Z26iml8xFagFahhVxE7y0F dZhUqCbQ12OPCucW8wfwTe70RQM7hYXn18pGiYKMhU+LAhHxMCYWrASSZRTlCPcyJKw0a8hPdZX/ Niz+/g1xoZjbkvhsFEPjrDgVLB1su4IFu2B9CIukzTAIqD30O7DxWn7esDPutGD7C3/Q/w5hKwxj cMu/wndKFgRGkWwYas2higWbALJ1jQVB8lS9aD3IyKI7l6xxOOskSf8oohMWrw6+iX0/qIh1gAu9 NOxNqWw076TJ4VE4rQ0rTCcUUGr2lkXLDDQCYdHNBLAbMLawRAh3Bsu3vZnrTEM+FWbPwvYsalTB wrLudMJlB3PPnocYy1VPsmAus1nFG7YSETRtAihtQJ1AERdLaqYaS9OOhiGcN4xcO2mKI3TexIJo zEpYVuTYcUOUDdw2xGnWhjXBXpJJZNhKHM6txb5DcJOpnICeAyeny4Rwl7DadgPiL0lawCi24Huu htWGJMtiLSpbS7IACSgrNEsLthKFcxumFgDUpz1+dQGZqkWjbHeSRYK7zeFMkMLSsrVgOTwNUreM 3rK8aHOfUygUY6wYx9gWDdNdwXJoqdl0ULL4pF6jnUvWL6/EphfGZ/kOzd1q2SaWrQUrZqsJKEAy bCVer6gGOPRe1/hQjyrRbGDYX7sbhiHG8XZdcTgTxqDdlZF/P99cwlbY5UYeoYPoLLiulm27WLYO LJzLSEypt8bChAenYoAV1TtMpVSdYJum2s4UfJjg4cyEYSXQbyeRsJ685iN0n+JGKkoWlQ1kWT7U WRNW9v4ZmtBM64GHUW6AgRbTX2cFOFnSeDYw33W1q2EYzwK77R3jYbh+chx22870lRiGz8QROtz0 IljJ1GtnZcHcaLszPHBXQ7JAVITBwNaDYZhSIL+CsKDeaSqlRLNBOWxR4m5+UEzpMcgTHM4cIqzj FoRJBsc9MDT5CN3FJWyHZUfo/CHEM4fBkMoe9YMUwiuxbA1YXt4/UlCy67Jj+poHxpo+B/BUSoln A8NU25FkHbQO4SAr2OQU+9ePUjcShzOfwRE62EsEnYWbXnyEzo/CEO13Lhu5MYVX1oCV5COHJzTD YCdVlB/mNq/DSaBsTiAwhqm2I1jQaf/klS9Op3b8o9mYAiFnv6MNMtjDgP9Wy08YVs8/OREnMuHz 7ISDJm8OC1jkEyC5sAzrQRimjLCo3sVUSld5yOru453BqgiTVI7QrcQRuvKSdWBF+uuzsLeGE4/d N4ywoN6Bj1KchqwOe0ewOkP2Hgwx7HZ8AOd+pdfh8V/MI3Qd8EiQ1wE8DR0fBjD+XsfrACNPlQSa 0AxbifU+Mymo91BzQPBaUjPVdgRrHM5b0nvQD7/tfJOMx6i1QME/yo7Q/VLMhsG8B2Hw0wAVfPBt J43HR+ihuPEwnMAZNiXRmsW0ldgwRYQwZnW5gWHpKtV5HGqm2o5g+bYL3oMZeQ/6bhfsgWnudaAj dFfZETos6zpz4XXAD/W8DmI5w7KTJcN64EKIsGC989rRSPnLaoDvzmBZ8OIL9h7AQhpeUAkjpHoh HQ5yr8PEbUJfakiWsrGl9LjcVhoV1btQ/iYtFfbuYDW7wtMAsMCTAA+thtVsNnOvg13T6xCbRiRv 6Ri2EpsUcVG9w7DULXYeh6qptjtYbNxtcTjzjrwO0NnSTQpzC5AROqDe9ZkyrnDbK6barmB12euA 3oMSr0MeN2p6HZTXR91QwQMEc7OP3X1GLkDlpPveQeJMBxbPh0qxSliT2vtjfN4whG+EvQewmIHP uddB3ZPmhbTpdeCyN4MFg6awjaxaVflSTh5X1scnzJ0ma6HF8uwqWM0yH/R2a8cAdnV8cDiQ14Fg oddhkHkdirCwrCe8DvhcqnegTUTZo+nbLtldBwSFbWoxPxpuLTER6JofihZvmtsZ/PgqWGHR9bUd KtjjhZWdH6H3wJui96CfwGd4L5v0OhRgJceTQTf3UAycAXoohuXBFxWw8A0LxQYW3X1QRgiM7uyC ksWQgNzOuBYWDNfap9Pb5x30OoBrCbwOCOu4g4czj4TXQYsMoWHIXocxWvz9MdSDE9JQdmZ6k7jB 5bCQSsGxKRd4JkVGqA06xFKyB82TQdaQcskCJVg+CLaSLvD4wRZrFLrRkfA6ACzpddCjaHghPY4V r0McuzE4aPoFP6UCS7x7WraGX/tVFsvBKt7ATgKjyy1oLNVGkDdmFZ89jdnpUOnNicY+7VaURKF2 Cl6Dnj9/JY9cHviz8yPQZOU70vCan/F0Kr0OHX86G/dbnZNywYKvEVPEPn5I9N6QYu/FVb6UvTtG 5KJoaYMO71oGi40yKbPslk7jgRx0bXvAIUvlbd2OmZMSmZK07SvOe/OS6CBQN/AKl6pUEoXUYMlQ 32PIgPWB0xChJIVxKF8ayX+iA02zinSreK1uMlPO8SrQtoPVOy6NyxBvqC9vcFFtaJ3T/3qL3Jcg dChWQmY04FkEHF4Mtd+MJpTFRWwnVlSqAa/un8+K6fyPT5Wo0cfP05Iys/NkUvpVqX8mofBnDgqB jfnfbKCy2h0d1Zej/E0GbVIr/iWFqpzis2+AiooaIavC+eFMki8Frqf/gL+uUJbuLLq1usm1p/qb UrhledAQ6J25/8fox9LiW3b4dtXbySNgVarBb3fj/5e1u/+4/+UHVtt+tcGXhlm5bcV9LNe+lRm3 b8TiW5lxe0brTgPv94zdnnb334UpAjfQxejsAAAAAElFTkSuQmCC ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image010.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhZgAjAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAABl ACMAhwAAAAAAAAAAMwAAZgAAmQAAzAAA/wAzAAAzMwAzZgAzmQAzzAAz/wBmAABmMwBmZgBmmQBm zABm/wCZAACZMwCZZgCZmQCZzACZ/wDMAADMMwDMZgDMmQDMzADM/wD/AAD/MwD/ZgD/mQD/zAD/ /zMAADMAMzMAZjMAmTMAzDMA/zMzADMzMzMzZjMzmTMzzDMz/zNmADNmMzNmZjNmmTNmzDNm/zOZ ADOZMzOZZjOZmTOZzDOZ/zPMADPMMzPMZjPMmTPMzDPM/zP/ADP/MzP/ZjP/mTP/zDP//2YAAGYA M2YAZmYAmWYAzGYA/2YzAGYzM2YzZmYzmWYzzGYz/2ZmAGZmM2ZmZmZmmWZmzGZm/2aZAGaZM2aZ ZmaZmWaZzGaZ/2bMAGbMM2bMZmbMmWbMzGbM/2b/AGb/M2b/Zmb/mWb/zGb//5kAAJkAM5kAZpkA mZkAzJkA/5kzAJkzM5kzZpkzmZkzzJkz/5lmAJlmM5lmZplmmZlmzJlm/5mZAJmZM5mZZpmZmZmZ zJmZ/5nMAJnMM5nMZpnMmZnMzJnM/5n/AJn/M5n/Zpn/mZn/zJn//8wAAMwAM8wAZswAmcwAzMwA /8wzAMwzM8wzZswzmcwzzMwz/8xmAMxmM8xmZsxmmcxmzMxm/8yZAMyZM8yZZsyZmcyZzMyZ/8zM AMzMM8zMZszMmczMzMzM/8z/AMz/M8z/Zsz/mcz/zMz///8AAP8AM/8AZv8Amf8AzP8A//8zAP8z M/8zZv8zmf8zzP8z//9mAP9mM/9mZv9mmf9mzP9m//+ZAP+ZM/+ZZv+Zmf+ZzP+Z///MAP/MM//M Zv/Mmf/MzP/M////AP//M///Zv//mf//zP///wECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwj/ALEJHEiwoMGDCBMqXMiw4cFWghxKnEix osUrrQZm3IiNYytaHjuKzGiQo8CQJ0eqJLmyJcuTrViGnAlR5B46dDDh3ElHD6lRpEjp2amT58uO LFiQFIRREIsrJ680ZSGo1RWlJ6m2enrFadWrTDF2lHp1LNWwSb067SqV1qc2mODKjevpmLNjzebE 3duGDtyIBZ1qBMwiAGBBEbdGFGQ4KlKoAiMmFfgUm2Cri5VWxVYZYqsAAwXR2oNpj+nSpunkadbM WbM8dJjelE3nKDapGiE7DZARcUfelCF3FdhY5G0WAsuCNX45OeTfHj/RMQVyDnVsdOredTYnNjbS i6cb/yx7EjDUpDETUz0J2upG9FIzgnVKsvDzqywrs0c8fE8bKEzRAeAVqjljBSDHdPKfIFDMAWCD tpE3VmS/dbURcMHVlCFTyT2FYXIBIGeZiM5ppBVGtJQCVwl0RIIJi214YgUECQCSByZJQCGXjpgA RpBg5SXH3nqKDXQVVo8VFJ+EkVVG30D6/abRdzo9kRNRTySQgAIJQKFTEleCWZtBT1p2WGjFffjZ c9gUZ9lxFd4GZWYE4cbeUq1IZ0pV0/GphxUz1PhEj62AB5F4Bj3FX0dbxZRcZmz61uRZZaE3olRK xcfZeo9txBhigt20R0d0jNqKas2MMsprbphi2Rzh2f8Gk0yOFhSTrLPeyiit6fE6q0a3ZuTWf1IR e0US2tl1I1VJvCgIiz5aJO20C40WFxQ5/ZfTaq299iUm4IqJK7XkTuvKHnN4ku666pJil7J0sLuu HtGWay+1gaSaKiCA6Nsav3atCpQV7qY67r0IM+TKKgFfocAMo2xnBQ01vktKAjTIsF29CXfMUIrN HGNFAjTK0NofWtJISmssaJmAFQZ7LHNDC7eWR6AzVOGaMyxQfEXExwCCMQvuOsOKrVM6ZNKUB7eE r6qj5KFHHlAL7G7VelTxh6p5vARRUmIdNFxWabHEFKcTEmQV2E1X6x9ffOnxLndwy+Wd2oVxTLba IR7/9RRLV3yYleAWWUsUUdy6dqNfV/Y1ppKEo+nmbZM3amIAbFIWOUV5TtdVn4JkN7deiJG2B2KI 1rk5Z2v+GCLeP0oFGt6zkysqqaYWqAeCebgRkSmwkmpbYbJyGPhLec9JEHKMZU48uSnmWCwUUiE7 Y43LOuUsC3erLutwzfMNmeWRAdb35faS9p9eDuaUJcldfpkTjjhFOLljlJGoeW9shv3p8quTSJ7m oAcw6cWAepBBoLowKGx5CSfYchXkItQV/kyOMchBEnEQY5XXQal21DLUqfbQikSgCiivmU4rTKHC Uw0vcopiiwcHEgDM9U8qTNlNfgLokGGRsBVJ+CGyn0ZXGipBJXQcO56t9MeZC9bQR+SLDOYGR6a2 FcQ/SbgCtrKIrcSlkHpeAiMU7Oc1DUqRTZ8BIZAAWB/BrVEitNhii+jXhk4QsS92SwLHdhPDwJmR cobJz/jWRKsaaqaGOJSd3hgCEdOY5hOOLBggAuHISkpQbaDiD6iOAhFQqc1sHPxRJkeZSStOpBWA 0IMpZ8ZKi2ymlbCMpSxnaZCAAAA7 ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image011.png Content-Transfer-Encoding: base64 Content-Type: image/png iVBORw0KGgoAAAANSUhEUgAAAI4AAABgCAMAAAD8bbrIAAADAFBMVEVqk8OZt1q5ysbm7dltgHDc 4tWyyOLi6fNecYGuxnyjvdxVhljk6eFVhqxCXpB2lUY5aYcjUplugm6dumQAT6N4mzpqfXVIYY0c UZtyiWF1kk/V2uFGeHpkk0c0WJRZbIVWeHh3mj5Yg2csVZeMmpt2mrtFYI5idX48bnx5nTYwVpVm eXp0kFJVaodYhYUOT55whmfF1aajuYt9pS4XUZxwhWlJe7lgh6ZOZYpri1eFmbjw9Pnu8+dzjFt6 oDKyxJh1lEkuXZV0j1V5nsm2zYqZrMnR3u6xur5RZ4pqkbU5WZMYW6c6dHGLqMhyil+7y6GmwXCo taXJ08OEoV1beajd5s6Hpk7L1eVkdnxTaYh6i6gET6GaprE4Y4vHzsvb4uiIl409aadFdIpDeWlM dKv3+fJrfnQrZIlSc5g8dKnL1rxvhGuTstf29/Yra32YrnnU3MmfubBOcIPG0+Zymafe6MxLfmI/ emlBdW5gi7qVtZdWfrTByrwqZa0RT51zjF2VpoouapNXh78JT6B7o0cXX41Nem63wbWzvMtCZJt6 k5nAzdxnengoU5hsf3I1cLRpe3dnfXNfcoAbWJooXaKEkqOdt7w/XJF2oDVAbYNJaYl5iIw8W5J3 mEJhc39+mlZvmj10jlh8oy9yhZ6httHb4NoiWJp6mkVcb4PO3bCPqG2bqJ6ApoAqWZhrfYckX48R WpRHZYw4XJMeXJRHf2GEp9G+0pZxiGTB0+iFqzt1k0xld3zW471MY4v5+vUfZYaNsEhLY4xvg2xb boQPUp/A0pmQqWrv9Pk1cIw+dZkIVJygvdzH2LhXa4ZljqFOfZJolVhokrB2jbWNoH4yXZLS2OKC lHt/n0k1YJ+rwYNxmnppj0tTa5TA0tNid5qSsMTT37d5jnFegW2gu3hRbqGhraqerrpleory9uuw vqSstcLP3u1lgmlrhWdAZoyBppR6oYdpgG+/0r9nj3hhi5BjkYhegKuQrlWOsF1+kINifIa0wdbW 4MaAj6WBkJX///8Cl8ldAAAAAWJLR0QAiAUdSAAAAAxjbVBQSkNtcDA3MTIAAAADSABzvAAADCdJ REFUaEPtm3lcVNcVxweZzLAYNlkEWUUYFq2YGRB8YhAVCShJk1ghVK0bxoK2orjECA0kWhNBFBPQ COJaTFziMrKJCpg2rSE2ra3p3po2bbrY2rR2SfXmd+5984bR0Yz58Oz8kfOHn2GW977vd86559zz nhrzZOZEpjEbTzsXTvt45+GBOkYX58IxnnIaHlLHaHR1Fh6BM8S5cIwHnYRHqGNsX+gcPDKOs0Sz BcdJ5NGYw7i3LPKMP3Xq4P/RcRppseBp58Ezmb+8Y9k482uVlwQNkxY3cx5KrlNCKeMdysaZyS5D /qBqzGsYk77bQAgoFVK7jONu95xn3F1cXN5UG4dlxcmSDJJp7C6LZ8qIxkXdfgTqMFbiSRyT2St2 cVzLxpT9780hxAKzL9xAScZx2IPkLhem416DKec8PdmF/o739va+fPlL/yKeMwN1anvHEThZ83kA S+sFjdwBubpbYimgo6MjI8Pb+1sgUjV4BA7TkC4HmW440TT8nd4qG4KXYfOXHq07cODA+fNH49aP 7OBEZSrKI+PoSR64SB/zt0PPzMH5xgOmeVrdxKt9TYbOxE21taVXj1YtWk9Aj6qPw94VqW6xMe2A OXAsosWtKR8wgUVFNVrtlu11dQB6+D7g6Ci5lPO4GxumHe4uAI0hPxEwNVo/v56eHj+/SNOJ4R1f V49HdhZjocCRK8BCF2PYUa+u7L5eQQOYnuLk5KSk5OJiP5+quI5dY9QCUnA0wJGD1MXoeSm2O3tU L3mqNhAwyUmtwkAUaVqUlqFW/Cg4OlRS0cK7Gz2jvYK6Cvpatho4TXFSa3BeXkVFRV5ecGtS8bW6 E2kZM9TRR8GRVso4p43Nl3Z6cXEMnZsCazhNRfpusvSKPMET8jWVcdg/Bc7C9uZL4fWxiJyWrXBV kRY0eem7M0eSZe5OJ54tdT4h6sSzog5bIXDcjbMScryCUgsi3JogjrYnmWhGhoRgYQ4JGcl5erac X7/rq2roY8VBDw+c8caV1YTDfSXECa4ATQeqlrd3BvEEtxb7lZ5P61AjnG/Fmdw8tDp8J/Kqrxe+ QuSQOJmgaYyKimoET+buvNbkHu3ERaqEjxWnjdSR2qcNjQYOhU5TPvkqqRXiEE1AfEBAo3cHyZPU o910frga0XwLztvN5cChSLaETlIwIifDOypgwoQJ8VGNkAc4xdqiWT4hKvTNNjin2fvTyn05johk HjrwVUZjVPyEPRPiIQ9w8lqB01mVtmvJgEezDU6Z1PyGozi1E0NDBr6YWnFKUEJfCvO366wOOCse 4vRzVu2OoyoEsxVnmfEcW3bSf/QtoYzMQp5TKAeAhkK5gkI5cFNn1ciBX3r64zzG/roUONUJSqLX yolOqdUY1cgTHaGT7Aec/APDH1Axdg4Zx7BDL/hXAYdWZZtlEAsP2kDvjA4sgxCn2K+mNtEwMVLN UP4+2p3h/v5VJt+EnHprkcA6iGU5k6oEagQvWlgF4SvDrHkDX7cUZ+kbzjE239+/UE4tKqG8SqBo UUGnGpopl1AtxMlv2hE38AuhgjMI2z7CEcEjGgyqoaLByEunDiM9nTc8FDmdBrdjcQ+pFzvPUGtK OLK3eIdhSCQeagbRf8GC0Q8SDYnTcixOxcx6Hr7iONxblFujsDCLVhmdsuhO0S73yDRuvVfnDbg4 zOKsXyCvGPvoe7K3EMxdSrPMW3f07snJxYCpgTZwVW/fsenq4TzEp3HvnCV5TCQPdWDYSvBtFm2y /Mi02poi8pTBrSWiIPUl9XCe5217zFLg8GDOqY/tRkcIHmxCa/m+D1YUGFi7CXEDmlHZ3XNUw3lb jCpLThJOYbnMky148hNpV8xtUyKkETRdPx94Gkvs/FvsabI4DiUXuQvhDH9hX2zI7+xM5NYJmK2I m4LsrqBxquGUnZOnpaEvcHlGD5V5UgtGQSC3rU0GYU1Nbm69EaOIxutj1XCGWGalMZ5cHnKX0Kcr m4Ba3IC0dSv+bemNgDSp3bFeG1WgEc4qe8xyaA9PSnW4i/MgnoO6UwHUFxHRyy2iD8qkdgXF1u+c ohqOu3WwHbqK41h4IBABZRcUjCIrKMjmMF71ORsltXBO9+vBJ4W9ofD4RidAIALq6koFU3ZqaldX N8HszElQRRxlVbZcqj4uTOBQ/PhWRyfkAMgrNjZItlgvgglPWKCGNhgK3npYTfM0C89oEwcKz9m5 sx5MZPXEEp4Q/V7WfcKR3jLyZBcBJIASwsNzhIUTS7Wvr4c6NLerg5l3g8JTyIFAFA0msujo6mrf oSa1aOzgsDVhVh7/wqrRIAISoKCKL1hM5arR2MPBLZMGXkrlkCaicpOw8vLRVbkXVPIUDntbKFPl eq7BKC8/ClJhFVlhYaH/5j+pR2MXh/OEUetzu+WaVYSxrw70WYDBpR2gXPN3VKWxrw5utFViconB u5JjpFPlBZVh7qQOJNA9x++RNoStWrX07NmL5gtt6uoijm4vlMUnkvkt+SYyqO7XUxF3xgFQyeKV 4ratU+BQzpsfjDsZ1uAsOLyB9jBrVNhS2Q3FuznrfsTuLef4HOduon+uzgCqs3x6zPXrUz627CL0 P+I2TDbLicYPmjpixNTZltHhkv0wfDb4AdkGK0SuM2BlFnO9y6p8+0VI07eJ1jBho7yPuB6EXQbt e/hOrEX8ZPZNvqcPDCzaIIBexHToh4y15VVghpaJqV5IyGtiUqV/AuPh+HjcX9izhy+29xA7Wet4 W0g44eF8g9523AbnZXpvyYh87OcFTs1XiCcrEjhfZOyRfjgdGXyQZ6ZptRXn1D3g6HJFlypwcmiH XoL9Tj91PsBbc45gvqDgaEHBSq4B51nGLtrgZJA+K2xxyhzHaeNN87ZKsybXl3CexNHWEM7hwxO5 XXp6DtT/vQE4pWPXpNSVQp0aLeSJwT3v1sFMCgXOlThYaBrG1BnfxgFCgRO2evV8YYcWOoyjzyUc 3gpKm6tpo4NXc4HzS5sY24tRR/4HFOnS5lIams1mbCzhoGO5AhyIxCSP3DR6wATwK4Hzk/4HcDR2 UqiBXy5+mWUSONJh4NhMeabQ5GWq+Ja0jXA2MGk7cL6BOMG973Rx20AXRzgzmO5nwLF5RMBBHA/a 4SjfTYHpcNTjwPlmv4uTngbOq5Y3NPkcpy0SOB9CJMKRPzsqcCZFAcfmJp2DOCmEo7fxC66Xtu57 n4LduHHj5T8yto/mUnCPMHMpxzHT8xKPMzYPOEh3bhzHlb1DOEMsRs84OIajLwROJT/S8pnCwLaW cJTMgkxPAueIwmwmZz3LHiGc8UwfCRyIxI07i7HVhKMkOsnkGE4JBhpVJXQgD0uiY4r7ng3OMKa/ CpwRCs4kwtnPLgLnN/jhn4EDkcgkPHaDzMrytMGhTxzDqSQc3runWHD0TJ9gg4NY2gEcOZDx1euE w/SlwEEkT6LHOOTqoKPMepiVZPTH4e24YzibCYcXKpOM81tc73HgxJhlw4TFTDNNBUeiRH+d6SKB swETdMKRlYuhdceVxeDefMCvLAfgh3cMp8qCo6ek2oZl8Ae4XppCzVF8cyvOPnoKaTabTo/+oIBu Bw5E4r66ApwnGPsHcC73+/294SC1uWVVAwc1dC3h9D8aV+fL8jvSf4HzH+Q34SxBugfnVUAksldw q45qxHzgvP9ZcNaROinytS2gmjWTsQPAecoGh2LniNxW/I5KKJLeBzg/RuH6C9QRdwcHpwHnNRRg T+A8+llweCiP1pB7Zy7gJVRibeHAGWftd5YwD8osw016fnb/CKror0PKUuCgkMbQHbHHqd/5kBqM XchqM+72Ro2x9juOx44HrTuoWQvWzhWhjAJagiFv/3UHMWHi4/n8myNe5Q0GtRce14CDSjU2mEJZ 6XeonL9LONZ15x4yi62zjsGqqxE7qFQajHj74ezFCSZd4jhyg/EiuS2GnmLbj8LFn9eScdL4+vMF Wxz+bK1jmcWycpWp3IIS4OxDObfF4SFcOdHNgmPgdZ1dJxzESaQVJ+2jOfSJfr0tDv/PCA7iMH0K 73dM26ZLbaahc1EiTHj28zA36nY2DuMxac69tKOl01B6dZw88Djh4+OzDO9v54ZmZ94KebKoW7ra YtTs/JQ/su0oDq7GAwuW7lNH/220rLV96tdsE0r56xNdmQPiNtM4+gAAAABJRU5ErkJggk== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0001_image012.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhZwBNAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAEAAQBm AEwAhwAAAAAAAAAAMwAAZgAAmQAAzAAA/wAzAAAzMwAzZgAzmQAzzAAz/wBmAABmMwBmZgBmmQBm zABm/wCZAACZMwCZZgCZmQCZzACZ/wDMAADMMwDMZgDMmQDMzADM/wD/AAD/MwD/ZgD/mQD/zAD/ /zMAADMAMzMAZjMAmTMAzDMA/zMzADMzMzMzZjMzmTMzzDMz/zNmADNmMzNmZjNmmTNmzDNm/zOZ ADOZMzOZZjOZmTOZzDOZ/zPMADPMMzPMZjPMmTPMzDPM/zP/ADP/MzP/ZjP/mTP/zDP//2YAAGYA M2YAZmYAmWYAzGYA/2YzAGYzM2YzZmYzmWYzzGYz/2ZmAGZmM2ZmZmZmmWZmzGZm/2aZAGaZM2aZ ZmaZmWaZzGaZ/2bMAGbMM2bMZmbMmWbMzGbM/2b/AGb/M2b/Zmb/mWb/zGb//5kAAJkAM5kAZpkA mZkAzJkA/5kzAJkzM5kzZpkzmZkzzJkz/5lmAJlmM5lmZplmmZlmzJlm/5mZAJmZM5mZZpmZmZmZ zJmZ/5nMAJnMM5nMZpnMmZnMzJnM/5n/AJn/M5n/Zpn/mZn/zJn//8wAAMwAM8wAZswAmcwAzMwA /8wzAMwzM8wzZswzmcwzzMwz/8xmAMxmM8xmZsxmmcxmzMxm/8yZAMyZM8yZZsyZmcyZzMyZ/8zM AMzMM8zMZszMmczMzMzM/8z/AMz/M8z/Zsz/mcz/zMz///8AAP8AM/8AZv8Amf8AzP8A//8zAP8z M/8zZv8zmf8zzP8z//9mAP9mM/9mZv9mmf9mzP9m//+ZAP+ZM/+ZZv+Zmf+ZzP+Z///MAP/MM//M Zv/Mmf/MzP/M////AP//M///Zv//mf//zP///wECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwj/AL+wwkawoMGDCBMqXMiwocOHCxVxuQax osWLGDN+4QIoo8ePIC9KBHQopMmTKL8E4tgKpcuXFiUa2nKIIsybOA9u5MhlYM6fN2VyMdQRqNGU KwGxPGjzqFOIrq7MBLTFJ8FDhwDJamlx1lOcrroo5WjzEJctXHpavIao5FeYrmRMRYSNlaGhW5RW bMWKyyGrb1EO4kgTGyKeSgF5bXiNFatAhwIBDmyylZctd7EJmnk3M0LHgVZB9uuXJF3KLgdzZOWK Z1rArLJSTcvFShcuSUkuRn3yClVWrRLxPNSy1bVAhmR0mUEjAQ3mCbDM6GJl5WTeH4X7JdgKUSta BPty/2FOA8sV81fOk6dxOxD2k626YN7N3ayXGdK9XNEv6EqXK/3d91wgXL0HkhdpNYXNLGbRUN55 +6Xnn39d/Pffc12cZqBHwhliVSuHyEBDC/nNoJ9+gVwRSHUqsthcF+5tmFErrxXUl4NYPGiehRRW 6KOPNDzQRYEyWmQFIKddw4UXLpTI34QrRlkdiyk+h4iCRT4kSFVXXeEgfligN6GPXLRXZoUTPndd lgx5YQhd8TlXHn4RolgdbndKmWIgzFmxJpsJIcLlIevpOGaFZdKW1m0++jcgoFoCMhAXNCgwopMA thjlUDxFqeJ+MyBCH6SBbjFLfJZ+GaZ+6VkII21j4f925oVX/EkqQZvx9UANzuFnYoT/bZpUp3im KIiJXdy6kCAdeQFBqjhC6CqjitLW6H/SBYKlsgR1QZwXllpKoom/9kedsLJ6GqCXyXKLEGTX0PCs g8+FKea0tK10Zo/pzZCIuwhN1EqlNVjaJIl1ajrlSp6meCJzXgBsUCuAUPTAvC7gSOeOhzL6I5rp SdfFqNyy0tHACsw7rnTm6fefuQt/+jKo5klckGQLzhBByvSWJ6bLaF4LMoQ5/msziMXpoMDONGQ8 7n0nRmjup1E/7AWR7sZWkLwpQ+uzeWCPKTa2RGNhM0HaEuSKFwnsXHDTWDxNZ9TrVo1fC4OcDaJB gjz/C8HfXtsr4c+Dnxcmc3nb7NjED+zMtHMHszz3r1CTy3ILrtjM1kGo+m1wzzmGLbrhOToYseIJ dVHpzs++HbmvJcZ+Nw2Jn41QKzN4/nelPWscOn7l9W67QmvL4PjSlkJ+aXkrk8h8pZkPn1AiXVzc 9bxe9669Al9Iv1CFbSPferi8O90079xj7X1B8XWhwPt+A747tPTXAN76CiViW/jHs67A2+F61hfU hz+D7CR310ug7iBQuwISbxByERHyjvcst5nNgQ8ZxG3KxJy/ebAGNRgEATFIPC/I5y5dUI4MWjFC EjYkESZMC1Uk5UKPuIIWXjDhSkhWw4vQwhWKiF4P/4dIxCIa8SOucEUihPgRFrYQYK6gQRbo9YUG ugILg8AiFr2QRRGyLz796Q+RupMhrwgCEYFARIYkI4iDQMZbkCEJZDT0ki+873MZMxo2csQc2BmO ff2RkITaSJBEUAgbYbFNoqy1GO1UCy1cegkt7EgwByUPC8WJW9wu1YIRJQI8MPTVfcwjRoKY0E+I nMGKUngu3MRIf0pJIRdkwIUYcOGJGunaF5Y4CHq14F9RdNAghjmIRAwzc60AmxcSkQhF0KBVp2PV QAbhn0AIYpj3SQuBsIEg3DBTEIlABDPh0rUlFuQL58tbL1twuoQMAj/tJAh7ANQSVVrBK/rrAiER +f+FO13DFYLgCB1zUjDuISQLX+geNnpJg3ga5IrmwRo1/YONVqRnm6cEDDXT0oqwcLQp26oM7xpY kPthg3lewEJKsyiIlqR0Bl40IH+Cc0jLVAcwiZDBirBBveGUJjIwScT7aHA/V3zBCwmtIjZo8RyN RStz97kCSRd6SBMCCJGHNMggrIAbnrpGUYV5SQ129oX7DSJ5zRkgLV6nyRm0lBa+Ul8Or4CItfmn jRq0QksNor9AuMcLSllRYvIyUJMUVKEnTVXG1IkjYhrTi4kAm1z9850JtcRcMSrIBgfSzUAY87N6 dIkuC2LURDjolwvt5AUR4go6MbGiEeKpF2zTEv/wWIFI1KtObXd4lILSgHP0agkfp1pI9JCUVW00 ZIUQ6TIiBZQLcGoPLk9CA9aZrSWJyIKcKqrJiBWnomoj19XAK4j77NWqV4rKilhYUUTcqZBHEtg1 jENfmJzVbzRAZ/kiFszg2WtV8iSaFwJJ2aWaK7kfexVHTamoxPDEVh5pRcEA2JwsZCxiWSSRhi9H yF6KF1QDJggtWoRdnS5sSlwBKGmUMhXMQDjClcJvMSv1L0pmTHu1Yyh63FqggZnIpVeYQZCD3IXx ingGQmalf2jZrpt0tIpl5Q77wPvd705MEVD+IefAi0wqg/d2XrYyQQICADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0308.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]>
© Tarek Sboui, Las Navas, July 4 - 8, 2010
2
I.Introduction
II.Challenge
III.Proposed approch <= /div>
IV.Conclusion
Presentation outline
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_background.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODdhFgKQAXcAACH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACwAAAAAFgKQAYfv3q3m 3q3v5q335qXv3qX35q3FvZSUlJTm1qXm3qX35rXe1qXOxa3e1q3WxZScpaXWxa3v77XFxZT3773m 1q1KQkrv5rXm3rXexZze1rWlra2cnJTWxaVaUkrO1rW1rZyUhFLO1q1ra2vW3rX/72vOxcVra1pK UkqMjHv/3muljErv5pxza0LvxVLe1pylpYzFpVKMhGtjY0paWlpzYzHetVKcjGtjUjGcnHvWxbWl rZQ6OjHFvXvW1s61vZzFtZwpKRm1vbXmvWMpMSk6KRmllIzOtVKtpYzvzmOEc2N7c2PW3t6Mc0pj UilKQkLv5r06Qjrv3nO9nFIZGRDm1pxKQiGEayn31lohnGOtrbV7hHPFxcW1rYzFxaWEc0I6OiHW 3nOchDrW1r339/cZ3qUZnKWtnFL31pzFrWvFpUKtnGuccyn379be5iH/93vv1rWtjDp7c3MhGTEZ 3uYZnOZa3qVanKVaUhmtnClKSjGUQjpa3uZanObejCHetRl7WqV7GaW1rXP33lpaOhml3kKl3hBa Y2uljGtaMTGEzuZrc3Ot3t7ejGveOmveOiHeYyGUEBDeY2veEGveECEQ3iEQnCHFxbXe1loZWuYZ GeYZWrUZGbV7WuZjvWveEOZ7GebeEK1rWmOUQhBj3jpjnDqtWqWtGaVj3hBjnBAQ3mMZOnsZEHsx UhlrYxmUEEJKShlKWuYx3iFKGeYxnCFKWrVKGbV7GWutWual3nNj72velObeQuatGebeQq3elK3e a+bea60QWhmtlNbWrUJKOns6Y3tKEHsQY3uUc2Mx3mPetdacUmutGWv375w6IToZWkKEtaWchBla lGv/3nuE5qXFxa333r2t3pSEjM7v3pzOtZSt3rXm3pzWtZycjIz35pyEjIyUlIzW3q2trd7exeb3 763O1pw6Y0LO5pzexcX3971Ka0r/97XvxZzm5pzFrZTO77W1lKX/5py1ra3mxa3v97WcjKXm763v 1pz31q3m77WUhIz31rX/5rX/5q3v1q0I/wAZCBzIAALBBgwQKkzIsEEDCCEeOkyo0CEEhxgbZNDI caPHjhlDYvxIkqTGDChTojzJcqVLjzBbxnTZ0CDBmzhz6tzJs6fPnz9tQjSIMAMDo0iPJoSAlKnS pBmcNsih8KKlqVgtRW3K9ShTqlq/NgibAexWs2VR5lDLNq3btW/bwoXrti5dlXjz6t3Lt6/fu3VV AtbalrDWHB4yXD2cWCtjxBC0HnWsuHIOyUohFgT60xwDc0E8e/480HMI06RDMAihWXXE1Q1cx4bg oUHtiEw1hthYe6NthLsT1h7eMWJs3y+Tn/TL3K9D1aujkxY4mnpp69NHa8e+PTv376QlfP+uJvp7 +fLeb0KHLnC9QKMeGLpuzTBpiKvCbWdIzPr4bt6/ETfcfgSilFhiBhZIIIKVHUhbBvdBiNhYEGoV woRaHbgggYRp6MFaje0H4n4ZIuaBY4hZkmKKjlliCQMvxghjjC/COONA1TCQ44476hgEAz9WU82P RIYWRBA+BKHNkEk2ycAHSPrgwwdSUkmlDld+oAOWW3a55RE6HHHEC2OGU2Y4L4Sj5po4hIMDCm+i AKecdNKpBQpaxKCFEnsqIZAP091kjmrmPARBoRA9hJtxiWqmaEMNLRpbVa4xFB177V0q32qyGTep SyCZJGqopMKUkmY4epZjCOKB192rrsb/ml2OreYI2mdBVCNeNdrgyoA2PwLLQKvDWnceadURVGl0 Q7HmrHSqPcoeUYuNVVS12GaF1GLbUsgUZWtJBiFSBI5YIIMIImjWt24heNiGKmmoFoPmrkWhtVeN G9xvk40VnyXQyVhjjjoWTB2RAgkLbK+/HtkroNokGfE7Ss7jg8VWfqClxhxjecQHYBYR5gtkonkE muEEgrLKOLSJAzhtzlmnnTGgoAQKSdyphJ4E9VpooBish9BnELkAW0IhvPbcpJNGpHRtC8UGabQC AddsQaxJN/TQmibtdWxO/zaTSsv5tZvYzwlaMHk9hgZkr24rCaRncscNN913vz33TeQV/zwawwIR XF2y5P3IAKB71w1eTu5hnal7Udd21UUeUM5U5RvlRpXkGmEu4bibjxugRiUqhq9GT121Vr+SyYtu ZbC7i1LpHXJoW3DwUXihhPdF5q8lkcXXOwP/IvSvagMHruOQCQeeI6BKIqkkk08iSXGSVE45pcbb a+wxl11qKbLIZJKc5snhqLFmES3b4KbMNoBTZ80oxCGnzlrEoYTPmU7nQtJF+8ykHMUAo4UgaEhT 1HMadZymNQ1VjYugQbJGwa5tjSEQsImlnuU1fZlqP/eAkD5sE8IQ6GMmiVkaprTjNv4RJFmBws51 XjgQhtGKNG4z2NrMkSNh3coziAvU3/+uAyweFutYOMHUZpQIrYQADCJGsVYUK8e5fB0FKTnYTRZN Jy5uHWU3tKHQRiaEmATJK15TSUwZa6cSNjJodpbZSOvKVRsMVWYqF3oK8Xz3osrVKD4wgk6PdLi8 5/3pkMNSksSiJ6WIfaB6VgqClbTnvQ9wIR4fEFmXRGamTp7sZC9gn5vU9CZvoCAcp7TBzOh0s1ba DAUCcRt6RmPAoUQKbIlCWgIV4pveOKRy1urfBaFFlPa0RjPIZI97ZBOd2fRHPlSJiAfC1hyypQQj TtuJ4ITIzcF1MyfV2aYs+1Yr7ACONHk7XE/ath30DKRxXesfayCSA+JR6Cgfss1F5Cj/ot00xjb2 guNU+Kk7e2UIjnF8F2UIg9CUMMZ1IBrRGzmUIG5VhnhbidBkFBOfLGYRM/cBHsBsBMi1FVJHEjDc 9KIXvbdFCZJIotI7KFnJjYEvTFgaH07NRLJOvqBNP3WTN1wms/nVDwU1w18c9oSszRyKmapxQaJC 8L9DNeo1SoMi2BQSkWimbSGVctbVqLaaCZpVNVez1AZRJS2lSI2rummgNXkzwmvipWnYadWuGpYw w/G1rzhimLDGI5oftQpxnlmSSY9oK4L1MEg1LA2tbghEdB7ysceCYU5sWakLcu5DwalNGBGzxS1u tCwhgh1hyki6BLn2tRVNSWod2lDZ/84LtbFzi1YKSsV8Zuu3k1ENfCJDkG0oL5Y8JJg61ckrHS0M SQz4gcR8QDFtWAxjlNweljomPi3pYHxj+iSaikBKob7sTeGIX5xWeVT7vdJPv6LOaQxiNM80wL7P ms1bo+qsAepzI2czTlkbN7T5GvNxZi3rgOVzTAJfaqxIe41RdnO23vjlhGObFE525E0ZJpaIx41h DmWYQx6qyqQE21U7gXQwXylvxC1sccIM2dTRwFM6mRIebZwCIabsLp+Yy5eF9sOUc+FFdrJTrYhI tGQDRdSMrz0oGxXEmCaXaHf43FZlvLgY4BHPRiOtEUGENBC5Ecxu1Juek6gUpZg6sv97WtoemDRW BO9qUmSfPB8O0qSyUbbMlKhEZVGTitT37gkF1UGIQUzTLEflcjY/s0jYKOKprNaGwctCa1nNYVbP XA04GKQaAalW4GTWpHK0gc3koiU6EZbkPx+8ZtKkUx232UogxPKb8pTLMEANsTouNJh4WIXr8Ris uSzWxq3iG57mxXc0yi1PiQ1rMHfiuH+Oo8/prhKi3nA7LfJa7YfUyCA3IlRdsTVylXHbF8Og5D8H vSI+bUPFfoHFX6yDz5f9KLwYhUC5ABdSr51rOEAhjmKP9IF0tQGli00JuxyzKZe0dIR4bAnPJkMZ +swLM6Kud2b209lR4Xse+hKN0wf/TJrR9DtpAYftKrfjCEdmne2EeBqt88F5ekBdwWdtallWoxqp 3eo0CP0mIrzRSwP0kUJrglp54hmNeORWbFv9SDtswwngcqhcFQ/SsTryzF771h3nHnvXVR/idBj2 QyOVHduaYlbvpPgUfI0xduGyLZTLCEe4MLR2H5Jt3uNVl3E3qMmCL5CURfQhbq/lQie6qGLuM5bh YcsgL8IUmXskJDLP7UfQe67B5wGshk8yYzqY0nZtGg8whekIeH5Ans3Upj67zJTnBYcqjVqzkNss f9rRzP8GfKi3Iu2pzZJ01BR4kf5ObVMP1nQFFd3zqjUTa/RRygbrc32hW6ooUJTm/0lC+EEMfxCb pAH4hmV4t2jLUm0lbmzgVGXivg1y2TcpJ2gKa0TFDgRxAKhrz8Zs+1dj16YsjmM19XZNGaIR5gJH lqBG7AY7r/VGd8F3bSSB8HJkUNYh/iJQuzVkdvQt+FYWtHEZ1tJ4i+FENnJ2y7M2z8VX0KNOU3I4 1iNJTzIlknQx3GNT3hMmFtclZFIEJQNK5IUD5GUDt/cy8cNeeSInS5UzMWAdp9EeQWM1AnQ0LHcR sNEfxhFgyKFh80EdxcQACBRVq8FpxiRWz9SGkMJVDBEfYLVgF0JqVxEtEnYhutFqaJQBTJd0ACY1 ByMa9gdtMcRCyeI2xMJ2fiV/8v9XMHoVdr9SDQEoicESWcJWLDfBiJNYMAX3f2rTRMr0TsRnFMQj ZPpiFm8Uboq3ZIHnIfCiIQzlIRKlIOWSeIn3io8HGUCmUPgWH1wEI/gCMJk3UqrBeWsDdp9IeoyU g8DiA6WXXRkTcd9Dcd/1XWPSU+KVJqJESu4DJ7hHJ/QDhfRjP34yKGa4GkGjGZz2M7gxKFx1hZLS XwxEj2J1ffFUQUu0YNTHjz/XfUsRVm84VvQkNFN1G8dxG+fnARhmfmnTPCk2fw1jRMkCOMGmiSB2 YlHXI+V0a9FWGoYTToO4WLgCQ4woGr9WbK2CRNgGHRqkGnJ4b5BXL33XUHShLjj/yW5l5HeCkRJw QS8EUgKEl5MHlRhhVGUP4hXA6EUcpZSTcRT11ILJY1L7lyvqJCyhB10Jp0g7GATShTGTNHE+uCWZ tCUbUDJkggMno5ak1CajlEq6NzM3Q45akDOHgiwQkXLNdzRKc3ws95f79Btiw4YFwWhEo2BqCGpg RUBzOHRRRIdcCFb44SxU8YZ1iEEUsjn6kRJ/aFcTpWFjVmw4ARrnlH4zlonTkSMjpmspphp7ZWJ7 42yduGxSN39UVziGOB1mtkOGwyvbFEOjCHQPBhV1GItGFiLmMlEUeEawuIr70QNDyRZnZBkHAiIU AlprtGSOgWUnghinuG9fFp4o/1ZDQ7JsoTckzxgE1+OMVIIxksQx2qUlracD83mNRRBeGtdJLiNU RXVK7DWXd2I/ZOgaCHRf6sgaiBIRKKdAtxR+A6Q0rwF9ZDVMY7geo6YpbcVzbuVEnYVp9CGcxmMt eelA1GR+HuEB5OcbNLeROySbBUib1fabOcR28seiPWJEvBYaEXlDzHZs56R2UXeJGukrYmcw0LNi mtVEj/NlWKSH1TJ4DKUgZWR4tAVuE0h4gKEu0JmTpJUucLQbGfIgW8ZFkqNv9XYZRrGCLcgAxgV2 QEJmCkMkwMIr0bMwUBIx0jNTPRgE27V6XCImQahJGXcyKvNTR/iWfrZK7vVeNv+Tjp5xhgVaVvuV QAnkNM2nXwASiI+TmKmRhms4GouZX5Aih5vSmEMxh1Hzhk4UG3d4qqimhwo5OijRmfuxHM8hSIQV YmVnQ6bpYoBTayIZkf8mibk2EHulQ4ZUgLe2m7x2XDhqWRzWNzikWTaGgAqGafhBZHrnWqUDlFAG W7lIIFu6nByogRBYq5QhRsTDk4HHLdgCjF8GPP22fsvqiYdkJEaSntDoZu25Pf5aSRP3Ja4HXp6k Jmmyny3zcSiwe3UylyGXBIRyKUHzLIViX08VNX1pfBjxaIuCQXGnVqBmENqGfaIaLY6yatenKMdU OZWiYzDJmG6VRWF0aaezRe//BioGYqKCWGZGFKQ0ZCxXlx6p6WwFaGzktGuw+axhR1mjGZvGNiw3 yleVxZGIhDgDJx4r+RmjCHdoJYfcVlZLGRXKWZQF8oCw6FqAYSDpYGS55QFu65Pg1loclUZHuWV2 10WNt5SRcR/SoVx+dZWG81zPeDjpOVPSc3rxOZbedXHXWD7ipT7pM0owQ0r+aVR4crk3Qxp3aV9E U2AaliiRVqmXijSByEGZUkzCSTSVUq1ihardpxmPCZOqmqq0+3OtEUzGIxVhQxwe4ZC2CDZN5ayd aGuYSHVhFyxkR7Qt6lhFS7VYe1wEAzF6c5rEWyyq+WHWMXbdoWJol1Iy1JID//F0XctjvdFtB4UX ZjsXVTquHgKdCQIX7rsg7EpRFkJG7Xp4p8hFYxGvCOEi+4Z5aDeSLPY2QlKn0GXA1EVdOwifESef YDKf9QkmPnU+KNOW6SVoCks/NZME7yUQ9cUQ8Ki1dwkcKguhcEURUSFhCyF80TEaGBBP4bsZJfyh mOaPQ2c8SiE89gQwOCyQCpRF9VGHJIwfChQg7+aQJ8QSodkqpcl2GImIHgZZysVYkGgdlIWMVVy0 3JSjJzaAxXYrbEOR1EakOmpEBBi8WytPcbiq1dKTjKcgryOurxW/7YIS7ptkU7Zu5IZb7dpaqgN5 +ZYi+EJcIyUdRkIQAQh6sf9EpxEjJThoejo4jQELMt41sNhIMuK1lqLklm3ShAp7VJdrP3eJoBjE uc5UVVnlTHBFTVilxta3LKPRLNUqd40Gao/pujrshrV7w5M5maNmFXjkFJxzNuOSHMrJNQKxDfR3 a9MriZhorNfBf8dVThApkWG8mrxqdb2Cmy/Um51YMAyDzVTpbEdLiU3ryo6zhmx8T/JbrmURv8o5 IsnpWsrppc7ZL2UKqwBVnL8VTOM7mdEhZjeBMHqDnua8SDQoJQmcgz1IUz7oeq0HJkfwAJ50sAfr Z+c1J01YaDWjJxy8J2iFjgIkdAvaKIUCoSsXNs1HQMyCGtUhahykQVqbzv3/WLLREbs1kXP/GKqz +3wh+kVhdBSPIpj+lMQoCkIrAbzbDJJDu5IjxqM9E7jKY8Z6Fa0lWW0TGb2kEUQEc04n6TcjlliG 9XV8ZXUkWZJTnESvvGPZomWAtx9rixfuC51lRMcIcsdoO654XYsb+Drr9tdjulAc1SLE6BoCDb1u GiR0ygDzEF2MDSQaczgOB3Go1zFdIiZiogPmg5YnQ15rsiaTy7DsVUACgUCLZlVclUtYdYV+6YWP +WDMIh8GWoVBl3wyTIfWV6q2q6Gp+kw8V5A0HFZcKKo9xrLctmMV5hB8oQ8ul36wUma/OrRa7E21 MqxueitfvRNys3/QKCSN/6QrSNLICv0Bb6Y9UsIF2ZN6R+ADWGIArgcymY3ZY3Kf90kyainf+I1T 8a0DXMDfYeID6424FtMk0qPQbWZwBM5STiI90JUkBX4kDu7gDB7hEF7hBH7hBd4k2FMl2gNx7D0P ZOklIv5dsvcAL7ABJ7MB4UDRn01K3hAOpuQN3hA/Gw2FNq4E9pMEcbDjOC4CSiACPg7kJiACJlDk RT4DJjADHWACHaDkM3ACHXACJ+AEU+4EVi5fWovKCIEoP/M/CuQsuME0PgcdprGOWFUVX65hkMaX oQZBr5yyI6UQQNyhOlwUPV27pDrUqxYVcAW7FDZXsLYRfAM4YJcsdHPVZ//cYsxLWMRGkTgCkpX1 oma3zc1lcIoEuM+YPVbyDtmD3hzj6alnSSDjA+h92fyN32Ky2Y6b30fQ363u3xL96h8TcdrDcE9C uHIzXb/iA4y8MBAjuAzwDg0juEpC7MBSXeppwBRTXe05U6Q3D5EEJdelPRrAgw6nAR8wDyAO4h+g AUWgAZvEuFtCJrAHe+Hg2Zy8Jt6ge+xeJ+5lP/CeP3uiPz+uBD8O5EKe5Po+A07u5B0Q5VE+5aR9 mAeqYCQcYZcamWM+u0wjEp4iEhDflxlrujRsqrgrqfl40xrfocL9TFOkR2pOzH1xQmRuOFH3xAdj kXzzzR/mpoUOzdhLQwP/R5qUuCQppQ3isa/PCI08PzEJ3D1T4t7ag979DTL+zQVcACau/nqr/gKB oOqYjOpicp+YjVP9nfRE39BW8oylJ3o2uCQG3FJrVqdp1oyLdPaMlPbJ7nBamV0YA+3cowPcblPc LjLiA+70+QDfVQRFQNEUnSZp0uIw7p/rjgLsvqjwXj/yjuP6owhxEOREPuRJTuRIXvkzsA5K/u9P HuVO0AHoiHIFRKAICqFLEWmWKqok/IVLQ6IlsYceAWsylxGnPzXFxNu27X0iai3WIlwEJLZvCNCd JVx1uEUjOhx1hWEssbNlBs0YKUNXjInbVIDcq6Pj2bxmRx09YnCkqfPQ/yhdTXKnVMJwPI/elOTp op71W1LqsZ7q2ZjJPlWwQ1j1Uh/frX7+DT1T03Xp+yoloMErBneVADGPgY9q2oIE8TEwiMGEPhYG +aDQoMEPDyu+c2jw3cIPH+b5+FjxA0gfIkPO0zHvg4aOKV2mLKKhiA4dM3U8OFLkSLgNO8PlDBcU Rzgc4IraAIcUxdI4TFFoUYIijpY4SqgqwSpCiQiuJkKZ8GpixgwTHcrOWDejw4m1a50wgGCOAQMX DEJAuBuCQYO9dhuYw8u3QV4G5vi6CDFYseLEGTKEyNAgsmPJDTxYxjwZ8mTJkylzjtxgsF0Io/Xe FWw3L94chFNb7os6dv+OBpZGj85gN3ZpBrlrD4Zwea/tu48re3CcPAPyDPok65Ubfe7canPlFmYQ RDr1wtWrX5cwXdt0BuGxl58bvprc8esZeK/WcKC2auEnxh/YMMg7bT76YywpwI5K4uKDAn04AsEP EjxChwK5cPAICBs84oUjKsTwwhcC+QmHnTjcqcKffrqwRBNPbPDBjgYE0D+EIvJvIAY+oO+hiWxE CMcbffgBoewimuehhCpykaIciURoo41GCgkiH1Ji8gMdpERJyg+KQGnKmmSqSYcNHhgxTKKCCseb pMz0BoWkwIkDqabelGqqOKoSIQ5FttrKBBH0FKvPscTqQK22ZnBirRP/zNErLujiiusvu1zAq6/b 6MIrsL0CUwyCyPbSzLjHQOsMssqSs+xT0JRTTjRJI9WLL9ZcG+60SxOzjQEPbOUrsb580y1XvFpt tbfhMAus0hBEhUwfx5xDlS/yqjPvOnOCsI67796r1rv0ptO2MGqrwxZccKf1lr25xiO3oWn7u7E/ iUbCKF4ffDhwpAINRFBBKSeUkkINMXwh4BBHtDCcF4rA4YVw1CBq4J0CttBCFFE0cMWRaCxJoocK ekghjgfiWEhqO3ZoRoU0ZuihjSaaRxsimxSppJhRUkklKeNxaSWacNaBy55+6mkDhXcqgihvhiJT qTWXYvrNqKqiCiol/+7Uak+rwyJrrLQCDZStE9hyAgK65mJ0NUn9OhYDvRBbLDG3VRXN7cguu4y2 uUVD7rhRIRP1M302+4wyZTtTLjG+Hqv1tV55CyFx1GTLq9bTfguBtsTnyvXsYYmjjTbmACe18HKn C2+hahlA19vxRpcO3PCiG7c7c9wzL/bVtVuomoViLLKh/lzEGHgBP8CoYnuthHDBAo9YUMIIdSgx Yp0ivtBDD8PhUOGhcRiKw+tDhBjiE6G/0EGLBxyJIfoy0v1GIbOrcUcGPpoxxyXntx8ihFJ2yCEl XyyJk1akkpK4hGZaKsKVNNClmMxkJhvYQDjAZDAyCWVpa3KTVDT4pv+oVaUqiqDTVroigq/4KRRm QYug1kKoE7xFLiEATF4Os7ZKGeZXikNNsRTTmk2JJjQ/zIxkLnO3U5mKcKSCB6k8oKxlocpwl7nL ZSwRrNPw5jfBwYsH8JKBwNjmiq5hVRVllasGbHGLpMlLcpaIKsqIjTvkORe1vAVH1JHHIG/EY0LC 9cb1FGQ62qkjesyjR3cVaX8Zudh/fACgA+nAACu61/L6daF9QY98/6pQwK4XMOyNqHtjGkoox+Q9 Cg7NYCEqn05MdL4AIcRFMvKdjzKSo+zIZz/UuuP7ImKjj9xSGy0j0kX01xH96QAkK+lIlag0JZb0 TAc869IDZjIin+z/BGlBOZqZkLK0pWhhg1KJmhLoVJWtMGFPYPkKWVDIta51oC0n2Mt16gKYF+5l bXexp6UytZi9xM2fn+LbY2jzHFB1SoiE60wD9DHEzySUjUwMHXB2CKxIpUY2FjUWb7RomUjlxqNn a1zmctWa3/zmMoRjIhMrg51okec62IHddMhVLbn0US7mgSl6ZBcucwEyIbnzXXwm4h8XEXWR87pY SYq3IgMkaErJS5AkmZfA8iWIele9EDU7JJROHuGT4SjaVj00tKGhMkOXZN69WPQik+1yPD+9z083 0rGKMGR+dq0I/ETWv5XpDyMhCaCUIDISKOWMJliiyTOlyaVw1ESa/xSsIA7SFI41pUkpcMJsOKcy NRFyZYRYE4s60eJOrxUKO4pCY6MK45q72DAx+rTn4SCzl40WNIgMhcxJObNEId5DOWv0mxohqpzh kiowuuKiFBPTmspFcVjCuhVwoigYKtpqVtcVDOdeG1DQpcpZ1tGOe7YVSNfRFLzSkuN57vie2XGn dti5ozbkQpC3gqw/HCMqRwYiL5cFiAuPfJKKCuQgAk+oqf6SGMAEBr7qfchgDAOlULjHvU5ydWAQ 0+rEVNSR4gWwqLcM2SxNNkuBzPKWu8uR/3wZhI+0mCQuFsmKWFIll+AsS9A8bE1+VrARhZWrlN0m N50ylSRQZU6cJf/n1UIhgqz1KVBbU4taTkCoaomtLhg9TDzzqSuJvq1tonkOZmxDxL45lKAJzVvg ErrQygx3oc1BVXEHRxyOQs6KjysNRTcaG5BaEY2Xk41vbGMbhjaHOc2io4y4xd45wnF14qlWek93 XurMV6Z6tXSR4pORef1OZv1JqloXJLMPGOCpFXvqlPx1SYlFjHrgm54pXzAUhC3sx6Gk8FAYxqGf cDKrmWyQKlV9PpclckiyrN+88IfX9z1EZXf1EZH6+jKSDOgjLGmJzbSEkphsyYFcKgKYqhkUhQ0F KZNNStO+ycHNzikOWlGEZ/mEztCGlp1ec4thxoao1cplnn7xS7H/uLzdMl4mOAV/LRD1NpkhBvQ4 njnibz0TOjY2Mc4VL6NitKhcYbXKNsGR1KAPhytCx6pSmSMMrF7jAdApy+WOgc55RtdomIb3PegC 16VnJ62byxSQ1vmYfUyXEHPQNyGF1C+A4CUgAwiIC09iUL8MxDzyQYh8L0BQ9P6VYOphr2AvUMOs FWZrc4vS7FwdysMcppPDUh16LZHZMdEnsySxeF4iM4hARrIfEjtEJAvpZUV+kLHADpZJcj/gAXG2 wJ498CYWgqD2fFzBcNgABWZSk1LUze4kSMODW0mCCJKgpyX76Sxn2do7z3MXRhlry9RtVJ6pKxh/ ZupuDdcU3ka1/3vQpBnijvFtcoJvaDin9OLErfhjSuOb33TcV7mSoT3PNimRCktxzb+VFhNTaDaq 6lyXDqS5vv+s07100XA0/3hMV5ifmmN97ZKAkNgFQCUhtb/G60gkKwbV5dGEC/6qEOh5NVcDGA3p NVMCEbBCGu6xAaIwO12LMF8jEVUqEZpoECuxkimxGFKTmRkRiWQLoI3gESc5qg77iB9wsSDxiOGB CJUwIA3UEimZkgSyCQcKtzApmrFbQKMAhzRBAc3LrKYQpyObE60QoXkzvaxhp3fqgLewDtQCDkRR lDIauNkTuIlqAM/5pyD6lFEZoobrQs8IPuBijoiLuIc6Pjgrvv/CyQCSIg5B44u6ab7caC6/sATa GhZW0Q1ZUbnfeMPlgCiI0ovsML/qaI/xwpZooZaZAj/wQD/w0yPUCYKCMMQgkIChyi+i0gaM6K8O m7unw5d+URCqozqroxC0KkALKQKBEZ+skphSQhhrIhNcc8Bcc8BRIpgQcaCcIB+dELYGiUENXBFh PJ8VKQmbOSb9mYfB+7vBa5LAAqzDSyYDQqx4WKBrbKCb2Alp0gHImrxzWwpwuLymCEfM2qyroJrO Ir09SaeyEAsoW6EWUi3A2De4eA19G7g7Kw2J8ie50RTDAY0yG5Ufapbl+D3JuIe8eTM1XEOGtLg0 dMjKaD7F6Lj/LTsbOqTCk7MVP+MVX/E4wdiixliWQ6MMfEKdnEPJ8aqp61gdnks0ncKj8/AB9qiG +FgXm5SPo+qfADmqi3mkUoOk/OsIBkGQ5fm/CDERAUxFrIoYDxGRQDgYrwoRHKg1CAslpLhFW1xA yasQttOJnrAkBqqJYLMkm5DBxMLAlijGYgQslbilFRGgFoOSZuqIZjqgZ+oSsXQg7QkKn5CspAEy cVQTOFk3IhSnqrkaehsLJYwyJoSn1Rqb01Cb1mKVMjIMGSK42FquxsCUTzm4IcqMzXC4vRmc7guc hywu5Ls4N0M+iKoMWsmV5DKjEIiuvGiNg8OVitrDPISVYIkV/4O0OJXijp3blvbCjpx7yZccxJmz ND96j/qQRG0QuqFyF05cmaUrHlCklwBhkEdinlIksFMEwFRUMAtJGAJksF7LCYExmKKBsMqTrKOI zwkDJb58mIJxmAtxIOjZz5rYRZzxyhwDRgtMLLRkJWk8xrgjII/ImQNKIJpYiWycJjDpRjExmqII zHC0vM0Lp3Cqk6wwp6tpsj95Mq4Bm7HBDhiqKMCgPYBDDSukyDCjPYCSSIP6jDIrw+5jMzZzyIoz PtWUM9UUUpiLjOjLHC5qro5Eo10JFpSrnFwROeK4FO5DvtE4v+GUo2mxNJl7xOVczuQMj4SAzpv0 D6GSv0OaF/8RTKqKIZChRBBjuhCoersimJCr2zoMIRGuIysDLJGuSruBKQJeizCiaMCjecAx8QlT ckUSQSVfVKVYe1T9ZKD9dKCbucBts5gFTQmIMCCLoctmAtDEklCiqdBVrKAGBEcfZJN126DPe7fO spoSSiez4BpBmTK2kBaxkYss0w3E0DKK3C59eq2SEg7RGKgh6o3BINJQaSjeOs1nTY4fTc2HtLgI UI4niFZqdc3J+EzsE43LEQ7fuJXevBRW8TOPjA1TiUi+cMTXMa9A4lI+JI8vfcTjHD+iw52CMDp2 AR4GABB56bBG8s6SYJ5RfBDnmRDxbDUTGSuz6hCJSZj1RKX/EQmEndiAsKs1WszKQfUeWXQYCnqY UgrZROXLgKFUXjzZAtWSGASJKeHUFWRQnVkmvHQmnAnVbsSJx/LLMaGsoNA8phkycBInqNCCO7mT IxTRPgktdWInKnOUEMAAu3ihv9BHXbkyGDUcw+nHuxHIMDSziTvDUhGcyFhIH6XWhlTDaR3S1OSo IqUNXLGV3qwUQXscgINSP0RXj0qWQ0spLYIjcLmdl5ILQHqpQZSVPXTJRdPSnluI8ZBO3MlJTUxT ozK2i6kYUzOQVFsQS2qe8bzTBYsYqDyRqASfsnLKDKOgWkO7MWEYhDFVrsrYoICwjx03supLyLJP kA2aI5Am/0pV2QfFQLssLCtBLJiQwXBzLAfSqrGbRW8Ih8wTR3BABnGMA+rdICMTp8NUR3b0kyhb h3vzmkEUKQiIFN1cDYqqQt7wqAywBFIZM03R28/IATD8nIoDrh49vml9ueRzDGyFM2x9gh5Qlh5o DgIOTlRpX0uomwRm3wZm4PmFYPb1gBxIYAa2YAduQw+4YDVio2P5WzqStOkwXN3YzemoDRJOtJrk lvU6OhvRK2esH058OgGDOnwRMOVRnvD8P5xYWFdjTw4BYuzhng0R4iMIhIQ5YiP2kLD7kJzYCTVw XVsLK15TgycmioPpJL5cwKAgpYTZ2E3CXZAlmBqc1LzMMf8IhcFlqpJmajzGq8ENoAmeYN6wMpOi uDwMEkx10yyr4CwjPKdzSkJASaG2cILo8Ld+iwvEUBtzcAF/Q5TLZJu3yVowW4za09pKpuRMvgfD 2eRMxmTRuAdPBmWELCJpzVbhA7MMCOXIGL7mEBXnuOSszTPZ0xW3sVp7Upssc5RdjszJzOXE2N+E VCi3kZ31mEl0cT+WyimPVBupdWYYKgxzCI9pFiQtnUn/6I+i49dOI6qn87SSaLpHEmdjUpEjOLCE taT/sxAuCB/zTEWoZEXxSZjzTLvtsV1Ost0L6ySkGVmDSTuQ9WKv4kuCqSCfGNTXJSs4bqwN8F0J 7baYON7/ZooJnvk2aHpoLymCcLtBC8WmMlGTNKFeNiFHdjOyEKKaESKLdoyyxoxHEhaj3axl1aA+ tDkuxjiWm2aMfgyzgKJfiROuaF0j5ACuhVLbs11bIWVNbTUODx6M0+BDeb1pp1YNqFaNqubDKWLf hTw0D07hcFFhFRZhmE5O8tMWFa4vCajJ+0LrbebmTkOfizEmYxyQxHqSle2XB/ABgbGkeA6fB3gB v27nv/66wTaYghE31MWJ9oQgngjZseNLoaGgn3msUmrP5RWTxg6rCIKgImBoCJImaYJjzgZQB9qA eLhoaLJGnekSin4AnIHjnxm3b6QskL5jpYmDfTAy7LWT/xD6rD3Jmiar1Rk4UenYVbo43366KGB5 DZBk7oxrjFIJla8dSN4jPv617pfb3ybKbqU+ZYcMxOTjx+kTb7g47oxKub7gM+rqje5mIq4Oa537 OZfeQ2Oh6kEk7pnLyfnAj4R4h/wANaLyxLjTv2J8kAKrqtF95zzFMCPO0wPstQ75NQl0mLJCXYMe twk/GEWVcGoqWXLrcO1h6BeAIC8ZcQnaT6HpXQbiEhX3ti7ZbDC5QYPmKuetPAzaB1Yl6c9LxxH6 inRaTJbGN0YpDHbtFag1cheFPUnGlFgWjYMDyDLbjL2ZOGed7vs9YDUkySHN1u/+bu5Gw+3GzIoC li2rKP/dfA0x30iPsyeSZFtilmr0cw/zc6NIIW89TDQ5qq86Mhf6QrH541fslBkAm2EbHsV9ydwI eQB1zmsTebUMUfBfy6TrqdifiMULczD8jEpG9WcHs6YLJzfLVrtcPKXC7vAw7rHKHpjHykEI+hLO 9k9wW/FslKCPJTcfQ4HnLZPoZZobBycOyt6i5W0+AeQRhUfhXgup1VVchubnM9Lp20crOjkvs5tk /UfKaDiEmjjlSEjP2O781e5TTs0gRc20RVuITPLdaHZ0ldfMeVs6JA3M8YAs/1FR1hUu1aN6GiMS dpbDfVfwkhHcGQ8J4B1MnBGjkhegtBjMfRAFgarNlRD/q6oqrsskgYFnahKRiZ3KjM+wQO2QVWRw jOdLXhP5CufwB7/4eyZorwqTcfuJwwafMOnGVWT1CBJLhqZQ5a3QgVndyVqKy3KKVu317D3p0AsL lW7M0eoaJ4ha1Bpy0qghKrTMKMyUWtY9H+KUZOW9rC8oKs/RKQd3/EVDhhTgHu3yDLBW677yU86M 2ADJ827SVXn76JqiHLALOhQbyyhqIi3DendOwaWjRBHfubBvOnJJxy2PtLav3vHz9Ak1enmkAXt8 Q/9OUUxKrXs19SSRil2wPjWRUf+QVaxiMf46DsfPlL9dUOp00x91fBZx9hx9lndssPr0saNQ2VeY sMJi/83mCYbuRlbHYoOePOe99TXhplWFE90+zCTrbdAiCxloTCdQC2RH0buoCyMPjF2lKH2EG9mq ZNikUbph1syAuMF5M4XK9uQzvm7v7i13jB44+zjrAWw1PvfPgPhffzVU1o2qlT3DoV5ZUr0AiAwM QlhqACGEwIEHGzBg0CBDBn0QJUb0APGixQwMG3JsaI7jx44DR5Is2TGItoYpqzGQwNIHg2o+UsKc iTLITB82P2jz8cGnzw8/uXzgosMn0SM+lB4xeuSIjqhQpz59+qLqVavhjrzAcWQrjiJPwwXaqmYr 2hdoj4Qtq+aq2LFfX9D1ulUt27Vgw6nFQTac37Jz7//yLUyXL17EhtEW/hoObZFwRdQ+LhxZMubL jyNPfkyZst/Q4HB4QwHOBjgUquOgjoPCdZw4WrTIFqFFiQjcIkzsFhHKxAzgoTqY6DDDeId1M5x0 MGdOm3Pozp9PZyAdwvSP0qdj+GjuIHaGLg4yCO+Cwfjx5hpgMLi+wfsGIRrQp++wPn789/Tn708/ An33aKRRAwA0oM9DD2lkIH1PaORggQlexCCDDTg4YAP79UdeQyGI9CGIIYrIUocZeKAggfXN55CH HrYkkw84xVhTEObUZE4QMTFgDokS7FhjNT76EJIP1VTT00091aTTkkDp9BOUQQlFFFE6HPGBlVNl WdX/Uw9YZRVdYYY5mFpX6VUmYI85plZZdvEV2WePhaaXX3KmWeecdaZZmWN3VqZmYYuh+eafhf5J GZ+FImooo42GgxoKj4LjTWqVuvbaa7TRpkQcSiihCG668WaCCb8Fd+oMqSJn3AlVNNHEHTe8+uoN N9DQBA256pqrFSx44asVXgg7LAhehOEFCCCEkeyyyjprRrLQmjGtDdROa0a1ZqihrbZqeIuGt2qA O664aKARCLro8hDIuu2i4a42PMg7r7xoxDvvvfHaiy+/8ubrb7/xCiwvujEwoQQLJsjAQsIyOPww xBFL7HAHMlSc3A0dZLzOwkqkmy4X6NoQA8JKPKwx/xRffLEDEV848wURcsAs8xdAsLzyDjvkkYcT J/CscQdBC21xchcTLbTQNzAHdAfMMcez0lE/7cTOVPNc9dVUa1011VA4obUTXmN9tc9k59HB2T5P 3cEJTrMt9AlIr3rccUUfVxxydxNHXKrAyQAcqYAHvhupvYlw+OGhdhob47Hd1qmnnEbuaW6LW/74 4pLHkYTkmnO6eBKWN65IHLkhnvjpvZlgyAysp/p60Ms1LfvXX6vtNRRQ6PxqrDTcQYOtuwrPQq++ Gv/rryCwUKzyySKLbLLRSy9tDGZUjy321Xrb7faBbCuuGoGYke656JrLw7npr3tuu+ye7z769fr7 Lv+99dt/P/71axOIAfKqEYPyTKYwhrFgYQYsoAETiECJ0aADLEgOxYiTMDWErIKBwIEJMnaDneks ZzsYgjM86DIP7gAKIdxBCIfwBRDmbGc706DFIOZABzrsBhEz2sWQljG5ve0EN4hb05rmtNrxjGpt KyLYeOazJfYsDyd4ohOU9sSmtS1uPesh2rAYNyDGbR1C82Jy6Ba7MBpHOXmbgRlfB5y+sfFUqhtV 6kSgCNuIoFO3ARVtZBMHUJGOdHUkHaekUcc6aoF0jjtkbea4x899Ljac4uOnQhWq1BVOcKRCFewy 6YQZbNF2tfsaFO7QBFkBz3fCyxUBaeArGiBvWMP/CsPykAVL50kvetACQfVAAK1qVe97vuxe+MaH LnEFIn3kY1e61ldM9O2PmQRz5r7kN69ovkNe1eTBNQeGTWsCTJv941cg4mWA/5VMBgJsGDodhsB1 OvCBC1Rn0BoYQxMwgYKBCJn3ZJCHlOXMZTjbwcpe1k+BrpBlQ8jZywL6z31GEWgZi6EDZ8ACic7Q nRU7GUSJtsOMxe2HHg3a2TTWNrQ1cYlOXKLa4ubEp2XxiUrLItp8ONItvq2mQQMi0upWt7yNUQZi BI5x2OjTUwluBoQjHG8MxxvdhEoRtCHdU/WIyDoK8lOlcyQkcwPJOQ7yjp8a5OEEycc9XhVUpkNc /1KNypvXsbU4Yrwp25xWxbDR1Ws3+F2sfmervQqveMYLlvFmyYJjFQt6hq2lLXV5vcWaAQfd4lYw veetYXrPe+P6WDGXyT/2vct97IoXu+bHA4G9K17XtJ8D6Dda/d1PG/TjQr/m9T8mFNAECWuYbSUo 0d0W8IG57W1FKdbAiplACeLiAhpCZgKA5owIJBwhc0/4wZedcIQrkwNAsWvdnEFhZ0HL2AMpOsPi 2Ja3waWYxbyoXrjCDaRsk2nQjPg2JzYtbTHNInNUOkWXchGu9mXbDnFqU7ntdIw81Rt5+QY4orox OL9R3VnPutVHIlKqFo5NHXFz1UEucsJ8lKNuQP8cYcSFmKu4SepaRaDW3WCSbpx88Sah2LaegTJs ed1rrUp5AxagUpW9+rGvfgXLwQZZWIUFASmalVgcJMsGip3W96bl2PBReXzhE99l2aeGdZnPXMhN HxoM8K59kRmarv0mwOiFhtSyeV+p/de9Vnuv/vXvXqeF7brGOTKE2da2vmUYRQE90dtGdNAVvWgH 5FlceyI3BnlAoQcFylzsAvSg/fzgDrRraZwFVIUidIbuisi0GLpzBg8Lxd/M+0B4Di2HXtyh3OAL 0qXZ92whrfXbPEpT+MoarjS1qRnJmFO7jdGtbEXVgkkVCqRCGMUjDrFVK9fHQsrGqYx7JIXpiBv/ LRyudFtN3IdDnDpxx/FwKV5wG1OlHJ1uMr/unjEUKkDXu/qO3ndgwb2Dp8pW8BjIvwLs8mIprDCQ AnrTI0VipeVYEDi2elNuLGQra+V0Ubl8mS1fu1zbPjG7a5utVS02hSDnkY9WGyKPc5pXm786h1le ElgXCJTAhPLetjgsCIWhGTZeiw460IiuGAs8ltx7doC5Rofuc0OI9JWN0LksVOF1XXZQ566sCt09 G6wtlnMH4jzBuZVoAnF4sfUG2L1m92F7t/hD9+4aaQJmLw+LFve4cXLYyHHr3nbL4FLx3cG8ebCz mXpWDfOR24XUnIU1VW0lHP6PkTSrtzVM4smH/zipzX5jb4KjYhYzWFViPEHdZUzjE+DOCbHKcY7v ze9W6IqAxHs9LAc+WGEhnAm0ROwtn6xLXUIc4g/vBLi2VVnwGfOYyTVXZpGJhmqO+V70IzPK9aXN lDsAX3CO7cAGlk2Vr3acB+vzzRlm857nXNWFnmENHUbPkL0jEDZ4tEApzVyF9vOg/sx0pfsZUBEa /aDYtTRAVQ3TBM3f7M2glRfNHceqZVSryV3cuR2AQWCvAdHa4VR/tZcDQmCs8dTdBdVQrVGpEIep VNLlQVjiNJVWaVUklY5VSUPjuGDjMA6oxIELPh5YiRu5UZK5wdFaAYeKhYJRBSEIstUZsUpcdf9A BczVjNWOXd3BjelVruSbKtFAKwAZw/SKsBTZkS0P8xjc9Owek0GcLjkWZIXLxIEPZVncxSGTxi3f 840W/JAWwKwZ/VQfvqzZaOEhyfGAHa5WH6Ic/nxTM8lL/9jAzB3g+PncoC1MRf0WxKwaASqBDZSP AcgACRkddkkaQnnQpnFiCGmXzLBQpm1XdiFd1WiQ0JCfROEcbykMebnTDTHgemVg2sGa29kiGH1R 0axXLsqdgP2aTelU3rmVDADhJfGdivEd4BlOEpgO5Tgj5HFYHzVSHTVOHrlgHsngIqFOVo2buSnV 4QRhMppKMjKYqSCb57EK3YBeu80Y6VUA7uT/lY7dQCvsGCqxHsP4GPEMS7C40vMoyz/iHik4WRg2 1hhKGcQFU7gMXzERk/lcnAEk3/qsTzW5D2g5E73cS2rJixBoJEcOTEfygASE5PS9WTeNnDZVU7zA 1mcFAhMkgfjd1iqWGk0qTEX5HCMuYD35QHKpwaM5F0L9E6ZJmkAVpacx3aUBlM3MH3XhjAo1ZQmd ItKoIs6xokwmjPmhVw65Gg+BkVcGTS724i4+IHIEmxiJpdyJERq52N3sXeAgo+XFJeI0oyRtFQtC UmyMleHFBgyOTh5xyh/dJQ6ijg7yIIttXue12LHxFOjF1UyNHl3V1RPeFQvsmBTmyuoxTCv8/xvD FNywBFzzIBxi6ZKTSYsNkMK0jOFBbg+ViY/4VFz4WBxyPeQ7IB8PIFe9tKHG0cs12UtplZy/iBxw kpwECIxwshnJ/UtGct/A1JkNyBzXEVrCtJMi1tZNFhD6BY0JJEEgtJ8BKMFAGR1AKV3OeFr/jed0 ZRd6otB1YdpB2YzTuSd0uVCt5BRN/gZxAMcB5mcxFqDCYBTRcAwtomVY0qLRxJDF1M1Xpp3QFJgX uZhPDWHf+YZhOlsz0qWndArkRRIdldXjaShgMk42/mUfORK3Rd6IfSMcPZgQqpU5ttgaeZ6MGscm IYcS2o7X0JU82pvvsAC/vYINhIA5dEd3uP9AdjhAd0yHC0iACzQpBmCAkSqpOZyHC8BHCFQpfczH lN6Dc7iAkMJHk9JHlQoAltYHAEAAAGRDgRgIALApAPwDm6KpC7DpmsLpP2RDm+Zpm+LpnLZpgxgI nvppnqqpgdyDnh7qofYpnRJqhAAqfRiIADgEBjBAd1Cqc3TDjnTDd5gDpj5HpXaHNmAHphKpc1Bq ozJAjGiDBKCETdgIqmpDkuAErGqDTNBqq85IT6yqqrIqqqIqq84qSkhATQArdGgDqGKHqGIABBAp pVLqsQ4ptIaqd3zEpE4qp2IHte7IjnhHp36EpnaqtoaEuFoqBIBrSoxrS+yIj4Trsmprtbb/K7K2 a0NAALJ2A73CK71+iIuMRIt4SDjMAIWR1SJ1GFnZBlR1igsC0oeVTooqlSFkXjj6YIseWyYd2BbV 3ehREY2BEjxG0Y3hWBTegQSYgwNAhwRgwMiirAOsrASwLMq6AAY4gHMUqQM46ZQWKZTCrM42qZPy rM/+7M9mQ5NmAwacaTZAgJo26ZmGqQskbQMkbZVWaXvAbANEbdQayNUqbdRWrdM27dMaxNFaLdOG 6dECwJyerdk+bZWqqdOaLXYUq3ZwKnWkBNxaB3XYrd0WqzZAh9JW7d72hAEArgEYwDvkhOD2xN76 QOAqLuLOROICbuMG7gcEbuQ2rjYsbuAW/+cHPMfecq50FKvdase2gu65aurfzu3ddq7qni7dwi3p 6q3eWgfpFmdLpERxiu7t/q3rpu5zhGt3QIC07oi1YofwsutHnIe1NuuQhsAMOFUk7aUhMU4NEuy1 +RGITh4cqY44Smw5thURulje0J0VcRI7zhWN5aiN3ZW90WOORUfLqiz8nqwLIOn8zm93IGnNPumQ MimU9q+R5qzOQkB6VC0Bb23bbi0CJ63ZYi3bfm0D42mBzOnTAuoCp2kE5+marqkFu6mjbnCauqkG Rwij0ukC0wejqmnVgioDmO7c7gjotvDunuu5fgcBA4CNXC4ODy7lUu7lUq4EBO7g9vDf6v9wDgcx EeswECMxEvdwEBvuTHgu6nbucwCvC0drprowFrdw724x6lpHFZOuts6wDG/xkMDtE8twuNJtFnur 3J6rtWoqtiaru35HtborpQqptRpAYA5sh9rG54yVXX4bh+qgUWWexEpoi/GNWu7axUKmEnpNx3rN ZFLhOtjKHajqypLsyb4vkzrAyHrykMpszA7pku5s/0KrzhIp0Ppv/xIwBggtAQstABTt2X5t1rJH 2jqwCV/w2upyL2PtAteyoypwhFzwo/pyCQ/z11Jw1d5DlZbwskaH3NotC2MA3PJu3kYHdLTH0WbD DysxOH+zAYgzOI9zOZ8zOqczETtxccL/RN2O8ZDi7TVXcTZDRzb3rj3H8D3HMOpy7nOUcT7jyDtL Mxbb80cAr3dY66TCsXdYqvKixx0Pb9xm2ImSFbZZtCHN4DRK4yCbjrPtxm+waN+dI+wA1SKr4yYl 4RXJ1cb2TOmF0umd3q2wXhXsrycjKcmq7E3XLE6v7JJCKSkPqSr7r85WrQBPLQJXrdkiNS0PMNMq cFMHsy4vswTb8jCX8Ag3qgSTMNqe8DI3Ki+T8FSPsAsIwNeyxxYbaxRvcTdcs3TU83MUcAOoKjor 7uDOxF0zcTnjtTqDMxcMLhfwdTn3sOH+s97CcKluswub7tuKLnWIrj6ndXR88RffsOz6//PeVjbp 4jM9V+sUU6tjN+vv1vGmeva2kuuknocJGJIS1CDpwOBYsWDBPh6HKlKKplU4stgaqZgatVFQ2Wjo YZEj107b5Gjp5VVMmxINVMFNn2xzOzcpx2wn36wox6z+AnWR6mwIEHWTHnUKO2nVem14q23Sqikt W3XWBrNUmy2h1jIKc3UwP7DaqjdVwzfaajV9J3Mtn7XbDunn8q5bTzHdxi3cQmkEm0M66/U523Vf A7aD/7UBQLgRI7GEL3ESN3Guqi6Bx62mZjNCd0eHD7QXd/FmD7ga724Zb3jrqjhB/7eosjF2YICm Oge2fqrybjelIuumams1Rm8MVuPiJP9sp3C0iA0mWkHYDPyGIYygYgbVOnoeOy5H20j5xsKbE0Sy E+zAjdUj6sVKTrfsJs9vy5oDmMOsc98vUMNsdKfyegAwe4gt0yp1nBPtUo+31ro30s4pN4e1Lsu3 em81WPu5BDcwm6ItoOd3oItwhJj1CjQAmUZIkqLxWmf2Y7tuZbdHhCh4g1u4Ogf2putwhUd4gyOu qjpu7Gpxhz/2iH9rFVe6d9Tt3WqxFsdusR7JyO5uFqfEjHvxs/4up+4Ivdrr8GKAkIo2sNMxajOA CVwYDHJKVLF26Rzewqag4BkOSG/e6qAbxf72SU95ft2o+UJBcddV7nwsXtHjcoO5Jy//6U3vL5Sy bJOKsrxHN7TibM/mbP+GbQO0QyqnsNlaLdci7Xl3M9fGspynLVbvsi4vap9v9aDXdwSbtX2LtZ9/ dQOfdaPjKb1ShzVPehTL81rHuQ7PxF8z+KcbgMnfdRL3hIRrA4Sz/DqHel9neE/ccO7CtbGusNzG s4gHtM/nrUHX+mGPcYp78c8H9HNoapIKL7fOrKUmb6UuL7FPfY5nq7VWI7WNDob9JYZ1GG0TZrnJ peYJIZOnW1CJrxGWr2MSt3Fjude4yseyr+/odMsiqbrLbMvaL5N2sirzrylTbZOih1OH99TKedTm udoWfC9rbdoqsDC7d5+HtcN38H23/3cJN7oykzWid7Axcz6jni2oTrZkv3CJ5/p6MAgGLLFg8zXr D7bKTzin5zXsHzFgK26Fyzynz4SwWvroZ7FnjyobBy88F/TH37rH/3eAS6vyW4eoZippZ6tQG3uS Iut5fEf1CzAD5EYejWi10YbB7tEdbZhgzpG48SAQGvI58raq4N2Tsw0ntdvsDPcSvnTu5A6sqO+5 20oVgLl0a/IoryxAOMDgQIILcwMxmHPh4KCLhA9dQDCIwaGLihYpYmhgkaOLBhiyNQhp8WNIigA8 hkQZcSRKkQ1QAngZ86WLmDZh5lRpk6fMkD915qQpk6hNAUJ74rx5lOZRlTNhQoCg7f8gVavmGFzV ltUcVa5aGzZYAcGcAW0+zBpQu5atWm1s0bbVxqUtXLp156q9y/bt2b166/I9q22wD6tXuX41h5Uq 464HuSb02pXrY8Vbt0rATHnz5sQYuE7FmtBct8WgFzM4SBayC9UMIo4mi4FsCNAYbKtuICKOlt6/ fSuKoyROceHD4yhSopz5chHKRYhQEn16dOsmRITCPkPEDO0zTMwAL558hxnmT5h3cj79CfdOTsCX 76QClPpOoODXv6NKkzt3brjhDhpuaIWGKjCQgCAHGCxIggQTYsgBFxSkcKEIK8oIo4o2ougjj0B0 aCMIAKAIRAiywWCljUYaaaObREL/8aWdaqLpqZuA2qkophpwqscZc1rhJSF9gqrIoYC86UggHaLs MbAag1I1rUJ4qYHBAstSr7fqMswwvb5Ma0u4uASzTDHH1DLLwrqCkqytDnoMNdVKm/JNOjH7akpz fHjSySinDPSxOLcijYFuGJAMgodUu61R2LAyiKxFVVvUttxcY0AE334rrrjgfFNCC+aSi4O3U02t TjrrosPOVUNMgJW78Wgt7zz2bm2vA/jim0G++JyADwpg7csPCiicyc8/AWkAUMAA71hQwQcVJGgh BhkayCGBFMoozonAbfLDizx0aEUVLRoJRBezkbHdFl/EqSUgW+JJXpiAUjKpoZQK/4qoJIEkssee ghQqJx+JEoA1qkBDDEo/vboqpY3OHIwui9cqbK130OrLLcPO/BiwwEKWKy4D7kpZTbMKO8wyq7Ii iytEG2Pt0DoXixJimB1+OOLQUmN4tEdXg8xo2iBDGtNEK5XNBBQ6jUOa3ngztdRSl8v6uemas246 7EQAm7vtwp41PFrPvlW89GZoz1df49v1hAqAvc9Y/YzdYZD/nh2wQAHNqdYcgiCklsIELSwIocAz 1JAi2zY0R6KNOgRRI44aoPyny+utcWKeZrpXyRePVEp00ZPsScd+m0KKx9GXIhglAZSS7MnL4NTq ssdI3MiFMDMOE3iW+VrZeJTNHP9Z+eNX1kYzL9v000/U6qTKNNNK+1PP3Pn8U3vvG7OzNJnjlNxo 80FzDTf0c8MNNYkSvdQc6ZAjDrnmoJNOEfyrU5VVVsHmKu10xwShGI8BbTWDdZzHPB04wdvgI7df BSs+9sGP3Y6VrGPxDUDOAtCBpGUtEQ5uQoqbEAYGopATfutb5NoQR8oVIpSgCCSVqwm6PBejHIWu RjOSSehmxxMf0a4o/2odTFzAo5AITF87Yp3pjNivkHykMtjz2e4UoxGVlCV4cjkL88BoFh/8pWTI W8tfxHgXv5gRjXwBmQ80E7GfTS97M3OMw3LGmSdF7GWWAY1paCM0QFbKNImilPv/0Deb2rjvUu8b Gm+IE0nedG1rXvuf//rXqrBpclbdIaDZxhMeE5hnbW3D1Xre48AJVkBYwbrb3fizrA4y6z+Dq9a0 Cgchaz1ocE2CCApNRJGGTM5Dl6ucRUoEosyxhHInIcm7UiIj2b2IXtQUCezudaOX+Cgk3PyXNvNl MG0K6Snl3GaSZNKkw+zpirrrijITwgUulTEww6tn8rhwMjS1pY1sIaNc6tLPtIBMAiCLHs/u1JVJ 3U6PnREU975XmcmYr1Ko6cZtUpMQpiVkNokyWtM6yihzzMA51FnV/1B60pQGUJMF3OR2wvNJ8sxU PA1k4AOdoEq5xSc+rDyHK+2G/x9kZXAHd2hCHjjYLAJVQVq6VNBBHLQQC2XrQdlSyLcoIpFuwZCr LJkcSUBiLxjxpF6gY9fpipQvnBAxm0Ex5zeRYiMjIXF04SwiXeNqMADcQ2baIA0fH9bQx5iOnnjR 51ri8kW3YImxZByj8vKyRjHm5WMCTaOWnue8s0hAM9Hr45vqGFjugSUru5sjBrQhmkCexma3mY1t RjM0rCQttnRqmnSmowT/mfQ6KGWpq166yQF2EjzfESXabHorUqLSgW1bD3xYWbf8uFKo+4FCLI3q QWYh6JYSohCDDqcgigjkhBZCYUM0lCFJWUQi0uRIiUTikRGZ5JmUy2ET4+W50v81ca14lQkRkchW bCIsiUI8GFTYCuDVyRUoMbKdlG53FfAtswFcJBMYC1tYwdSzLxpGk8rccsbjsYkwD5sKOx+KYvDl TFDXqwrRtqK+R3H0aEQjzUUbVVuMHooB2BmOInC7quoAVwks1eT/WNrJ43qSVgikqXLb1tzmygdu 87mgUIuFHw0mS29NqMIsndUKpuIyhFClSEEY1JCoCvO8TXJzRF64oY98yHcoQmZ9XfCumujZrEDc 11ybIi8D15Wu9yISWvUqu2nODq88YuI1XyIZ07ZzekqxMMk+YDLKhpGfeLFsQP3J6TV5iTBwjCPP /JQY0q7aMYnpI9GKplFZxxb/th619W1sIzPXRoRpEeFNqLRwKt1aEsm9De5vNwkeJsdUPGdzdnLZ FuXntoenqzwHKzGItx1c9z/+6aBSARdCp0ZocA8pt0PYHMysbiiY8/UdSaI5EhqGCIfvqnfqgKjf +DJ4rmqdXUx8AlcAC4mbRupvWv0FsHBC5caCHS07vffDeNqTn1gyAPDkSXHEnoniGgexluSpvHy+ 5eN4KWipnVcNraDaMozRE8Qgbj2Pmg9OiFrMpGZ969HA1lK4+UiVIJA5oQfdI/BTAjhQgALfQC1U ww7b1wB4ZODGimwChCmtulMrUqrNgejxlU4niB9i4W2oyNq2M4o6CC/3TUBe/w7hgg4iobibmdzZ mkgLMxICF1YERRJBF1izocwUdc4l8Y6XXEEnV5mQE0gF5zejaSIkIqmE8jD5F8KqKXCDw/VGNhGN znzWRwk/pWQns3jGJnvYLpaMS3R5bKjNKEaz7GUvigWoG/PyesH0abMtc4zLpSdRVbdacuGTeawh YJrWos+j8Cu60KEvdPnKN/oNQEE4wgEOb4ADHFpQum+0IKqTFnlVU2+pJ5O9bFDWSutQjjJO21bt at8nqPnZAZZ3wJ//ZJdZNzhQgtKMWgiHWiJEmAQCISbCccKlmODt3eBNmjSnAfMsv35iYqaowfjr rszJrgxMR7ZJXopEADxwh/924nUGhl8QDnYUDjVyJ+YghqG0YZlKRALOqIw0zmPUQvX86fSIJ020 ZHhCrgZHbJ+yxDBe0K8Wo5AgqrScBAZHgyrehDScBKNCqgGqpAGCrvq0cAujLwRQoAiKIBzCMBy2 j/uYrjfCL1V8S+paRckIKBSyLuuarabEY4FwJT2mLD2mbT7GrrqOxewA0cu8DMwKZMwWZEG+a+6s Slvi5LzMje+6JSxcaM7CinPorIYmsM8s8PAKTfH+bIkMRsAAICaIiIgAYPKcgikSBiaOgilc0fJE QsB+xAMxb/E2L3NQiNI64/cYBicqrIvwAhhJpp940Hgka9PcKBlFLvY6bU3/Ug9mGKNhCIUxdEaP PoOP+mqjYotSuLAbM+eHupFEwOEIHuAFXmAMvcEGvAEFzJDpREUNyS+4uAP9yEbZQukeZ2qU6DBX vq49Join6C/L8iNZ8GPb8m9vjKo/PmhAquC7JCSXCLDc4gS8CsKX0I3duMqYQkSZ8mxyAq9GtEiL 8msT9+Vz7orx8MsTQxDg9Kqb1ooouqkTWce/8k0FbXFHKuzBjtAJJUxGAKBMuOQDPGzjcrAYiTIw iDGgykigRu7iCguN0GidWg5nbqYFGSOkBkU1XEz5bk5ycGNytPBfcmIswdEbs9D6dCAcjmADXkAM sY8M19EM4wAcPkV/1hC4/8ymgAyhuNKGpjrgbGxKyh5obiBI/ijogozlDwER7aDgy76sCdjuQLpr WhYCzebuIQRiWxrRzRrCzTQSI1JkXCjHXt7NmTxHRVLnhy4Qrxas8ToxFm0C8qCInGjnFbPhSJxi FH9EifzsvxJOwNqKJjQKsHZSd6jic/RpKJ2xTDgG9Zjn02DPZNRontjo4tpIoM6CxSCjMUwDCrcz ewaFYW4Ge3TNKxNF6H6oLMvSG9mT+rxBB4rgATYgHNKyLd/SG/CTHb/vN3IL6jRpgIbLBOrxk5xt H0kJPdSDPXglp4BlbrJMP5zBCe5PMQ8yIZelCVqhEAFwQ59KICKSlzBEQ//QS0OIid1G03dKBL5A 5B86svBconNsQiT97c9kMwUDDAVHsZv+iyh4VCxgUTdV8WAAgPJ8E0jxC8CiCK7+RScdSkpADymK kEuAR+OCMUuaEmVILkxALAgzrvUqZghFrBkzhjD8ZFIKRVAkbU5+jyyux1LAshvXkz3lVOhQYAPg cy3p8y3fkh3jci7PMDhUBdmICx/9cqZsim2YK4Li5jCvzA//kDEh9cvULrs+SEAahDIFcHAmEoWy JUEa8RET4oUux3LgjEOQCRM/cyVelAJ7CEZWld+YyCZ0hBQnJhWT6Ed0cxR90xRH8VaHokgVT5zc ykdxcnSkEfQiTPQeg5r/MEDUnHXj5slLiHDE4gI6Zy9jau/1vihbGQq14iQytPMrXEy1pMIc7Cv6 4nROuTAL2RX6IAAc4DMcNqAI0jIMj0BPwwEFts8G6JIdo2Y42HBsPqk7jAttEuhQ368w38Mwp+tY yM4gK3T/AqT/7iBwGAQACafcIrIAG2KF0svvRNV3fKddOHI0K1BF0ymZVlWKqIkEUzM1I49HW/FG Ig9Xk2hIZ/FgYhJhVGJHxeLfEq6IoMhfJA0aIcxouyJzjuLSrNTiMq4oc/DCiqdKz0hLlXN50GhK gfJL28KgJmNK5iS1GpFpzIdSFuVcjSgcM6ddsXBt56y94OxET4RyvhA+/x/ALe9VT3FgX7VPP+PA X7UgVEyFk8ombAp2VmzlLxEWD5/Lgaptgl6J7LZsMe+gP6ogMm+gCm6JhKAqWxhCM8dLqn5pM4vJ XE3E70i2Q1ZCz8qFRXSIVcUKihLPI/aLYGRRYBhPJYJ0FF0xNoUCAFrxR3MVeHcTXxLNFKuJKVhW OPMIj1hNwlziH8whWynL9mSvjDAGsTgtWhELxJDxssL0WReL97LCKqgHexqGTpKGLM71G7lw+uYs bk/EI4ypSqjPbYMufykHAjLABuTVXsPBPsdwb7Fv+/QVHPj1b8+wOPwHL5lMpgq0UL3ObSJoDxs0 WPDGlSL0uq4rYvkvQ/8ZEmMH8GJ5iSEaEUQhAr08k6vebVzsBQLJyr08J0YJZjUXrAMD7DVF0HgF wGcnbzd9F0h91fJudQVCUClu00d7mFhhEcBeR3ZN0CRWDEqMLxrNIZ0WxbBw0Dkr7mOYM2pBTk3k iZ6iUimXEfZKbjCchE4QRaNoSyo0Yk6VqW3PMvrq2F3njAEocTS/So9hwwvfcgz19i35NS6Tbh+Q ji771Tic7vyOaw4NFcqaC1GdC24Ms5VeiUKHCu2GQO2Qapb8z1IH8Lui6qk4Ne40s3GwaiO6xYZM pJlC5CNWJJZh1CUIDSgW7RPpykaYIkd2F3kPTRUJziia+EeZKFdVMYn/34pgHk0FPw/meuYF+wUo dVBLNCbEqPbicG9Lh3H1HIsYoXLE1PgqpLEbWutN3XcspW/o7At+1XWdgc5cg85c9fj54gBf3xIH CpiAs49f+RUF9sEG/nagBTd/rOM71K/Zto4fb4W59PChw04/Mngg/zD/rmtv+kOWCOT/puViNZVb IOQgOBaF7k69homFwQojXmRUVzrwSoTPUvTOesiGq6kEP5FfWjGKeCRIlzhXf5RYgTZIcbeYfXaJ YxXhNnAlpliPvscqZLDC1EhqhQcop7VpR+1qwbRLWk9LuTr2OoswmNA8b6P6jiL66Hfo7vedzdpt 52xti45+Q2BylCAc//wXB+raf8MBBxIZBw54+wZaLheYkqYOH9NGHw80YfOwyi7YCX5qojd4IM8u /76M/7TrDjrUlgbQlh5CAlDZMjPC3IJJzkJbh2g5RiTQStRlVW+YJpb3dHITV4kkJsiJeHOUFXWi FX0XeWmb0ZJ4t42XtzvxriCvYC5vUZJVwsh0FxuDdl1AesVXTRTrmsG4m8E3fK819iQrKbF5sQyr sx4De/Su+u6BwuZYrdFVrWGDwiAA6OQrDvw5kfkV6a7vvZOuvv0Wav6Ukf0HQAuoL2lqgZJrylTJ PXYKgyU6kyWUgztYbyr3QpWKBvKgzDwUIc6LvBzRl0C7IjpTIkz1mP8+JJlQNM+0CEReVSQJhoda 89D2y4diM4j/heBOEPKSuDZ104jPqYf/Cyds/BVxvEd8VkeZOJw4ELRgEFlHy5hgwiit1J6oNC28 VMOAZ6tb7yhvT0xBDbrbZKPOknbJG0716svFMp3fOQvjNugYQAvikr7fO5GhxhvmMg7cPOneHGoY mDnKrw0heDwC/P16hUEh+oLHLjG1jIMZUw70T5aexf+YaoSlBao0NXEcQnG2ylteud1QmsM1B4ZV 16wgEJdhxN9k0hOPAsZxG8DuYXhXkXd1oldZUhWL1aez4bV7Noj9JQRpMpy8Vbmp8Y6kp8UBgGm9 WI1ABroNIyrfyLD/oFM5wdlKkT141Nhc5cs3KSws3Tdd2RMcxdLat/CrGsC9Efjb/1a+8Vug6xuB FXig6TxwGdmg8bK/85EOvU653GMG6OYfJzqDty2DODj/GLzBm6AJNhpAqmWUUahCzI28NDwzN9Mi NXzd3o2+RNYh+ExkO6delqQ1XdLWMx7gkqhnfdymg4i3b7J4b7PAZqfyRt2nc5rkF29HlxfQcMIg 4KQ4WWy0JOcbZV4thBL3tNqabxBqudu6uzhMuzR5/OlLrjSb3WI0Mme85bba1fmHnD54qb54pd28 8Vi+9Ngc2PGf4dwG8Pvc5Rzdw77sPcV+eKvqDOiRuS5Xpq0fJYgP/6krMZElwSNbDrjNqP49Mi17 AAeCs1OI7h4kcShdvUTk8Ee13SjCJFCi3lhiAiseiZgkJV92BGEitonVBFVdV3/bV4mo5FXxl2Mc V2FyFoH1p0+RiJVXFkdxYUIPuXldKZzbsIh906z3uQFD2KubZHjfOdeIGI1wre83XWXC6dUZ69Mz nZOfPYMuCbaPbxVYzss+7P+aoIeDU7JmyFoKVgoWMNemAxoIpwbc3u9m7rFsqCCWPxTSqDJ0oyNc WhySAAdfYzMEvbBqqzqzdVm6dTsiXvoOpgHCRQMXAARmawAAocCCCQ+uUMiQIMSCAhICYJhQAMGM 2SJqpJixIUaEDf8quvh40GGDjiVXJnxYESHLmDAPUlxJ0qZEiwpJYjCnDSiDoESHCiUKVChQgQ0Q AjUANaq2qD6mRr1aVerVrVy7crH6NWtXq12jcoHKRWxZsgbOXg0KgWfTuQLmtqzL1O7chCT78uXb FLDewXsJN82LIhwOG97A2QCHIk5kFJMlK6lcWXKcOFriKFH0WUQcEaRNiJhx2gTqGaxbr5vRAfaJ GSc6nHBCG7eT27ed+L4NxQmU4DugOHNS3BmUHc52MB/SpMmdOzeoV6dRXYIDCS4cbMfgwFx3DC4k mAPvArx4B+V/pk/fgPx7FxBcCJxvv/59DAVXQjjIn30R4URQgA3/rURQghEdeFBdKtn0UgMwbZSR RHXVBQCGD2J4IUEPQdhShghZZJNLB2akEIYWcYiQiiGepCBD8UEQVFJI3ZiUUUmJVyIGVJW1ljY+ ACkkVEVyNWSRR27l1lbauAWlk1w1CSRaPog3131N1XVYl3ll2ZdhhAHGJWB/BSbmYBAkFo43ODjm GGWUcYbCZZxpFtlmnW22GWieKVGaCKYNmtoMqpkQW2uzzYBbbYzWthtvvp3jW3DCXbqDcMMtx+kQ zg0yXXU3XHcDDXf8tJ0EGHCnqqrmOIABqq/Gyh15sbpwHq4/DSQfBrwOFF829x1kX3wuEHtffwki ONCA/cm4k0Qp/+HE04cWiUTSChy5lNK1OTHU4IglEfQgRQ3eBBKKF117kkvuAtAguSXxJOND5tho 1I0MHAUUBjeGwJMLRgI5ZJVQqVXWB2RZxTCTZEFZFcJmIUxllG2JlZY22vg6GF7AfuwlyHaZiWaa Jo98cgMoFBFOy4xBFocNkqGQhBaRaVGzZ5zVrARnPfdMmgiABrqaCaEc2hprsS09WweR2rbbb1FX SnVxxBmXXNae3tFEFaLegV2pVWin6nbevXqeq+GhV2t35+Vqq33y6eerfXbTHV9/xP7XrEHB5r2s TgziNO1DJx670oUuEdThReJimK2ELsFE0kUffqRiuCja9FGFGf9KRLnjkIvoOL0wWrQTjTkWhaOO RhlFnk9OFiwVlQbfjvuSUr7lg1tsGSDkk2s5GVRgWnrcZZYQDMbUl4YJlnKa0Nu18hEst+zNYyiA Y+fNdnamRc98/kyaEuYHerSgps1wdGuItra0bLHpdgKkvV1KdXBXW82pc0M0V4XoUKcJpipVdVb1 nfa0ij2zOs9P1PPA9LxNgu7pldziM5ACZXCDCTKIr4ilN2AJzm/TktG0dBITcN1lIy0pl0O8NboX 7mRECdKQhFQogBKBaCaiY6G2JKcRmngrQgeSII6OyK9+JQUD91jJPWjksKxE7HcGUNhVPjCl4OEu iwajYlu8QkX/KpljeSizy5fyIpC6gSl6yfuY89g4GBQcIRxFwIFitmeDyUzGTkoIn87C95lAgkYR 5QvUaVKDNNXATzaPetRtnBY1SQHnUstBjnGQ0xysDWE5crhDFaZDHeuU6g4SKJt2XhUeWJnngdyB ldtiJZ64yQc+7wGWfQBUrGP95z9pLIiWQqggBTVlWtKCiDFRyEIH0SsbKnKQuJhJro8YDkUoCRG6 1GW4xCXOhzlpUeVcNJJ6Vc5CDYDAvYKSL37pCJ1IOQ+aBCYVsUyFLbojUlasUpW0/MgA+RxL78yC Fq+spWBCsh3wzMGlhdhyS8wjDMdCBjI0rpEwEm1jmlDwAutt/0ANLYOTnL53pz7qDFCeAY3QTkqo QRkqFIZK2vviF5vazKZR9Zta/igpnEwtJ2vOgYIcnBPA6JCqFWF7lXYQOKtauQqWqCKPA3PlTvrY J6q9MtZCi5WN+ihrQMsCQN1CWMJinlByHeGmts7VrgVZ6HQhqpwL78JDycGrci9RFxDr6riZJJOa IaHh5hrSDaXYaLD8KsoSm/KQBmjRi1UKC1i0+BbgLWxgEtNKWc6SMYC2xYsPq8oYE6LQwqDpIGZs I31S9kZgqbE+5RTI8k4rMsLYoAhznGMdvZE9cMzMMnXqjPm0IDRACbeQgFKpagrFGkUmLaa2YRSj ICnJ3ViKkv+Zslome+qMTTqnk9KZTgFHRYOxfeeUqUzbA9c2nliq9z1ww48ttZSeggSIQKoFYbJI SK1mEa6bHzHmguhVOcOxCF4sgiaB0wq5zrVwRBxinLisNU13AXFERGSctLCFoRkmJLBAYac5XhcU f324RkhhiuEkUKV6Ak8tkPUnkeJpO9/5LkmMZdJWqlI80LYkWcMsWbvayDH4Jk9LYEqjXcg4FyQf ZnnLe6hevKED2m60TXZ0TPZm9j2Rng+4wx1aoExztOO2NLkwpQ1zbVO/R0VtuvqjZCWt278d/HQH ARTlKGlgKqSqUpWrSo+qKGje9NgqbnJL43vmlg3y+FK1GfT/KrH8k1X77let3TRcMOsaubLmsCQ2 kWF/yzpEmeDkrJV7XH7zOq51kUTBOQxJWvvaV8W1GiTFjM9gj7gvbeT61rlCnTmo4kXHYoUtld2i Zb/IzxqbJYw2XvFDQ1tGMlF0Lk5OU2qFHOSB1AfJX2It9aJcWzriwE3e2N6cevszJUjjTyftsmkE pb6jsVS5sFFavZurm+dGMpLBOQEU8nC14/Q0a3PernS+Zh0ayICU4CHbqtBGKwm+zVYTn6BUMRCC +TDabsFibTAXat8iyohAKgwruqjlIW/m1SLZXFEyRX05a6ocABMiHc1D5CLDRRhyLLlIWtvVc8OV CMA2j086/0HMa6TXCCLmtCdnd7fisWAx6lSPJ/CmxJUlFdRgWOpPTzSs37+0C40hsEvdPC6y5rG2 yXPJOJOXfNptd7sBGbCBDo6Ad5ZxdNxyOrdl9mQ+kw73pF82FCKTm7TXxJQ1jYJaTSXlG5wSJ6fL aY5zirPdT4WKgHc+YCnBsyrQq62pFbcgxedTt1leMJcF2g/J/SbCuNyXJ6TVYX7H+kOfUzO/pM79 DTX9TFi/i8LiIhEMi09EzVkzJLCO9Ukc9yGI/EQp+qL+T4iCgV1/VnZVKraxvz+wiT1MoFdHy1S+ IhUnk6wncgmTXtT+RjKuvSlKvk/ZfZXtMQ6k7K5tCv6pV/8EOkBHc9Qyi1Fuk5EEdTJS6RZI7SY0 KSUCYYZ49pYoTBNTugE1TtMb/uYEeYAp+9M/mqRJzhAqJWhAeaYd4dFKrdIe9/JATPVAE1QfsaN6 rFU3QuY3CcI3HyR7A2JylyZMC5Jqq+ZgzKRNrbZqEMESOMdWc3VzdTFNQDcuiuNzyjSFpvY5lpMi vLeFDJFhkJNNAqA6SESG5zRivYYT5kA7/BRZ4Mc7XWRQx1Y7AeViR1IVZZcQvqJjckEyz4Jy1KYX akRkODgQDEB/DWAOTVF2DHBarkUfbpeIZTcXdQdu4WA94cBRcCIzKBA+3uNHfSQa5zN4SQBmJmCK qKFIh1L/Zo6yG460b7fhgZjiZpmiHJf3P1DgKblYZ6PSCqNiQDdgDgv0Ha/SgrASg7B0aMk4HzOY QXeTaLr0jIDDLIHzMSCkX5eGciNULyPRc9hiLhjxhYJzEVCIfKJzLhmyLnMVRDyxadA3IiDSfPPy OCAxj8zXLnWBL9S3a4aFawrlVUWCfkjyO2KxhmwIRgTZYpdVYwFJJM1DEqE1dC3hF9N2VYdokUom f/Ald97mAobYiGT0f3OBAuA2RxzlMgdYGX2UBH8UXMAVPg74bqVYKPQWP7MhU04DNWp2U26GHMiB XQP3HHK2A6EkKqaCHaZCNuVVXi14jOp1jLoiELliN+/B/0tGpiXIom3CQjh8E2k9NjgoZ0Ld5ITk 6HJVmFYLFmEdISIQIk2pJmCpVkMu0WCl00xJGETU4iJG2I1+RSJJ6DgYMIaDJWIehhTZVyPiAS0a o2I3lnVGkiS2k5CWRVD/5Ji8QyVbh2xRoSo9wX5ociYSIRGl5gJNpDwWSYhWaUtsB1Hyt2TaFgIY ZxfegHeWyDJ6FycosImaAT7mA4q9KVxexgTwZjTDqTQvBRvz41yP94prhlOYpxw75RzNkYvN8QVB JUrYwQKjklSpFHqqQiswOHEUNB9SyYw3OIMe5HoaVHusNVZjVUziFC/u+F+ecxcr93zzco8HUhHt yHwh0f8RcVUR23IhtKafIBKgnIagLgKGK+Qt2jISuKIN5hRY+lJ9NzKhnlkeyRZF89RFKzaQNbYw ylZ+begkYGImM9SZfOiPC8VBGFROSWZG9dcAbteRrUWjiEhGY5QXDyVHtFVHdeQy4XBuCdgzMfBb PwNIvRlcQaM+pphIi9RcN7kbGjg1JwBwN2U1lvSTO7BJ0iln0HFwYEMdRnkHZrNArUIrTvmUFaQr xkI3Uxks96ElGICVwsI3xcQUIQcRfnMiYGlh4xg5WVg43gRqykQQ93ARnPN8KkFg34QQP2SEiYo5 LaSg7gKPMidgDkaXbbUiPmGGOMJrrVMjH1QS5jRPM0b/bMJTh/0UfuDXJJdJmVnnWZwJWutnVxPp fnzBFBmniBV5H6+lbR8ZMt72oq9Jf68piU0hR7N5iWpQZXmURwnoM4CXpFyWpIASnIQib6o4A69x b2Y2U8o5STc1HJjEKZbXU7nIpUB1cEY5KiyAHdvZZ7LynRN3jEwlQXZDg/iBN4iTLGokaYJDqq8n hAW7YPrpaqKTsBYyEjFRIgGqsIk6ImcFLysisdcCEjvEVy3xQw56n05YoDAnnyWSj7qWFBO6j7s2 oW9Tak9xMBojJREzPI5JbO/wslhxY79zmVeRFjYLPIGhh8DyF3xIF8bzkAcSUa2FQSAJo/3nkIXY kVHb/1qMqG3B6n92YQMbQFsvYEcswxjagyeXgaQ/8ycv2WVDk63w1lKhUIHgqmZUuoFUQ12WpKWX 91PS6VNy9gVEKUq9GF6pkkoLdB7hQUExmK/tBR8WNKePRqfsqR/9MV8AslXvCZaTFkwswaiC0zjy AqjquE3p6KDlgi4tx7En0mqdcy13mYXXVGqls3ui45c7oS6AGWJlaJirg7vsuRK/1qqNeaoG+Ya7 Qxasak+XFX7asFB5eCbLO0NDB219cZoaOYgNQLWMSLUfw5FMJhBUa056IUcZRUd1NG44gALIQBlE im6+pb5l20e8KQJJwKSmuK0tJQP1NlPJGV2/0WaTN/8czhlnXNoc1NlJoYQdd5CdeHYHg4tAqIIr S7VUL+hAU0VoUpW4tSQfGZRV/joQj5bBfcMXI7SnERKfxRQTrCYvKURWcqWW83JyMAG7EMtpiFqP 7Ah9nlsRaIVqJRwuaVnDLDwiiIoRa5Ujq7OPoWqq06eHFrEqxoZjM9uhkWm8QHIvCKFkntm6JSNt Ewk9UsV/9yeJ/ad/T3taOgosYYyjhehGIklbOCC+4aA9coK+PaOA6QZIfyJcgqcETtqkLdUBqrE0 HWAbUOMEVCpdkgdww5FJ6Gp5XToEjTwEPyUqRQk2BkQ2Z9pU91p6ukIe+vGaciMeHGc3vnRfu/Ro XbX/LHyqUD84OF5IOKQTYXNlYCqyVlq4Lmo5jhvRETHXEJ2zIbBsc7qHqJqTly3kcl/4TKLGjjKh xOm0MUhkFBxGYkskICfRdFbnhsG7RcHTJKqqWR4aF/plcloskcrHmaQlZFbrcfXhkV2ydjUqVVPb iIbYzoHYFDYAvnvnxriZgOgbBzHgGbv5ieGzvryZx0GzPsRpnDaZk/mLPzxZXTsFnf+zrkK5A0Bg nWGDnQfUQOyBpsHIwE9lK8bSXnOTH7SUegPxDwCrWpPrp34qI2GJOgwS03IFI1QoEvfpoHDVVpyT XxCrsAOKn/K4js/nuup4EucocwrLlzsda6IpFNPH/4+hSn3mdB7L42sUo2II2ViLKX40m2yPpRaJ eLV6sbyciqtEW2ppfJrBCqyI2JqOCCZq5Nb05zyJYZIG2Hf7XCdGWic001s+M1KA1G7F5aSnmIp9 DMjgCre/EYvlWq6YF4Jeuq7qCgQ/JR3f1YulgpRJWTaDG0tN2ZSo98kWxEHpucEbpJVdiRN5E3am fDhCOC0OYoWNui7y0nM8rZZqqSGIOmAB2iG+/XycS5YV60wV+2o9lLpSCLJ38agqF9sICgAQMJhn SJi4GxTQHGICQkNvyDBJYjC0oyQG8A6T6aHztIYLc96J+GgzTbR8wSWQ84e1yqJuZKwuwKtJ65Ha 6/+avzrGrcVtpdUAs4WJbhwnMeDXkiGtfS22NKMF/qwFAj22vykCwSko80uByBkp+9Zmc3sclXd5 /uOl2ZVdFU2UvsgCBowdTcUqoYc2DYSvcINxJG2DhRY7WFVLBrFL9wVpCAKatRqEoJMi4TIT8phN z604P7RpJZwtrnvUGRKfBzpNIQHEui12NMHCoHZDZqnUvy0S3hIuAcpCoAWhRUwUppqyJXsvWoUm Ljui3y2H9NShtxMU0a1fQmvFo+OX4hwm0a0sNtgUZOwrvHrOTLFaECUmcdeRMWBHXzsnmxgDfK0E fK3XCG4zYgvYEj40hX0oLHDhMvVIUsOc/7Y/A4f/Nbb4HLn4P0MQyb3otwpHStthVOXhZxgQWBCM rxjHXrNE0u+Ff3O6aPj1euAcwguBjSb3XxuhTBoCLipyy1rYERgS5TYtIi7syqp25I9a24AqzKUD xK77LrtMhAPWqcyuWJ9KWDgy3SL2E4FFtT3SRcQrotdcFtvHFC99xWUdMCjyTkU0ZBDlkI+YmvtH 17HVUI34MTHTdwhv4Hod6QiOgH6dBA7evoBktnmcUu1Dv/fmNGoGeZbi2JVkHNCJixQ9BF8gZ0DA pUBQ4jdw4ngWrwsMKxDn4pk80nZDtVOJaKh9p1yp0j2uQdBisNHXl6w8Opx7limUDYhKIeMOqEqu /y0mAbFCtKCz1rl35S6zRi5O2C5heEN09bFBTHtE5H/XTeZKVKHU9zZ8M1eIKKItFhbA1n1URJBY IYiOUxhykWDijO97XlqslYhpdN+CaFGptUa/CncMgHHmcBm4ifB+/egx0OB9rdeUYeDdQ6R6QtDB VdhhxlKw4ceALFM2tb8f6JOXZ3nomuoULQf/I8mmcsB/a0rm1dm27pS2JlVv2usYJDfKIqfKspWS S+yV67xhGdsbgcuyzdwGxqjepHMtEi83TPUDuvWEup/rImuM07kcoi42nTnBjNyjI2vU76gXQdU5 4i9Kd4ZDDKp2fhH3smKQed7eLasvC/+++wG5Qv9/unrFTQRgbcX/4wQQDQC4aEBwYIOCCQkubACB YUKECAlGnAiR4sUGGCQ6hGCuIIQGSmzEQOHNRhwbKFCcVJkEhUslKEgmiRFnJoqYSbToVKIkTk8R SkSIMEHUhIkZRzsg7TCjaYcOJzo4OUHVqhMnULJm3eEMytcdYXcMCSsnLJCxX+R8GQLkzo23NG7I pVH3BgYJDsw50OvAxV5zeDEEHoxhMITCLjAoZuzC8eKCjwtCbucYgEYX2RwWPHgwG2eEnxt8Jj3a 9OeBqUcDaCBAIEIArAGQji2QtYDYs2e3ro37M+7crYULcAEAN+/Yx5UX553NeOx7rwVkc70i9ez/ 6a2do0b9mrV14c4brBDIXbjsga5jM8egzVw3c+7jz9fGgP59+PXjD9aWsDvi+LQxYEACBRzQB20M HJALbRAkcEABG1TwQQoHDIw15mTzDrYNz9uQtdc47FAgjRAq0QUGFJJoxYosiojFjRpywaEQMGNg RhQJSiKclGzgEZweV1KJJCJtGlKml3BS0ictfAqqp6OiNCEUGZJqSgaootKyqq2+2moHrXZwAkxn xBKLrLF2MAsIsuQYQo644mRhLhnuCIwvCQDDQK/BFAuMsMAY69MhjxTLKDLIHFOIoeIWUq1R05hD TVLTvnvtM/JUI4+60VwjTr30GiVuPO+SKw41/+POyzS35FbztDgAVsXt09YyNI7TVI1zQT3bejM1 tmzuWQ87gUC1TdVcdasVgHsgyO8+96KljwFp3YOP2vlwZI3TwSr0tkAHvW3QgAm/NeDCFV+rSEN2 PwyR3V1hm4gg0WBkNASIWtQ3IvJeZHQhjgrt6KMGksCBx4NtSNgkIFciEkmXSMrppZ1i6kmJJqEU IYmjQukYKROacsopqayqSqsuw/wKCjO9GqJMNdX8ImY50HILrhtylosFu8yRQII9BQN6r8KALuzP vxZbDMc+GUto6cUue9rRRA8qDoLPGk2NOUq3li1eVI/dDbd4lWNVu2WhU3tX6m4jj9a2x8vN0/9Y ew1OAN+kY/W25MT79Lfawj5ONeJu23W31zLVWyA/6+PPvmrtgy++jvST71nMYNMwPnO9DbfzzxlE 0D2QEvraXRBBdC3E1V0TLfV3Q1QRIXM2A6midTvEkEUcU6y9gd8J4oggDPB1IQ4cfEw+nOWXtwHI hpGEGMmJe4ojY6EuNuooK0GGimSoSj4hjy7zULnMMVlOM02yZl6LLLRqfmuuO+ZsZS4a7sjLAaD7 N2zoPh1NUA5ZzI2cBjXGaIZRmskGvTJHGgh4BjQG4YzWGJeeSpmHPJnKlHlos6vicLBVtUFProCT nFadUD3OYdXb5OapYqWQN7RilnNARRtd1a3/cK5LFrt4lStUMady5sAWBrCFrWrNpz3vmc8QHeKo 1FSucw+a0Dt8MEUIuUdeGNDQRNqloR96SEOxEw3XMrK7Q+GOcS8yTb5URLwG3GgjM4pRiwiGgoPh wBt53OMeEWYSIa0kYkmCyZJi4JOLAaUoUopSU9bhlPBN5QRcSllWWJa+sHglZmMpk5vUFL833Swu OeMZDWRwF6LtJWl/4tOfDONKxwQqRxkxFEMWk43MKQpSWcPaaTjTS69RalLbuiCpSKip89wmmcEx HNmm0xu5CWdVLGxmqmCowu/0LW24Otsxy8a3va1ncJvijdwwqMzCfY0/5oDWOh0XH/tMa1qD/6ld 1krFHwJdEYvkMtcVtZGnCB4qRBT8IuoMiqHVwQ40JrKX6QLanYYSpHYECcG8bjc74cFRIjEIhxqY 1zyF4fF5OFhJ9FoypBjEACY8wRhQsmcCJhCFSjNwSshC0YF1ZEkq5KPkJcmUvjKpTyxmYcsO1MKW 96lllDe4H13y9zP++U8CLgAafI4WQMXUyE+OaQxXnbaQ4kDmMxpRYKRGA0wLSrA7qiEmDVHjwuBQ J4SuAlsNTZhCFvpGhcPJK6xiBaxXtTCGI9SVp3BlHfXwsFJay02mQAWrYtH1bOrpSICgRcQkzgdb gXHPOq3KkLVmJEAL2ieEEMSFLAbmrIoaY/9BXeuu6CiztRSM4ETKuhkReZFeLKJR5t5okX0hpKIN aYCPPOrRIijsjwqzASB75BIbuKSQNNGCSrGXyKEwUikmwNJTIumEPJwMK5dUn1DNsklOomUIR11L zZowvzmxoH6mvIsD8OIC+xImafl9pWG0qjRaYmaim+HqEw9V1l2iNTSmi1RntAZC1XBHtuUhlXiU aWFmogo81YGmrw6nG3Bak2/mpFtuDvfCD4NzhddBG3CWY+LsTJiEYjzxZeLZDchBTp7dsBZn4Tmf +XyWRRNmZ4LCdWRzJYidAWXI6TJ0UCi3Vl6wg1RCCPy1zqgLJJgh8EXs6EaCUaR0EUEBco//Gw7m 7RGPKwlHSZ+XkiNJFycsbelLjyLTkOX5KSGTSlUkiRXziQlMYIJCUM1UFrYM4U3sVUtb7iCXRz+6 LnW5A/+Ilie86MmVSAtgRbfKtMc4xiFjHYhlMqMie0LKa5VidWi31VaBcPBYnzpVYiEsq/OwEDnW qdtzikM3GAJL2K1iYbyeQ9gcZmeHkUWsbQq3mh7ypoNuLdavL3gPw3Q2iUV0DxIxq1ltGPFZgRoo u1hDzwgZ4LQVkhA7ufgRgnLoi09+LbzWCKJ7XwQzAKgtG0F0Ikb5S+APAfNDwFoQFBQhHIEIh8LV kFznIQxIQTrpIGFyyEMmsiccY2RSZlCl/5xmSUtXwYolu1LeQ5/XLC/bgXrbopabzUXmPJOBXAIz NPtO9aqAUpp+CygoruaSeLpUSC9xWUEJcu1Rqyan4n6zGrFhqoTS3JuwbpPXXY/4hMgBMQs3PBy+ nfCvpNIrcsSuHOAg55vgkbrcmDM4Sw1uma8xIjuZmB907+c+lANykSvHgKWpS1FrFTB9FCSfEvHb ULo+iLzTGmXduSuh/oERg7tYdIumy0UCT9e8NH+oGBzhzB7lo/NWQlI4IwNJKsUJxuucMRMoYZEd Y8EMal97747cz+TjypjGJBaYOQNN7XsfENxk/Ja7CWdMXQf+TFlpoOGJ5wDc9GIIRcvGDP8v1JF5 GgNNI9YzgubdzLkgvW21LKjzCq7LgnBtMsWcrxNrxcRqmw2HM2vsDNtv1nYxqpb99LfxFRraDfRw HbPJIbgynLiSDtFSMnDTrCL7tmexls76NnezDNvQvoKCN45YI8gQDnkppnZxNchTqCyjoDQCCYgi JoAxuBXhN9FgoF7yPM8rOIjAI4ULBIfzBo9SLh8MJCF5GNZTgppgguvSHiaIEo8JBSv5uKfos6kI r5ITE/XRpJTjpPVqr5ZruVACgiZwqkmbtBu4uf2aKqDxk8QIlEBZjImaDK8isKi5JYXYN9DiDLLy pbV6MBZEJnEKomdKMXEKJ+WwP91QDq7/G44Ps4570LVr4qtj85Xn4LrnoCa+AZxb2TXkKA9LuRvx AI+2yqZ/Azwicicde6cfe5wIDDfLkg9gqg2w0ogTOZ3IMDC48yIOIUG2KkHW4RDyYxRi2hA6gkUb xCg26jfOq8FZIogYKIJAOBjkwgGQ4pE3E5KUSKkhbD0i1DjZk73Z266l6AAs6a6oyIM/Ix8oCDSw 6Ar2CYujIgtFazTj+wLjG4JI0xk6oS/+4Z/74hN6KozEADw/wb7BQJSCaKChW63d4qXS2CWJIKZV 45XuMI9kCQ9zi5dVMQ0XwrpjSywY0469+SEOE7bpABUM2g4gmhtrKyzdsLpg6zXX6RS7/+mgqSMs MXINFJGWzYKPyYkWd2IibYCAbiMdImKiXDobioDFWlKUUlGXe3uyYfIOenMXBswQFETBEokIEAm4 h8gcGLyUgOKi3eo3O0LGF7EBNcCBIjguaETLiGOuIFw9mcjGQ9qJIzwKjpsSbwyZGQg5qfgzLhET 3xOLQlOfl3FHmakZtSCCN6mZm6EL5+sZweAvPbmqpPETAoIjpRm6y+S+sOJMq2mjp4zBDSmN34CV tzONwgFADOIhlTQsayo2A0wPFPKbWimxEUtAEUOh8Hixu5ksCvsrsyGxbDI2HXIOtiG7U2kOCnsc euIxaClF6PyTP+mxdQqoLEu71WmA2P9iJgdjtXrzzoNSOtkZI9GADIdcozSCCKkZKIxwEdtqiN2Z CNyalxppABRouNHbI+VxnuiJgZGYiSHUiSRQggHVxihhglBggSmpvZARx/C5gd0DtEuCmbBokwpt OeFrRzdpC0UzPrnImRuYk7qouRvIR3OgKj1ppavCKgHyqkTRJVvaLbCckdIAS6RbLF+aN0vBFVxR LNnglGUDFZK0zblBP7rhtdzgFF7bq3RyoQC8q1npFGK5FVb5oScFyV5ZlQLsFUI8zX+zOwc8omfJ SXbaSXjqsSK6QLHxTmaKiDx000uJ0/P8Tg0RFqxET+B6QbpTvI/QDD11lLMCkYg0xs//y5fSeYgy 00G11KMe9JEeCRIiidSeyLi51LiiiCkpqRI9C5mQm4qoKDneE8xBCwsoWDnhy0KYS9WakZ/8YYFW GNG6mJNLC5rq4zmPOAxRIx7tWxqssT5cOjhd+kwHE1Q5jVNMQU3IwrLT+FFjOhuv45sA9JvSnJtj uz8XSjsnLVLgoMQPOzEbQie/AcWxyxsOk0loM6fDebpPNDv2iBbAq8BoqRxSDDJ3gyd0kxxygzq+ MQhbuTwRhMqCesp6i7fX4RqNaBfeORQMaTwUdCN+2zypicFeciPhSYhl7CiMPYTmcR5voMbVs0aN yxgmuJjYu7OPoRI9EzmoCK8OkMLx//EpoMqkmWnHU83CtljVtgACEP3QMJSvvri5mxMMnkNDoOuq A1KIUjuNXrJRsPSMGVxYCiqNEaSwdBJSacrSC4pS9Zgmq3Uxi6zNQtybJ41Ex3q6YEssaEssShzS b+JIE1oW1sxEIBIWThEPVBmIjqCnywIy/ViiJZKWvHtXJSIotpqxYc03ZVVWXFysCHM8haqIMkod WxqygNIy0YTa8oMIrBmzzW282Skz0cPYHkwet0Q9lfhPIqGzAR3QIxSBJExCE1BQ29tUnNKpKASv Kfw9M7FQd1RVILCZnHWvD2WBUqq5ORGaoGHD/oKlnyuegUTKyMBMsNqMVGuwO+waY/+FysLpmgUk p+2oTWdTQN08wGiVRG1lnOoAO+LEzrmxISWVoa8LyQ1jFRaq248sp+OwjlN5NfSwjdiiMf6wHFHs McuZpx+LVyayj3hyCFiDnWOCkVUrKIgsVoRF2DW6GvIbI0M5EdkBLZDAt4i4yhXpXPXcLSuzpzQy LtHtKP00CRsIEjiL1JSCkp44QhqePY+ZkirBPZUlR3KsCvLZgSAWtN3FUA5VE0VzBuNb4uOjH/up ORrgmSaQKqBVUaTpiK1CIBf4L+ybxazJmqYVNdE0q2DCMqrclpdUV9lQnF9JDXdAobeBlSW1DcdC p2ZtGyK9oZe8RBpKph26K2oS0pT/bMlXMUCY5CYOY03THDaY5Le688lvw5YxlY8KxDFIHgy8C7z+ taY4VbqJ1ZBpLSb1iMrueLbHY88MvmBifLcQsSfvE01KSReG7bwxq4jQS8sVNkuE8ViZQN0YqK67 7AkQ0EbYhd3YTdBNxZJO7TPczd0rjJm2+KSWYxM2Yczf9cKZmzTjvYG/8Iv7Wl7l9ccN3mLMCDyu oqWC3IxEQeesSbpVI7/QLD8wSo/fKM1nC0500k1QzMS3wTplC1+wxQ2W1NqNfI7gXFKzJbu9iZsl /TCxg8Rz2mde4w3429KMWCL66Mmf1DtKLlOOxtcl49fG3Q029jyHJGWATWllHRFG/wEmXuxAOrqa 7qAX3JKdF/HTh6U8i9CM9bSnzNGIGDAzFnYe0h2SkfjYGe4JBU0k7CnZRULQ2J2BBIUklYVQH5bQ QCNiM1ELmXmZefzqVQWCKXBMWI1iFpjiPdE0Kw6gE81bHEmaqXnrsTqrBvIlG3XaKLpcSnk2ZU2n Y7EwZ4M245wV2JTSQXRbGLK/WWnNHuLkjVQVOo6siBa7uk1sZNs/17G6K/UrKW0OtE2VIKodNJUW oIxACcRX+bAPvy3tffOOHwLlF4w3OnWXFYxKf5W33zIjPXU8pL1rpA3hruTgMAMzGyiC0D3L5Enu 5uoRkhgJX46BYT6Ki7FhE+CYJP+c3byUgQaNpHJ05kP7AuFLi5rpUJj73VCqGXvcmSiOYlR6D6EF Z3/MzL/Y4Ml4GngDK9vKpQYz4XieU1Gp6No8TeuQOvfLRCK9Ovx9ukCeIVB86PnNq3BdbIPeSK9N 3xLzyNfk5LPrX2dyPxIyzh8FRV7LEOmcnCF6j2qprPzoCJ1kpwEODDkSlWJ6Srrut3je47c7439F z4U4WH2lJeplMpb+xXjbl6wEM/R0sIng4KDGgePiQeVhLuZOKZmwxrmUEiUY2YthAZI90KRggalm AZWFCqseHwkl4jEJPlQtvuP76mueAjloVefjGeJtAn0MlOhzJQHitDT6qhfNjCD/r95T8z7QXLDD Pc9QJqGt1Vf1k+xFTDZXsQ1CfKbEjlKDrjZmoVarnUSRlOyLtM2ti5shldJCNDavi6xlm1IXk9vz 4BUMYG3AvRzVvuQmIuChDBR2UZw9NvQmQx0vHU2pLA2ofBEN9o9D5besVA02orsStlyBmFgU1qgS ySWQUOEz01i3fGH/dJjn5hgF5fKMGWaSjSljDvM8kwFl5m4pJJ8g1l12rNCZsVkiqObfDWv0Vm9T Wu858RNN2zmlISCNkCUuq6WBP0jFKDWp4Ve6vtF4npQ9Vs1KsZR+TqFjQqH8hSbs9Ei6AUQX85W8 yvRIJF8UMg7cQFKwAdvWKDsk/8XfKjW7vYmmvKHn1KCO+kVw0bLXAy5Fj9aPyeEPFmci6k0myCKb 2qA8d/4Q7DXjYvJK4ZmUC65p8jOdFiFNEgHG0PhgjBCezhByG3SBMsNlNdBP0mWeKRfClBrQA9XG RFLC2D2K27M9qiZzM+c9dnf3TCqL5GOvnP1qOBfrnZlzGvCCOckTfgQgtk4MLH7eijJnmh4rV/6t dla1WI5IpOdw2zA2v76byKa/UV5134iNN171go5SQsRjya55F9v0zwY2g+ZINQantrE2G8rxVL9n 7uQVy17OyeFbH2txePXJyjqMzopa2Zhgxb0oBwbPH3qypfdcQC12GayXDLHOqP/fbYgoWJ3maRok xs0VHmvvKLM0iaI+am1/biUA89hTAnHfcm50XZg65tmFCjHHkhvQEkmqe7Gw+5l9mURjzLA2b4CQ MwXIDRo3WBykwUIhQgwOMJhzYA6Di4kWKVKsSBGCi4wUG2Bs4IKjC5EiKQJAiQFAyWwQsplsANMF AJE1YbKsmdOFgAY3ZfrEWXMFy57ZivIsWlPAUgBOszFdenSpzwZMrQJgCjNqA6JXmUZ1GvVrUwD3 xDoFQDTr0bFOsTbdipWo1aNWfWYF0DatgKl5u6btCrRv3ad6/34Vaa6bOW0QtTEw1ziyY8naLEKe ePkyRAYYbN4VmhSoTpoyXwL/hYmTtOnVLH2W/NkAqOmfr0eWnD075+ySuXW71NmbtE8IMWs2eGk8 N03UuV1CH17ShhocaorgsBEue7hD2W2gsBFDvPgY5pUoYWFiPfr27tEzWW8i1Hz1LGbc76B/f54O /fM4cUIeAzqxg4EHOvOFHAYCMYQzQwwBhBwRAiHhQBYaREMrC8mgkBcsNKHZRBBJBJGJko2EUUci cQSSby7AaNJHvpnk22cz/URTbK1V5ZqOPfVE1QoylZYVXgLQFKReWhlpJFR3uSMWVGgNiZaVVgZZ JZJYBjnVUWeZJRZeVUIVZF9ApvVWWGtpeRdVRqIJJFxNBnlXkDQdVicGnV0G/8FmEDFmWWPmeDYo RBAQelltSfpUpXC2zYZaTFXVBltNOvZI6WwzGddbaSAB5elvleq00qaeVjUccb5d2mqLoMIa00gu NRBDONV5d513NnwX3ngx4GCesCAosR4L7iVBihJewLeeCPGZYF8o+OHXAQsdrLNfB07kcQK3BRZo YLhfHPiFMztEqGCFFcrB7hQCEWTQQjQoxNANJ+I74ogmrgjjRDB+tmKLGOCIUks3hoojarbFRpxr QWEl1F1ryaTkW3TVyRVYcMkJ5FZ5eWxnxFiBBTJgEVN1VZpWhSXAmmoaOWRPGOMF11RnpullYXqF dthRXiIGG2EgWSTZY5QxwP9YoJshvdhie4KmclVIblnVTq2mlupqVlOKnGnN4SVxjSwS55OpoZqm G3JeW5oqqMjJeqpJt7FIo0nU3Xorr9odYgN45Pn663kmyCAfE1oQm0QM6HkhAnosiGACEzPUd9+1 M2h7wwmacwug5zuEe+AOCcrxBRAPAqFghO2+S+G79HZIgwwLsfBhEy4EioEEuu950UREa4SbjC/C WFLAxs8kEo3R8YgTjz9tqWORjQZVWpaC5ZWXV0o5qtaRWKbJF8gusyymnNlvDLJhRjGppJJntcyW mU/2JWaTOrXZsk9nuhla/z8HxkgQEdFlDDWoxUQGA5xxWqAYwBMiBcVieJH/3m5qJKmWdA1TOLIJ jZwDgU8ZTzdpS87WAGCcS1mKRqaCGwlBYzzhgMSEO3rVZ14TsA8mwTpFOIQawsEr7/hQPMH6VXkW l55QqEcJTEAPsdqjhWOtB1rGmlZ+riUDbW1uW9/KA+jygAgE7YBc5BqCgtQloQoNYSDvGkhBYFev 2tHLHLt7yL8uApHgQeAjHjEHjAZWIxr5BjXRgUnWFtW21axGSVjBXlHgcrKoRMkqpkFTXEh2mKYs UmZlWd9SkqIWxDQlMZTUGFosqSZPWnJOknRKUqYUl4vx5XufdMpZbiakp8AmjwZcGmYwE4KjDbAb k4TgUKZWs5+oRlJbIyTc/9Y2qQa0AzQBDCSrYEOk5qjGUh80oTPZ5jwWpm15nmoR1oQ3NurgwDo4 4OHe/OYrXgkuBsQiXBTRowX3HOtY6SnWevRAuGshMXP64dx/tmggLopudEMgAhkZaroJAeFdEWXd FNw4r9qxACEO2J3vTHRHjPCxI3z044xmpZxsdOQ12cQgplzIsOnxxi5t4plRVpkWidnyKUaB05vg tyT1nWlmIgPq/gADlidpz2Rhiso92uKXpKQvLOiDKsfctBYzFXNJ1CsSVVTjJDfpBVEYYMBmnDYo xlyGrIQaIGekJ9Q2teV5bQNKwF5DG5ZgaiR0k6FdYbISjiAnmi5EVXEeFf/Dw5rmH7o5VTjXthwR DuczCHvhSFBQHTXwKm/t/Bt5hGVEy5lAiVpYYhPfI7loyac+1lotC7KlOf0AyKAASugXhhBGdD2o dO1i10QnOoU2yo4hNPjQDUQqkW54lI8T+eW/HGij4rnIJjP6Y0pMQshBHrJtMbXaJCFFmMAwpbvl w8oD0VQYo950keZ1S8kwthS32KmUX/kYJtMUp/CFJUqN5ArF1jKliWXvSnZh0k3y9JabHaU2Awxm Yx4jGcY4uDGIyuNuclJf4Zh3maICVfJoVRLlsOSChv0jYW2z3U+BJlXcrOEIzbabgNnEOSwiZG44 gpoWxaCHOv5hr/w2nnf/ynM9hZNce4zIuH1C8bTRQiK1rqWtDmhOc92abegSSrovOFRCD61Q66ag RnoFdyEfqt0NOJqv5HYENyP5F25IcpKxEcw5GFwJBmOIqdcwrKZywclO+Yw9oVDNe1lJ0k2zBz/9 AfWn5zPT/rRXVKZ4ZWJuyUqXnLKC893Pe1pxn8miWlQp3e+Bmq6q+6aGpzqJxTQY8NNZBUVAcyAK wpexbs0SzLMhiaZIFNzRjAGLzbER51Ed5I028aw2ZWZKgxUcTvLs2rDjfJA50pEOBHiFK+tsFnCd lWexQKuExZWWWaaVon2arJ8r3gDKJ9jWDZywRS4O6IsGEuOBdGu6BrWL/3W+vUHsMprRD3mhuE/r qEb4leYVHS+EgMwGjFuinDvXeXoPM+xbWKkmRlqavKQMi2A6VnFYJoZm9eOfW0ZTMpipT2SbDpMl iQKm+6YyKnuxdHq1YrOX2WwoNCfSJXfqXraYxKyVYdpYzSqZEdkJJjRDOZ6wlykU7rpurKE4bWyc zVNddzfSI9VxYvPB02xtsbwGVXM6SCvmtSg3Ob5VdtruTvJse3GEQyKRD3e40i5rn/xUT7SaXC0n D3RzAfpc6BA6OnMtlIxA2IGEiLAu3wqkorKjnRX+vRAIOy25d+QIBn6Jm5Da2HgqtC5NYIxSDmYt m9vNJusHI7SmZ1XQWP9NEqGxhKel8jR+dDoSUtnrkyilT5OQ3r19Pz2VtVwJffsrb8czrchM995+ g5YTUpePpAnmEVCJMrqIFKhAc9D64xXjyTCfr+CKA4drbMsab0yosFMhx0cqng2dIWaqlsKt9DlR ztxGBXVZtYhfiUQMFAFmXdZmhUdniUd8sIAMzE6RKQHeiVt7qAcDIhGTWc5+rEO6bY7geQ637IDh zVsYmUttOcPp4NsZwcuX0Yu/YdSHdIBInVkdUQTo9VHxvMibAZJz4JWlsJg1qZR2cU3GKMUp1c8i /cXPqVfzgcxU2Ix6hRJa3JdUJB96gZf4mI98lUVdXIVXfAx7qQ9U4cn/kyAfWQiaUeGFYTSKxYmP JBGNgz0Gqz3Y0SGd8xAGXaTJaNiFXRBb62FXS+jExOmgpzhPqAThTsxVdWGNNdWZbiwM2lgTrASH 3YwE2TUAOqmBN2BWjyngeSiBDOBHFCnO4UQg49xTPqGH4fQdC4SCtWDOtaQblA2ebFXZbSlUGUEI hazLFETIGk2BDCQE7bwgDZiZvvCLA5mIixSPZIGES6jQH87Y2DAPpFSKH25JIO7G8z3JHq5JYeAM WIiakvTe/FDaqfFczFDap+Ge+biS7OGJzBAaUynVxpycxWQhVlkMkIwhPqZFpGGVTkxfarzFSGCe Wk2E0jyYHNYGQIYN/2n42YE9HamQCjdxXYiZHXB83adwk9ZwZNegxgoxFrF9mF19BiSSTQglT0kg gzptot/42EuaxxKt4rOUIrE00U26R3x4gXywYkb93X5wYLu12wfKmxeJzheQSxiVDhA4nroMgUBQ lOT5G8Bh1L0MnEcFz+9oxC+RHSAdjAUdjEpF20vtiK5hGIaFo8SIHCZRUsqURT2GSYCRzxSWjFSJ jys5IXyRxViA4SZB4SZ5ElM01SZ9kiR1YRvKXF2A1fH9BB5iIWDEiPYV3Rxi3mIEIGAonYUpZvRk mGGpXupF5P8BIvtREDJJEwflCNaIJSH9wwfVULQlh7NNm454UAhdYv8mYlZ3ZMd4wGSQzU4HiOLi GFne5R0LgAAqohYrzs5PZs5/+Me7IRQXkQsRMMgOUOfprI4uRpRE/eIbWd6H0MAMal7B4WDxcJ5J PSNtyAgi0pjEBRtp6kRN3UmmSaFT/R760GeVfJrMVEyAyd5WnUX3MJpS5YUrlVr4OJqBZUOASmGq 2ddhgIlcNomWAFrY2A8/eg9UtIYE4UYBKVDuXEbuvGfF7dQxdUn/8MzDTNzzUBNsnoZwFKIgRkf8 aR0jAqGMHWLCwOZfeVhySJtvAMsmYpZLwp14zFPhVKBo2WRNEufjpOKSRcu1ZOAV0QCUqdtQdg64 iOBRLsjipY4cON7/GeGbl1WUMFIlEzCBDOBLoVAEMsJaSbxp6KWdNMYISopESh5iwzBTCqEaKtHU EuJh/5DSxHgjy7mMXMbcx5QPfvIFXXpJycAFT9RPXpyFJ6HFWTgSysUcgrJldxVaEsIMYOgccZAS LKlnihhQATXYv2zKYdCEVxVFZkpPY1rN1aTQiAlPToBkEL7n1nFN2uBZwyhixAHWcnzQq+QG3dRI iDlji2Ci33yH36jBsPxTKLJAEigOTroHsYgbKu6ktGTgagGlgDgBlnoRQiECQpUgdZKLli3luuib GnUAQ3xnRhEj5uFL8KTZjJSUV0oi6p3NanyNaVrcosTeKrkJTvTe/8392aQx2sxp2qlh4aRp1aDd z1XhCfwsn4Q+rJXM1IXKzxpKoU9orPwQVf7055X8YxMWWIZq4/Do0qpxRgh4qDSFIyMdU1qIGnc9 ioruRHR8xIap3sCyaGqmhjIh24vOzcI43P71qIw1XG9UG3W0U7BMq3mYQSr2ZLR8m90hDhOVYnuI m07yJN1J6RUBo7pdaZbO1pYmpVK2673tlphG3hvpQUYxAQswgReoaUUgV+fVIEUwl5rxK6jMiJzh KKs4HI4M7GlqJvoNGC41CceUF2LOCX6qnPrQV8SACceAD8zY5aRdruh+xVjQ13qREmPqFMrpnBY2 yVa0ksWy5cXljP9SwIYKsakBUVgx2dxTuep3jcyf8gxAjgYKWaLCCuGJ7Rrb0GhHbtDXQFMkVtem LIfxElJJ5gaMfcbeRKuPXe0TOeDsSA4TJIHdgdvX4mS3Po4JeAESZaAJiCu6yeINfCC87UC6jmAJ Lp7poM5S7pYaRRQQ0Ku/5W3ehmdHoZlk1SnnKY9XnlQzvsRzJG3WPS75dRX1KJKbvCrIxlKgZVyX YNXMBYlPfZLFlMlWvS4JEx8+bgmYIBWjis81aokUjvCFWtKCdlorsc+VuElUEMWUbHBcDejtkdiC GYryKAmj3MR84s/UTZCQ8CyMVBdziFghyQYzNc/0WFPWASGxuhj/9brQY0Vt1AKpAUKrtJoHsTTg 1haZ4pQiaX0bKUzgcS6L5ICr+3YA2galB3bO56DrbSVl6pARmCpImOabhUyBC3rBhxSwEtDARTiQ RXCecrkAMtZpwz0wJdLaXTmxwLYfqdbMlkTu+WSSTYFSytHj7F6h+rwlWPDlg6rPVRUhx7VX6zbV nMRP882c564MgkqVIwUaxAoqW07NYYhq+6lQHinzjBSsxQmFE9payjjdNQoN2wASzxrbNzmxsVEv e46lpLgfZLUUw3GQa97E18UG9pLQwIyH27lkGhPOFSUpE3AbsZjvG2crcVbgenwra4mrlfpHQBPI uR6ICFIndT5I/23B6+MBcJliVD4dJwhYZQLfoAJHpprN2A76IWxmU/1ls/q1hoWZ48zkhJnscAc3 2vWk4yyZ7vq0JaWd3MQ2Gp1goX9uCaKlj/LxFCvbYz9ubFSZI/K1Y2iQ9E/FEtDwoc46iXBAb51G DcTQSW3MVPf0CIx+yumpEF7JBm80bozeatkgYv8ZIo+4qABer/v50TUrXI5RLZFy2xpzrRItjtfS 8919W9hSoBJNkX1Ey2oBo2tl0YAASLq2rbzZohgpHkM9iCGf0Rop8iJjFAioqe/ELB/dUZvhYHSh pIzZ5tYUrXZR0HoZE0OaISp5MKRuT/a40mZS6oPGdFNgKnvV5f+hCiYrpXL2iKpUaYwIF2EUAp/n lsxe3HZ8cSGClrIsq5zSAbNpSrG07SFNpahIn+hzy5VyOxsDb90VK+9LSe9gnZ7WnTOeRW2HoQqy jlNN3JAzyggIEKlLgsATxbO1jO9ogVsE0rfdLWlE7xP7MmCU4kcrVmnaphuB0O9Ah+CBf8EXrat1 Kt69PV4As85UYlTeHucBr9q/QMRJrJmGYzaJZTUGrWYXfzVvRM/wvu5WlZrM+R6dDKjH1aUv6zSQ xM+LN6hNHypPrzTxRRot5ZQKh8/Hvi45BrdhxOcqTeqJDx9NP/cl8aE47SkiHVP38Jk5wgmKtkSM KAyvyUbCiLj/rRobBSVTsG6x2cDNWfvGN32kBcnmirB1W7+3fci3aNFzBJrv3aHvt+mTEh1Lf/dk QMmOA8ZiFpmrYKfrFxm2LS4U46mLGR0ymX4nfy8R32oerAUuh3flIN7IBZ0GS2GNNhPsQlYFmSCh KiNh5XahW/zXyeEyyQA3batsor04jWMuYQz5yMEy0+FSbXvulLxcFOYhWezMXsQXDzMJHwIzWBks IVY1LlEMYWxFrrHe1YRQettEsG53dn10V8NmSog3EMoKt0/WjcGKXvmGYgkPM8IIE3SvGv8TP5Pv nBNLDNAzCMh7vb9xKepTPrGv+0qpuFbpDUhZuQ40YR94HtBb/wkinukwHlMydAAn8ncyyyJLdr5u BA3CiHPhhulxtnShHgox7ohzDf2E8shf7JiYEk0zGpCktqu78sjmI1DFOqPGvCtDFaKeXMnS9Ksz JsW+MKKRsMOqY8YJr8hFkEwMZlzVrp3ZWY7UWvslMaoZ4vBIY8cHG4tiO5dzNcPUqNPSWrMxh8eD Xa9x2JxW4nhgFrelh3zveSnK+2ghTtu/d36HLQjkrV5/a0Yh0W/OK0CX63MW+IAceELdFhHUFuGf oLrsFpgOhEBMuN4a5+OzwJ44UCSHhFaShJtF5no6HKcjzCQ+HWg2+Xz1jG1HNS2Hkl/Y+sat8j3C NKx/bszjJ/8Yyr5d5smzm+FyQ+GoBzfJ5OWoygyC4fLqIqhjYlgaitoFc7piRq6t8eE3sZToWde2 fzWYZxfWD6wgRX8fpl9zTG+HPRzdVBOc1c3xsLcNgAAIRIv4VmD5uv3d0Xvc1/uS4ntp7bN64LEV 3QBgA7yAEEi6FghBA8SgHYi+fNlBZMfBIV+AMCQyhAgQiVOAUJzCAiMLL0qYbATBhIU5F+YwuGBQ EoJICCNduFjpogFMDDFjwnSZbWWDbA1ougDAEwDMnT936mzwE+lRpQCIIt0poAFUAUihAph69B5T AVW5RvVq9ejUqla3Ms0q1mratGjXam2LFq5atnOZut0aNuz/1LpT3aU9K/et2mxcs2kNa7cu2J9T V4R1MdZr48FHmTYGUPgyAMtWfRb2edTmTxdDfQYlWtWn0J4xV75sgCEoT5w7aQP9HBv356FGTRut zTumaKPBYRpVrROC8NiwkeO8CcH5apsQYtgAoQS7CRYzvIhgkoRJjPDjr4OIAUKL+fLpQbBQct29 FxNMTHgJ5QXjDBYdWMjocOO/E25wIo88BiwQkQJ3yGPBBg9KaIeGvhjCmYbkkEiiC+UgYoqL5PMC Py/agw8DkkosiQEXSkKppZZesqk54o6ayafkVPssNaR0882oFZKSKiqmglzssqv0IhKwBnyMS6+t jkQysCaj/wRMSrqYRKytIcs6cqqsMGMKsyEz+8nHILUUsknMsiJSycoSe1OAwuJUqzLKLvsqyKGE rGvHG3uKTUYYW3otuJJWq40o23rbMTfQeIMJN+iG+22omXbKcabYihs0uktzSm01AGYalVAX3lMC IxlkYGG+JK6L4VT0zDvvPFdpLe9UVOGjrz4WQsmIvw46oOG/AA8kMA9kExyIQYMQ2aEgZ75wBqKF gIjoQgwpuhAj/DpSwiMvZDjRnNdEcqncQV1yMToVkRPU0R1BS7S3epdSCqow98w3SCANM0wAnwJe izKp3NorqiP/qvJghq+ksq2ImdwyMbEKxkuxqSYD4C/AwP8Sa6yqMIuTS7wCztffrkJ+jLLB7jRM ztKY6pNHoQSVyTnoWlONNKVIq5fRoJP6mceiZpONJxyJWglQ5nDSFNAcn9uJVHhLcg9V7dz7Lrz1 1Ls1BlrPixW78raeTz6tQwlWBgCNzeM/Jwa8oUAFC3TWIIOgLYiICSMCAiIgNrSoIhbo84KJ91gA QUQWMMAgxRIhKEnFdQ21CfM/fYItNEd1onFRenlsTOOvHiOTyKlOBxhisvZi+GOQI57ySrqmhLj2 hiWmk8nC+k0sT6h8pNPlhJE0U+OK3/xyzCXFdGcpq3Ya3k6Zx7x0XUJHfQ7zdY/OdEdEHe3ZtPB1 Ujo4mpD/7u3oQD3vefMZZdP55lJZs1wkBlZllVUmmEhPPOf5CK1scCvrBBAEuGoPqhLnHu2A5FcY CdYN2nYDAQnIQAUiUIKWtawqQGtv0vqCHL7wEBNiKEMV8ZDh8FMeJoBgXCTB32tCQLmY0IhGOrsU oYJjo9ckCjiP0lFSZoaUjFFGTMizk7/+xUS59MtgUtrd7qSYOysGhoqxW6JiuGixOs1pTRkTWMHs chjNAExJRyEdXtaoGMxsRjO8qUpf4igkou1JXTK530pYJKjQCRFUQ5xU0Xj0R88MkmeS2uFwbiId UdFkOY/EHI16khIMyIA+W1OCq94ztrCBoICgBCXYFOiR/1zJB4IS7M+wOrAOCwLIQHJzArLqVssv MCghAolWQfwWOBRyiENAMBwDOzIiGKqohiR5DUsslzl1lQpqnYtmISEFnOkhcWBtQt5itGkxI53x d48hGcewhBiHZZF2HntYFc2JO9dJaXjfPOPB6vI7wAzvS8Mj52neJD06uUmJYDpTUK5Clafs6WW1 wQlNaOTHRhpyXpOKjdEIGTpQKRRpg5zo/EwDOqMo8lOaMk6hKqkicpmjA+D6ztdYah7rhBJspCyb ezTCQO1oTZXFAhDdOgC3DMoyDx1kECI+qLe8TctCDKlQCitSEZB4ZHGxkkFLVqSSdbnGXdyjCdV6 CClprv9vKbshKBKpQtau8C5jEmOMGSEDFpdRLJ1ZrMrC2umxJ1wRi3ExS2LCWBaE/eufez1iyOzE O5346yljBJM/DdYbOGZmM5KpIxGHcjQX/ANnhPqZ1MrHvnl1RohFA+LSJmqjjm70okxLTWhgZLSc VG2Z3EPXiSBAA45ooWukLOBLRWmDA6qHkwpUHEfqU59fBYuVbdNpLA8U1Fo2q1nPMghC+nYQhwwB hU2liOFqaswEjqsB5mgN5VxTopr0ZDY5gRokkyYqHfHIZ/GNU1RKY6YvVQVP3uxmwWDnV2/G9Yod aydez0lgeoaRTkFak16W9JSD+u5h0tvm6biUOoR9M0z/T7pTGxFqxMJgpjS3uSjSiHbHygIyN53l 3CN7VuJBktQ4pYUU5ywlqU2JVFD0e9xISqQNDMyHlGCzgRmqUx1RnscGuX1hrOKDqqxlRILEYuVO 8+BKDNJNWQxy7g4EAi2CQIu6JARChP5WkYhsV3EjYvKJKmfVdWGuvNL5YWsVyRPiUHYpiv3KaUxG xtk9CS49YXNMovjOAbsT0Fi8a14jFgEARwljFYMiHDfGlTI+sXlkXFKC6zgnMulksazzzMkKy5ki lWaNbS1kzUTTas4yqqIYRZT5ilKcS5E2kKrhnPtABaNdW2rOlESJOczRDZKQRAm/NSAof2uGlyL5 a11L/09UzQYurZlAD/vRNoCsDEu6HauWy8rDB5sFQoRMqyAUupZEInLmingrcQlcXAJN4C7xZq+h n8JcaRd5m/QdRaxBtNedSldQJAEJvwZT4nwDZg5tmMMH2pBAxImNASP1FzFZUbCF/6vxby74CXXV nVzJAtdCK2+fUhRT8tpUaHkOqS8ajorLPuYVzBw0Mdm4h2/2aqZQTy8zn/VsZ0cs69AebeivTpRn XK3iGNs4xrsWSp1B9+bXqujYjys25EzV25f6dsjV8W0MiHxkUarHf+IZLndZZZ8O+Gc/UqbBTv/z SgxqMNxD/aAu89a3EpYQu0sV3ESIAK40vyeB7cE6Dv+XWcOaGCqHMoEaczoHKvjuBvNj+UxX5LRn c7L1nyTxgQG0QXoJaCPiqIdJgWfnOq2ADIqvLzlTFj3F3Nl+LyLv2JEuFujJsAXTVCosqYuXsZF9 DGC3+SuoIUtfVTNPXkXZaIqlRkiF1hmjppHUVpWyYqUdhzZQn/po7DedbPjaJOQ6UYpawoSvM9vZ 8B/y+39rnq7FCqrEhTJGiBV3Ye0Ug3rqQOimbhYkD27pg7gsIaqLunpp3djNIhDHI0aEVlhgZ+7t 3lbjUGQEObjvJ4DjZchq81gGTY6nSw4uv9zCK74JKnrMAF7wBbVB4kjPAHxgJgxmTTwu5dLC0Rwt 5AT/oAcB4Ad/8M+uyAgf7Z+GJPZc5r76qbG85Cr0yWV0EK2CTnVKsE3cgulAzXe46U0k63SoKUZu LX0C7lEyysXsBel0w9VqY3NQK36KDthCo8Y8pXLUjyQmx0Vmwv18y9nCDuyILJR466W6ZoBwZXFo CiMiCLmIhVhu4AZciacIMIPqJkG2zMuKqu/A7O8eEFuC6fASCPEUj0Vgq4/OS6vA5wORDqxiLKL4 hF/sCL/qaSzeiYxgpwFKDwZhUAJ4EfUMwBz2qWIYpvZyD04C464oRoocbSqIEJ2OcC22BPiaaIy8 SCysxxqHD3gsg2UqDJ+qwjK+okkK5uaE52LsKL6k/+68dm2Hzu8MqYbf0uczvA8Atq8dbax8esgN jUP8bgjHGMpFTGK2MMCSXIJGQmCU/hDs5s8PGZK3ZErNEgck+AfK+EOCKIjuvC1uNIgS72bcFiRv vmy6/OZaRqjMmora5i2B0qPe7m0mRKJq9EiPbq3X5LHVlALUkOiglM9MSAdKtGQFF+MEg5JNIE4X dzEGT+/0XjAYE2Yu7MlJtoQZldEZrWIIPaZ19Mp24mKbRk4HeydhmnCbfA9MFoyexsqIxMRNMoMN 08gLQYyggO5OsIdyGuqGtkq18DIf3YukaDK+wq+IlK7ooM5T9nFqsOolVgSZWAQgMQCU1KAhnQ0y //8Q2ipTlMjjVDaCpnrluC5yylxJp14pgyiRgxCEQbqM786NusiMIdZtCjjkOhCnPATIBhwnq2JS zlLjU+zM3+ZxiD5QdMoqX4zorKLIntTiFqOxBY8SKZuT9CLOTiKgGaOyLUIOABztYBYNLpSxOqcT i5gxnaokKoGvFjGtFkvGGL8R1LzIjcBRS37vvvKrX7JwODemsHTys3gCAlijXbQnKPhIkurHavht 6spH1iSFHblv6mjDJhIUzu5wtmqIqiaUkkBgMm0AMi+U7OZvQ3urpQ6vIzIignKKBYhFuSDRlXzq 2wikI+3mlkAyl8wN8BBi3YjgQv5GREZxNkGg3lb/4t5cwPF+1Pzy0r02hZFG6xV75DcXDnhe7puM J4l4bySck0plsBfLxRgFgAi1MgiZxDqZBDy38p/WaYqyRBrfguaoRy/CsrEES8MqzIxKEKAGJjM8 zXfCJMMAjqBSg+HKh48q508DNSDz6CZw83LMj5KO5tboETlUbJqGFHusLhtWRHuyx1I/5SUfE0M3 FTIB0UPrTzxwpYEWaP/4Qw8sUlgcccp2yoJU9BJrqQqc6wuICoT+Dt1KqEZdEzapTUdrk6ruMvLu B17apbPAamjybBar0Wf+yizfwtLcRHYMxuGakzmRshdTz3j8Ky208zqPcSrCdFu/9dD0okvDVXcI /6yKzrGLmkSf0mJjjIicCEtOZgZl0PKvNI+wYAZMzgqhQiwoStFdKHVFVmRyHkcPt2dUEHaZGso5 iG6jEtSyfAOk3HAmX0Lfyi/OZEJjY0ANMnTINJTI/tBDP7TaJtJXumUG/KP/aEC5HpHK/qMSK/ES L7FBTlMBealvcpbM2E0ilizxDIgFCCUDA/JQoG6k7IzF0PBeduNJCU4x8OVHgvJ3Nu7gysJcYpBK nXMGJSAYt1RLGW0rsBM71wI81YIZf1Cvcq/CxBSvotHQ7qJP2eTiVNDT+lQvaO5NkUSfDEYuu/Et 4xLUQoyhwqtEjq3iiO3YTsJwT0r92Gx7+KgBdv8zRkas6HRNOi6FklrkUBFWY1HxmdTFQj82EDnW D8nOdBPIOj7iOhpoI/DjyVQJWFgAQFQ1ElEUEr0NWVp0EPJgd7+gy/LGujqx3Xj2NcvDC9gD2pQA hwZF2KRDh37ozqqJiJY2z0xtz0ymi8poHDnNSYDSBapVa60V9bThHbA0dxYtCOlEOrsVMbBzGbv1 CA2MTs5CLavwv2znjf7KsIpzjGIGTdbTTuxkMj7MjTDGMqgm60ji4TDA2IwNAxYYcR8YcRv4cA33 4SJYhgylU6CDZz4nklQkKFIjvfIIAxZKq2AEL2UScrPHQjt2Mjs1ZB/y7GjlhRbHf7Zm/1gl27T/ TdtYae5CE2a/racQgQBpVssOkHe5bCQfpG88sWfLI4GgzVezZzfNj9f+zatizKvsZU2FRE1xTgnl iQVP0PXONCiMklqpVSlNr/S0ISzct0zZ902/li2mkn3V9lytEktYj0vQYk2gsi6oJ556bk31io7Q Am/r9GAGufN8hAT/hflmLic1Bese7oIv2eGIzZIt2eE42ZM5udi6gbbwrSUkqTkS1WaK9iYWNHMj 9YYetFBS+Zkc80IvNGSrI2TNLoH+p4EYiKbsI6f2x4dTdVhql1W9rRJ1N6iKqlZ1KWchYnjNbEfB xgyUYDqIllT607P0ESjuZXpFBk/25TDmU/jO/7IEbScrUgJ8qdQcTs/hevH0fEACYIMpwJViihE8 y1Zcx1aOXYdbI8xKSE6KXqcuFmyJuEJmqgTV1JXzVtDmmOihzUgy9FRk/sozsA4CNrmTM9mTNZmj M5kBZPCjQblEskomSxmFz+9SFBVBg2KEnQlQnYN5mVemgbVBYaKFL9Qhy67+7C89QIIjcFg+cjjK UJVlMTI0ve3bRtNAquASY5V3PzI1+cZvHGLdEk89StdXM3Y1qvi1yjA/ky4E03JgIIP39OviVlAq 7jcJv9ccYHCddxGUJU6eJS4Y6yIIg9AfrKJsxxZctWJs6dgZxRXRSE6d/OJgVo4sBupJ69bC/P+p dZhn5iD7SJhWK0hwY/hUNF7S2B4u4ihOpENbBjuatBngo0V56yKnJmaZ/M4vJ2ajtfLNHUfDxtph q27kHwWUajDnMf/Qt8PulqM48UZ1mDTzqUbUIjHiVIfZEZH6dutOlpbaEhlk73ZAE/vu76K5ImLF gMjOmol2OjSwSHHjxZB0ev9lM65C52qOPVEOGfVqYQQgJbK2OUE6k995fMulGfspff2hv7Fzr7lV 9m7PbMFWoP+MvwhmL/KJjGiur+5VjapHMUhHslUmT0xtsUKGTxBYgkc7nsf3AxzOB9o5pE9vkzX6 xDOZzbzntZyDqyyFts+vfET4fF4Dc7Gnxlv/wrZHBbZjYlIboB06t4T3M3R1WmTrL3VD9T2AeiJb V2tkYId7uG0yom1UFoif+3aZmgBjdXelWokZcEaHlwh+9lNtwJq/2lKRxkjVXH7U8F7w6ynwBWrh 1cI8jmoBIAOspAF8sJ7rYlqR8iiZE4In59hEmgvEiyzyGq+FkCn8gQjLtUu3NBolPdHE4ksPLTwr bPYa+6wRCuZGTnU0/X8bbLHuFGqRlTT4pSQ4esTZWCnHVwZHnOIiTgIYYNbnWv1eJLYe1jdayx9L GCDPJ4Q1hTbqsCZWeiXapXvyyEKdzdmBm7eweskQh4GqXSN6JVX2JyNuwP+au23mThKPWQBH/3N3 6WZZBKIKeAlnS6iJy2wKlk3shuy7MzeFeYhmlEMp/I1eymrCMab3uOgWKSMZ95uukMJ9X6ON6RvW K262LDn1SKIunmCvASDA/YGdApviMd5Z3ULAAfoZGc0Y+8rPvGkwnpVkCqY0GsuL4vytzGrPxGLU ikRO74THHH6dX33Eydco8XujUW+js45FsEq2fU1UVhovZRxUgJ2qdvuG7rFiUwMDMCurLDZ0f1uG hduFRiQ+tuZDrp3Ksw1VVUkGHNGVKijcbzfLKTFW135BPsip1f3voLlGhRuXTTfJ8I2HZkJ9nubG ICmQ4istPX1fLCyM2+LBh+QJgiTkrtKvHP8tJtBY4blWGxSXVDya9CBeLNKXr7vV0SYg47vVOqdS 0SVdjy19XN0J0ep39gTjn/Y297JVwuZr02R+X+e0SHiDTZrimja7cC2ZvmOw9EzcHD6Arj1bo0+C IBsKpYnjskbjJhi0UFzax30cxqcfe6RfKIYc6VdZtl95XUDp2XkaqwVoya9DcfwHXH4Z24G5P4ha Vd9/mMXdQL6NbtZ+3ARiEHhpEHKW3R+wIlgKIGzEsEHQhhIXDRAqTNigQTYI2RoydAEgYcWIDSpe zJgxYkUBDUBeFEkSwEcAIAUIMJkyY0qWJVeiDGkSwBMAEWoKgGBOm4GfQIMakKDNR09z5jD/NMBg zgUGCNp6+jBgDgJKkzdV2gTgz6Q/mVivrvxqs2tOlihXapUJlq3YsGrRxo0rVm1GAPdqmsy7V+fd vAIokgS74i5Yky5Efrwbkma2mA5NPs42U29Ep0d9Ct0MlChRH1FD9xTNFINThQtdQESI4R9rhwox AKBI26Ft2QgfRtSde2lEDNlcKPz9kKJS4QmFm06OEIQNMwSdgzAjPQYIEEywg/CiBAQLJty9sFDi xYsJJiy8hEKfnoX79/Dj32BxQwYNGTfy5+9wI09+/3kg0gSAVSCSRxU75PHFFzss+AURQzxIBBAT EmGddQSZMZAaNoCg2ocJQbCQRB4hlBFE/w1dNhtHGnG0kks0xfhiYDOa1BhdKGWV1VlnqbUWSzkl ZE5QmhH5kzahiWjOUsktxRSSSd2TFQATiHVTTjtyhVJOWF5lUk4q9fiWj2O+VWaZdLmlFVp68fXR YzVRxhZlJ3nZwAozuQXnnnrF2dGLLdI4G0jKhTCaBKBxpqgB2nxWFJRRdYMBA8cltFw2wLnA22y0 zeZpbsetyJttmiakomkrlopbasXlBtFxp4loGhPRQVfdddd1p+t22SnBBBPkeQGseEyYQOx3oYi3 zHws6CEDfB3Q4F60N9CwjrX66Qdgf1XcMMiB4H4xyA6DLEiEuRUCoe4UGMagYYYcHrSQiP8ZgXgZ QwCgaFuLLFLUmI0kwViTm2K55CWbeCGcVQNPrNSwmS8WKVSRnx2VFJMuMADik0ZZldaXZM3l1k1d +egwWTfh5PBKEawMsVxePuyWl3P5xVJGBH/MkmA430xzSI8pRmdhiv1L450GayQonYoB8FBSokm8 aFCeNRp1Uk0J55RFwlW0kIqlGvepbZjOthvZDkG0GqmaougUAMABJ+JvyiEHa4jO2dohrtdll912 IOzKQuC/olfeecSaJ5544+lhgnsy6BEfC/fdp9862fr3X395dJ7Ht4Mg6KCD535BIRFTEEGEdAW1 roaH9C6kVEUk1svR7R6xyOKgd2l0UtH/L4VUY0h5NXBWyljSNKVcYs7W09RAQUnpxSAi9+FRGAiw fFZVClClP1xexaVZXoKJE5szqzVlzQfX7P5HJpvZZ8I0sRmRVvfPv8KMveOJkpx9EkBEiEYnpDnt TqnCTFQSFRQu+IQHU/NMZpLCFBFBYCKYShtlaqMbtF1mNxy0CKqUAsIPrgZuwgGhiYzTpNjUDQOm cUF29nadvVmnO4HL4eAGByzvBE5Y4CmWsNJzLMa1Jz56iJYSaUCt/GCOP9v6VhNApyAFlctcOziX 6kynOiBM4V3uIgiH4iW7FTGkg/g6o742wjsbKU1glYnjzD4GFjDdJQKGicuVWPYlle3E/xwS4AxR hmI1o0RFRBp7zcYwEJXZrWQCZAJLylBiDUliBXwyiUBXvqQVmaUJK2o60ycjOT+/qKR+/yMJRWjm pWwA5i5wwlNh8tSRxjwmaTZiWu9q+aTRTE0bXOBMUUaDvSUtR1Nh45QyZXO2DnYKRWAjlTKRo5u5 YSyBJDRNDJejzRBZTym0Yt11YvC3HPrQb9oZnBdyyJ3C/eo84DlPe4z4nvvU0z5MtFy2NgcgzyFo XAy64oMeNIR0qQ5DAimIGtSAAxAwhCH6eqhtJEK7jejOjfVjTI0WU6PibdR4cDnL+co0SZHGhSlH 2kwgo9dIplSPSQ91QVJWKRPwoaR7av/BqQDMt6aygFJ7fVRfjuT3vlC+zEt8AcxR/WcS/4EFgTJy 2lUyCham/U4yFcFTYt4kGaBZCilIQpTUoPcTCRAFKd34EL3u5UxRkcqDHuyUcZrpwdWEDZmmctvW UrMUrW1TVk3BId8GS1gcCrZXgOsVEN9ZHiGix3DxkVa06GOf/NBgn9tCRBU2q1kFiWtBzhioFrtY IYFAR4w2wEFqmWCiSk2kIWYc20Q9Va+NiASOAmtL09LnsJogz7d6zGQfuQSSBoyVkMg9a1SM6c3X wlYiNFHJ8sqylrF4JSeYzOSPtgsz7rJPuEWVn81mxpeAySlp6fuTZFbCs5nA6YAgYar/SCjDohdd hpHmMCSRuADBoPT3SBaDoYgUIircLPNTnqLrblDkKdxo0FW/UaZv3NYq5QTHN5by64e2+aF1dqhD F8LVrgwrYnPyjYfb8dXhgugeJUhucpSj3BJvgDlt9YdbnavC5wLaoNENlIus6CJBNmSDhdogEGqI QV8bQmCrpM1r0K2ov1oEsCrfKE8nie5JkjpJLFfkSiwBM050pJOtyLRIPjkuaHoCgRjGjiMADGBc dHo+f4C5S1vZUk2+B9Sdnm+7WREqmmrSvPAetS1B+9ieHONVumwVLXR6NCptRMCUUKYwZ2NKZo77 k2B2WjOhgSEMk2M2aMJ1wajWYFyl/ylXuMGGNsYZTjYj0o7XvrC52gyBaWaKgXIS9tfAvs46BatD XoGHO0R0jwle3KzJTjY/+LHxjXV8g81+zooNuqIWRWvQDnEItThgKGtJ5GSrmCiNbJxyvW572zj6 LC0GK4kbbfSwhq2sjjETEx9bhhKeUG0oZfUJUUQjnAue2yNyUYlMrlSyJ5Dlz6zUY1ccvvCxlNRl 4TVqW7pbsITBBI4vCaCW0dfUeDukJQe7pcoPU5N/2Ug5oeF0So+kXKzdrYNnQ/CpT21qBPcGOKYi 1WVSyDXUtO00bn4hZvy6lCWF88O4sk6wp47OwfnQV8c+3OLgIy335LOJmOXcta/NoP/P9fizpAty uhS6UNUGItxKVkjsVkRl11L5Xxr1GcppkoG4RFd7IQnfmhZ+lSvdJEtjPh+etcLIQKJ5pSs1gCHn LtW0KLynemFZwwVgjatUSZNZCdmYIunnrfDx9OIbacZJjiPd6qxmfPEfTfJCJ6ZtHAB44t/t48s7 PEU6MA/R9AIH+ZP/qrQnpUHNNH0ON52XyPkeNHAIawNhA2+zr0qJYWz6eprXZL8qSPcCdXBlK+p0 aPxTL6ywAbfDx5ZHcZObT7WqRS0ocq5b3/LPtzRbhQWNS6DbViGlFQNJJkbhpgZHMG4WMVEcMSKw hRC05SmLgVFyRGgzMV1sMkn2xjD/4JV5eaaBNhEXZ4EUkNcoAQcaA7ckEKgY7CMXhjFS/PYVCtc+ W9EyIqgyhacl8UODD1NmRsVTEfczLCdAMjFLdLJeUpVbLiEYj2ZpTgMS9IVpOnGE/0JfrNENhwI9 UEJBe9UbdAV9ClZbaKNztYEbZ9M2wTF0zDFNzIF9WrNXLhWHypE1SuBt0sE64wd1r/McwLZO69cd 6tRO8EdPMkYflBV2N8Y5/ZF//Ud2//dZpaM6azdG4XaACxUDriZRFOFkGuEvt8NGeTd7WSYAfZcB YbEYOdF3kwRUPpgyd/ZnflZ6vYVnUIGCRBJIElQV8GN5YnIjLhJdlZQTwUglJtE9/2CyJsP4PdQl VH72in0GE6z4PhznPsJTMDUCe3VSjbjHEnH2IkxVJxvnckjje16DGWCVGcJkVmi1HEFHGbKxL50y hvEYhjlHG83EQpvCQmh4HNqEdNyXYccxUwNmQVujTSAQBucHAq8DHbaykNPBNzREWOs0kT6UbOVx RC82H/m0T4l4Y9vSTzrGWZvVfz62RUAQZBSCWgy1UAhYBA71ZGkUU7iTEbMEI0UzbyJhPiF4R6Zn F3aheDDIR1tRb0NJXCejFTxBfFRTFGf1DwnXWy03P00jg1yxXSXTeZrEeTO4STBjb0MleqMXghzH SqKUcO1DJggDE0+IVQFzM914cv8AQxH3c2lrOSNyaSnagF9WM0hpRhqj1jX+0kwXIYGrNI87d4+e giIO9kFp84ackkJ8pX2yUnBKh3RzOIfXoQYq8Dqa+TqH8JCc6RwqcAjmpwJTR5FYd5Eudk+SI39M dAPUUmPZ0i3VVm0Ccm3WxlloN1qSOCFFxlBHhgNFgGSBEHdMdiLqhhGf+FzAI4q+YxMZ0XcfcRO9 Y3oNE2iu2EeHB3HPiG+VRBYRcBNn5gNVs1KNskp6xoqBIiMupxY58XnECJ9Z2VtaIXjhAyYlo4NZ om9ssXqjdCZ90SeuVGXuoBeO4VFOBSdqMZfeKFVuEVWrFGl9pSQTtFzLxYWo0mr/hpk7gnmX9ch8 EEhC9ggbDgErqGYar9J9HDZg/dh9LKp0KIoQXqAGDEmapLmZo0kdh5Cj16ECexOR6IRO7zceR/Qe 0YIf9EEtNHBZTCqbNpYHA0Jt3yKSJAmJajeJqcWSahAIRZBkGOEvEHicnBimCIdbVIZyYjlSiied 85MywiWWvfUEPHI+chqC+6YXPUF8FbNKddplcqSE76aT2HUVE3eUnhczYIEyihcXdlZmnlR47NOD QPgyG9d6uScX+9M7bEFTJ2dyNsM7lCEnguGWnGIaWGih57hcf0lqhgmGkQGPhIlgi3lCyQRhpIYb MQQbucqPGfYhrIEQM+WriaSC/7k6HTZqBp35HM9BmgppmqRpA6ZpmsCWHesUiBfJdTLGRDFGWRvJ kdtCbWN3IJtVLoNwLlUgiUGmdqp1gF06nMNpAylyQZ3YLxS1O4xhZU/VI3chnU+AStIlPHbkZ10y p2IysOfzPeGZeH7GE41yVubglF4ZlfV1ZS4yVWvhcKCneIH2Zxn7SChBPl0yMnR0eW8BhC14GP/p d8PDcjPxjTJxhBb7FkxDX0QohHpBG/bFZNrEFFioaaLWJLvBfK+6QQf0fBsKTaZ2hq6WQWjYNRyG QjHKfV3IfdrXTSpamaehkMiKozTKtcbqo9ThrD46WOhEHt5BT13XdfUUY9IiLf/VYjmXtU8Dkh/4 1zmh41k+9iDnKokU0nZcuqVHALg2cG5QRjsQqG7riXJNA1LQiSUOYzAgtbHIE6eEh2d9ykfbabnk YyOl8YIS+6ftM6qWp5am10ddUSUICxP5KTOdRyaYVJViuUd9NGirR6kj+zFE8xKhNEv3cEu4txK1 924C5DNyiRiBUTCPAWtN5ySlsathmG6gSI/y6HO3MSoXdlcupGFvuL2w4qKUGTtTe0yU2RxmQJos uZlqYL5ca5qeKa3Smk5nu3VDepF6wDiSIx7M5nX4cVlOmi1zS22cBTr9Nwjlcq5f8Aqqo3YruVCB ewSB4MDIYDthGqb16jtRdcH/MlGdzwlUIjVUYVa6QGl6CQuUDpd6JOOe3Hk+FzVyH8VuajmDOxUy qJueJvwV9kaVONWopQeUJcOVayJ460NHtEuWu+cllxpyB4Mw7FmzHkURl+qvg1J5B5Qqx+Q2tJVz HpRgsAGiXIyPaKMqTKsaGYQpdsMQMfoqkxmjV/uG2teFp/FqpqG1NIqsXduZm2msYTu2Y6sdQ8Qr wjJEfwwewcI4RrSkbFsfTMqRdwClAzJF4tqI4zLAD4LAREDJRGCJDawGXKDJg/tcFWFuYnhRLdGW CaMYDcMwxGWKYSFmQll4XSK7v3V4DtMylVRJdxqCctpuRjMm0WUY6GV5dPGe/4xKMmUxqOZTp5o0 eq2bpg9zjCHMetKYPkP8P0HIjR43vFDIeytxxJEhxe6FEkyYebXViW4FNmYDq/F4xbXVKdLXfGID mLGhhvHMxha2Gm3sq5VydH1FHFXLHJmiqwQGAlJwvjRa0MjarJoJrZ+JK+4EHuyHK37oTvO7dSxg BZFDOfmUyP27OTo2djoWOpJswERwpUSgBu6KZJvMBVwQCPBqRhRcwReVjRlsEn2HR31iig0zwicB Zq84u0BlbwmbzBmLE/epIw9HZZmnsnayEh4FP2ECcTixSd5DR8c8UspIpyrRPZb3nXQ0JVWiE8zo n7ZbJgQzvB/hVC13jV7yaP8OmmV4ApeQ1rJwHRmFiWDqjGBGy8UkpEbX2xuxBjf3pSmZ8qu5erX0 0qIu1I9MW9hL+zZ2s1dk3ABhgAZqMNCVbcfm+5AgsMfrN1h+GAaAsx0Uaa2QxTiVg9H0waRLKrdN sFneIq6fM65W9AXnWq6VPNJIhoCarMkpPbjmNq+9sS82Cah80YPaOVIaqD1VPYs2cTzEtRWNung+ VSUlrNW384v1yUmKW1/AbHpYWWZfbWfJjLECsElZycPEyBW0TCbjQ6g+Ap60a2j/KV4iARiD5xKJ Ro6VJxOvBGnydrz30807A841gZ5FK4Zf2Grt7NfIRE24GhzKy8YTMdi4Or7/caM1dOMUEJ4cc+Pg bDwbJmoqyifHA03HyFq+KuCj0rpOYVBOfuiHDN3Z5SHa71fjXkAD4tG2XmeI9TF/+RGl/tHRVdDa uYl25YLAlmzSSHYEKf0OXPAOLS0RYZovd8duVyaxK6GKGZGdNqLTYhY+pTvCWBLdpetnxqjeI/WJ PjjCkxagNIPCNlXe1BmLO7zcGfueXLE+ZyGDgtaTXR2E3fldQ/w++1NKnxTFUSWBcnJLubdB/z1V WoUjdX24B95MtOpqHGRXcoNz4hsiZOwC7fCrdTO+b8wb25ui+hw3IITqqobhLvAPu7qPdFzidcyj Eflr73sdLQ7RgEORf1zj/xa549WC0YmsH3dQm90y5CE5RVXwLbStbZSMwIC72yodCCs9uL1huAv4 i+9GSzyNE9Vp01giUn1KpzU4y8dNlGBiDevtsV1iOxaMxEoDMPYKXhxMjPymF9RNFl8NSVqyPPmZ 3eJt1WohevxGcaMrMy88zfLt5mgxS0QYb1dxqblHysBbZqEKhVkV17gXGccrVYFZV5kmKo6tKiT/ q5YSHIPdQpmyKtpXa9qbfb6BGjN/L6NevXblzk2SKY8p2Zc90FJwCJ3Zo4MlrdCa4riS69pxkL0u 2tjx6xeZ4y/WtjPGTz/eH01QbUQOLqFTwKGTwKrDpdauye8QCE4O5fwCk/9VzlEuN1V6kRUZ8Mof GDNDKT7fnrE2LF12phK2HAG23Hl3F+9YcWU2nejVxXCUZF1nAVsf+2c2BZQ7NYx+P9WNCjKTZFN4 DrsFL8QmG8SCDuisVKB1oZYDBF+IXrPbuGX58y9obUAGlEvQi4/QNBwizhxqg1db8+mqwuGfXtil 3sbZJ+pak6IolGFjXKLUZD1hvCnB72oqQNknjqMdosebPf3Qiiuf6b6E5Te7PpE2HvVW0B443rZx G7f5cew3sMg30NrIPpIgTdvmMgjRvttMbu1mHwgGAK9SbrgVhXdNIxcAkQEAgAgNCg6MMPDJQAAL GwpoGAEiRIkRFTb0Z/H/ScUnEBcmlPjEX0UADUqeNFlSgEmWJ1ECWDlw5USCMDNu9EexpgCIDVwg xJiw5kgA/kTy3JkxIdIJMnPWZKjQI1KPOSHCxHoVaUeaWb1qxQozJYB7DGfKDAszW9irYrGuALAW AFy5cFU2kAvRbjYBP/sO/BkYr4vBLlxAyHY4GwbCGLL5TGzYZzvDjCs3sOzCsWHNjzln1owXc+HI j7MhNgxAcmLRgS2LZn3as2zIPjnbzgbCjBozh3qb0Q1ChXAQh4SrsDFchQrgykEQHw4izPPnXkAw CePFuhcm2r2z8ELDCwsWNMrfoHFD/Xr26qu4b/K+SpU886sMul/lFZH9/0S4BPrvHS4EfOedQGx4 CYKfGmDpLIMGamAmgx4UqiGCFnJIgIU0vPCiCDCEaimKRLIQKoYisKYphyC8i0UGUWopRpfK4okn kC68KqGmmiIKwggrXMioEBEySimseFwKpAwTsgommpbCaqkNJ6IJrCrR6moivpAaiK+4rlohwsfs ErOkvbCKUCXVeoIrzbX4agCun9YErM7WAGAMLwwGk00yFxbDTDHEXuMMtc8aC62yRBWzLLM9BTWM tT/3XIywSlMLDE9LB8NTtcQw0FQ1PAF1AQTe1FBBDeFsEO4QFVxdDtbeTIUuOeqem+66MJgAYbte vQNWO/JoMK89YttT7/8O9ZrII74mBqnvWfuq+IK/avkjQg0u1DgiEAMNNEAbG0wibEEZWVrIpJgu ukigEoH6iN2NSuRIQwGsQVGoJzpiiLCUVrxI3ZTOLYklg19aF6igbAJggnupemglzQbCVymeMmoY qxWFchiomzBuSqiKOu7YKpoyurJKKr1iOUu2JlIXS7TcmWsgu2jECyIvvawZTJPC7FKtifzK9E/U 9LTtsEIvq0w1zQ7tLNE8b4vMMcg2s7Rc10rDCzHEbINtU9OOfsxqrTfFlFBQQZDCVeCaS1W35HyT e7jmTI1uOeJw5Rs7JrALdjw9yjMvPWI7oEGG9Fi4gfH01quiCWejnXb/vi9euY+//rjg/NsBteFC 3IIBUNCnBgfKIKYMn4gwwtThvQhEDEe8iEN+IxBSp4EU5L0llwZ2MSYGWSJsdAaF74lDARLiysKQ qdyRZczMSXN5IW8kKicdiyKIqOatH0hItNjakN/ls0rZyZbZ+krol2VKM66oVHqsrbDcLFPM+HXu a6X6+y2JZ66WtIkxRjaOIdTTBgW2qU1KT5NKlE+mFqjQkMozeLKNp2DjEwzOBjUa9GA2TGMZp7Um Mi4IA6qM8yozJCduZgAOqlgYK+DUiji5eg6vrKPDvwGrPD8sFhCPNcT13OFxN5CP5KAVH/vghwj6 qdZ+AgEgNAwoENoI/4QBDDAu1ZjuJa5DCEsOQpOPNCBDD7KQRyyiEebdq41RaQAEzFEu0/mrdQRJ ybqE98UudvExooqZxiZSsa3grikC+BhJpgcqNXKPRB+pSk30hbKM3Y5KECHZySDylIh1EmLpA+X4 BACntdAELkMDAM3sopecxUktWflZWNYSp7HsDDYaNFvSHqW1zEjwaQRUTKQUxRk/4eZPmOFaYP5k tNgEpmyeMpSojimYPjkTbKYJZqNGwwS7xY05eOtNqli4KuUMR1XDmU50cigdXQWLPECEZ+GIpTj0 1NOeN7hDE5aFRCQOwln2ecUgiCDQ/XRuQDwInQFCZ4OVvMihEhKAQP9ANJB7sA5IsbMQ82oCIo0y z3s+woA5zBFSDPDOXy6Znz7UFL8YtdR4yVPJhro3opFcD0f284k5tKHTBmjvQyvLXVamBBMUbZKo QgpqWA7ppA1RUiugDCX7Tok+wGjFlfajWV7G5wKdfamq/7MZneYUQLApijGP8qXaiGkbyjyqUl5j Ztf6NLasYSZUjOkgB1NDKWVKs4TVdJqoHjWqB0JGQZoqVBhs0EJxqvBtr1oOY1UVTls5hzp/8xsT wOMFJYznh1Z45w/jSThiGe6ekPsnEpk4H/xgbj/9qSIXqiggLWpDXK3hYEsmGiPWScWMCDmLQjTK LwzNa7enGalI5Yj/AQZoZo6jKd7xfAdJt7gFeQ1qSUzIeKOl8mtHmyRJSZirDR/slKvWCF/GoIQ7 nHAvekiRiPiogsjuUVVlK0uZytjXPi2lBWJZ+Uk27pEXk5BSJn+JyVThxxe/1KU2roFuHX/Jy3I9 CmsDFOaiGiUpSuXygtSszWICKzZOgcqa2BxxCMvVp0b90guTfQ5wYIWct63QOThU53W6kx3ubHY8 oPWhd6ygHfMMToj0ZBzj1JOefN5An5H7pz+n9UT+CHRACrWtNgxwRQPg4KQx2qNBHCIyhsh0dvvi UEbjpTGGKIgBITUHBJiLgZAuNwSl+7KaNFpmJ51lJutKU6BlkqET/8kESTw5ZIVKUhmRkte26orA UqyB6PHdaCJF2rMADqlphd1IRDwJ0iYnMtRQusxKXgWLm9JSpjZRhatvmUuZuMqzWJNVgBMeJmVs s2HDUAaCFKyg0vj0NQGKeJqTGvGJ73RM08iVNF9jJrGJ7VZL7ZKAZ0VhDL2JHG7vLcfUiQ52dKXD XvWqh90JHJHHIx7CCRE9xDLiHVigrMc1QVmqjdy0mjDQV+ynCvzhApa5wIPaanFcp8kzHiNiktRJ 1IwqtRBHPaSRhsxr0ctNLsZDyoDkhlRpeJZuQ0zCPI5UxNM8EZhb7jjyjRKlYxLBV1Fk6iM56rS8 EpDAThnycpB1z/+7GbvKUeqrIZQF/SoYy5767MUyKOG3fVkppVeAxhM42QwvX0rJmboKNKunhatz WoulDCVBhEv4abexdgNpExk+7dKPy94gCDeI4qLRvdnYrDsy+8rMFUdtUYQpzm6Y800ZgqCy0Lkh r3al43VKxzq38huwhiy4H5NHD4Urj+ISR8RkoVZy+WYi5gZxOWxtWctaTqhCx/UiNQlEIAcpX8TZ NeqMVhwmZ4xjAzoe5zjXmffd2Picm2s63+Wo9pH+yIc6NHOUqqktMsXdhVBGSR8xuhs7ta0EyrtT COQkZPUVCiJler5RG6noRwHvTszi9PliqdT89dIouwLrUl6FL2T/ahOZqK4VOXWFjidUkAZyIMY4 mrYqDbJxKwX5CQ/rK6tJjMTwlKyJQLmju07hO6epQAN6sGSzjX8wjKPBmgNSASkwAylQg1NhDt/Q mxrKm1uhjumAQXbCFS/IjnLjDnTzIXYLj/K4vNLywXq6N/hoFmhpIvt4In8DuHAJuHCpLS6IgU1h OLKwkN8qiXRxiBUxrtghM5DquDd7s4wbqW4YqRCYszkiw+dCq5KAvRvZl+0RCZFoujuCKLcwHzUi kZAACeFpDJHSKS0ygJzDOdsyh4GIno14GPPJCB5pmCeRJP2KijwkiKmgCKdiv/2qkvgTpZ6RCykM k6rzH7AIK6Dp/0SG6MRbkgy+oiCTCqazawyE65MQAzEHJLa4KxppujtnUrYPGyFpMrHIeLuyGRsI jBrPiKvXSBUTLEE1MEHCY47kgJtysixwu5UYnMFd4Y5gmTwWAC3QeqfNM60lw6f4wLc8kLIiFKh/ 6w8tCxd11KL/WL2B0RAxQp2OopcrlCTZKwk54riR+sJ9DL6MK0N+ZC4XaK7hiy52kT72Wp6Qkbjz EYu2qB6iAjramx9yySkMyDLt0wZANICb4z7uoS+GOZ/1OhKf4x6iiD7uSi+joq9T069PWh9Y64r9 mTW04IuoE7A3GTCziDpXqhNlAg1ru5S3ekWqoRoT0ys/8qtazP87YVxKCxSsW7SmZUIxE9s7XSS7 OjI2YRoVEIABZVRGExRLVEEVM4Csc4KVGTsO51ABHKJBGuShv5k8Ias8K/DB0gLCI8oDfsq3+ZCW aXmFLxg9/gAdPzw9heKCJFgQNTwJDPmtx5SdlZiX4YIQMiRDzCgpfuxCfuS+5BopO/O44duT4Xm+ NyQ5N8oYFdEoPUoTemyqNYKlRdO98Wo0H+hDQNxIH8g5ndMQiXieRxoJ+oo++8EeqSiKU2ueSLzH qYA/U+uZsLqk54yJUiqwv4CfBbOuv2A2XxK7CvvAUyyMCqsmYhMbv7K7q8sUCDQNUXHKpmzKFDMh yGA2q+QTvfP/I6RcDQUkDBVAg6/8SmQEUMFDwbKErFhZDmh8QXbKFRoEgTXoIR+aPCADotPqPCiT HGdZLcvBHGzZj8NkQoUKhCLgooFxCDSKF9m5x30BAIFgEJLCgDMUqS9MLhkVwz0RSC8kSBfoveaK s3KBkBtpue2JgPcKKk/rEJ3YEOXDKZRwLjhztO3TzY0Ml90MxDiTudsrutoRmZHoCPGxtNvrs6ZT H5Dkr5eUmVODNQjpKvkTEy6BiACTHy9xpfXErdgIwNsgDMq4lArCKxILRr8ysadMT1N8StOowFxc QBA6saKZO9RopmQTMQ00DRBAAymo1EoVy93IVCkYwcYavMni/za9saxcwY7p0KHseNBslKcjOiJk eTLVGsJmMUcoEqg/PL2c45wjOILVUx3JFLmO+C0UnZ2C8QneoR6O8z2SMoc3q9E3qznQDIHDmCM5 o56SytHhEbmaUE2LeB58cSOSozhwzZjx+aLGqDnbsk1BxE0f+EMtkoBwYVfzGrqguJjwCS9+Cc7j RCSaaIrj1NdJU04mgcmBbR+7mCo/U7D+srpSChOY8apNrDsF3Iw62iU6skqzcaZZDDtBLVT2RE9F LdT6FMb23MW9ujurVI1e1CtgNCxiJEZQ2Y3+VIP/rFSwLEHfUEbf4FQCNUvdKFDhCIPooMYwqEG4 9IJsHJwfJP+cdTCtVui8C1WtDO3Ly8mcDt1ImwPRIjiQCFkId0kIiZK9iVKp4dmTF60zZWUucwA+ jpPRL4QzORtIgOzRM2yuYoqKMYPDvE3N5emIQuRSLh2SkVRTgynWRsM+R9PIxL1Vw4RXbdiT5aGK N7xHo9jXjZLIpeAkUJPI/3IqpStYS5Q6J3mTrxIan+wqtYgTVEpKYjoaRamUStE7trugu5u7j13P APtYpmRPj21PQOrdRYXPZToxs6mmPoEmX4wUq1QBGEADM2hemZUCGEhGKSBBGNpZszTLwevZZ0Q8 dhI3wAkWYmm3Vb1L02IyfGoWcfy8v8yPDR2EdE1XzuEWHUD/EHlkHUOMOMk8iNyzUd2TI4L0vZpL W2X9Xy8sqWRtrv91s5DCDMsczQa4BxY1TuPyhwmINKP4LnzBw97ktOhRkYfwkS5SVuyL0t00AJ3C Te3zw3flyJF6iI7Bih6JkqKAko9pxM71inyFrzL13EvUC6h7yD7zrwQzibKIuk7si7AznWpqAF/r Gotlu0AVO9rd2Lvj3SvG3TfJXd61O1sMGwpUWWziFAlcJg0S3g/D2D+h1P6UWf8ESxK02WVcRrIs UANVjqCVwaKVPG0ED/EQMj4eoiMKwvSNWtCLHCkLqETOMtsyAF0tAvnNAOXrLYd4nTQbHgbxF2sV SOUKqbUl/ykDLkP/zVGzvcze69EvVJBoLR49qz0LRj6CQL6RiLR8+ZBI02DkOx9OWrlyURCdYgDy AsSbK6+bs1XcrK131SIfAL4D+76jYBKo+D7a04mLsREjObAY3lz0wcSYPLVTkotZ27qwAiuGaA1n eo1esowHnBrCGlQrhtN3FpV4npMsjgsqvrqRxeKmnDtcLIwJpMrBkKtIWdlETd4uMgM3hgGEnlll LEFNbegRNEtONUsZEtUWBF9g8WPvQLch82O8bFX1yANlwdD1XV/8yA90JIKd+mUf4IIj4BZtwQGG cBfZSYhLVkA3y9FlzcyA3Gnew7gCNts5SuBpHakcLWBpLf9bbDWJ2Yk5h9mIfLllWt4RWmYv3PFW Q7wK4sFMjtupnCuvPtQpErZVW9XNsc6+E94Te9UYa64I8GrJIhkSmWnrGmHJHn66qfLmK/kSmDGl seAfRmXZVhSNzZANPGs2plzPKv7Yq8PiuLhn2Khi89zY7ZzsuQLe4Y3KleUTvlsMYsTAXcsG/mRe /3xeEmzesZRosGSOnT3Q1hZV6QAcHNQOdHPQ7lgDImvVvQTpG3gF3ubLCzXkcgRMgtIpnZLfIiiC I+CCcfkI1hGeOFKaRynlXqbWOtNROUPl3rtus6XWBeZR7AbgM7TWBCYM6nmJR/wQWZ7qWcaXSRtS WHZvfOn/CPbmtBIl1vIubkHUsmHeby3jSHfdSGDeSGTuyJHKI5Ikiknr151gxKwAiekTSTCFKvYB E6lCXaTwkoRlsFEiFy8+NrYTaB/NYkIdXcf+oxMvMBN3bA4PuzcNGsW+XQucbFscVAocYw+nO6TJ cXU+XqqEgINu4+b9T4ZmaNSeXnFibRlilbb8lV4h2ieH8l9JjzzIA0TIgy+wcvrQciTay/fAJ/gA biYahDsoQkX+5Q8IURxQczXAgRggVoORo2J1gWgl78scyDhfrjdzYDLkbqMmagb+TGkV9DjnPaSO sB+tOKNAvidw5faONE3bCAt2ZQt+alrm4BoZi8YoKRKm/1IBT2EBL2YpNcwsc2F9tRin0IlEQgpM 456Je0n8uhK8Xh8rWaWoWAuakYl5liZkkiARJizHgLYPM88OvyVRsc4xyZmfWAFl/5l7ZrYAy+IA E6G7M9SwOVS7O7GqfMBFnaZ+jhrIoFRLHW3ndV7Tjt6wbOgSTBXrHbwDBVrYBpxciUHtuIH6+IIv GAIi0Pcv2AH72Mv62EtlabJ9Wl/Qw1DWyhyb2xYbYHgUiAMbEAE60tEXPQyKx2lRFuUEtm7qGUPG +O6My9GC3PgAFHlTHm86Mhjb6ZAJeAL3bnn2HlLfTMi+ZXSCkHRNS6rh2UOuRmHcNIeOzM0AJ3B3 PeZ2Bf96nmK5lDSSRFOqMT2wLKHrLMUvTHQZTUxTCIELmoGIslgTXacm1/grTDkx0tlYj1Vx3N0L /RmlL/k6+aHnV4PTGK/A3w278xzZ2r3FEQNoQBmhZpomYwNyhGZecl9o6X3jIhen7O3Z4cCsXEGn XWGBDqiCHaiWLwACIrh8OcD3e+d3RJiP9SgtwrnQ0b9Qf1KiZ7G3MR+EXz4CHHB4FEiC2DcBE5gz MoQAMhT0On8Uk5LzaF1gpSnIj6vW5JqeBi7DMwx5P/cJg/QdkhuJW9ZgR4+0hon0p3YYh4H0qu5N icApss1vm/NqdEVhoQf1KS0vAHe0Ui809QtJ7LdXumb/8Cbp3CaJ9eYMXVNy07hPib0DaK1BJmgD CAwAXDQYaNAFgGwFFWYzmE1Ag4YAVhRE2PBiRQEWKT60qHGixYQRGyJ0QfJkxJQMS2ZjCaHlwJUx I5qMKLCmTJwuMLS0ebCmC4Qq0EhBA8OoGhhqpCiF4TTpUilSzExdasaMCjUqVIBQwSQMCLBgzYRh wiLPFyJf0n6RA8RZ2x1AvgxxRoRIniYdaNDwwpdvkxs3+LZq0qTVjcKGDd9pcufOoDtVXg3SxkUN iiRKlJjYzBmDuQagMbhg4ALC6dIEUTdoQJCgadGiQ6SOrdq0aQgYQqBmsBs06tDmdDcYnrr3Ttut WwMo//gkgrUIz6FHmCDdegTq0aX7iwBAuoDs2J+Ep079CQCIzQfKxlBcmzn48iVoo2/AgIT79evj 97E/P3/0xWeOe+kBAEB3CJInAHn+pJegd/6gN8GBDnr3XXoCZKghhwYKwGGHIR64gocjNqBhQiEi RJNKrg30D08qlUQQQy1e1BxJBw4kwI0KkZjNQwY1QOKPCYlEogs8RrQjkCOJBKSRFlkEpEk1NikT TDj5pGWWCbmUpZVAZUMaAKS15IIZaBi15lFHMYVGmlLBYMZSS6mA1VZ5hrXnVmaAwMQNVaQll1xv DbEWEIcCkahaN7BghReRWvEXpZW2AlgrijXWRBWOVf8B2R3a6IBDDJ55loQMxkEQwm+0QRDaaa61 RtBytBbnGgSyvooaq6eZo5pqr9aGgW+zYYCasLmFBppsKx74hITSmffEExM8Z81z1lU7nbXWTcAg hdZtJ8C300XAYUEHynqsOQNqA59999HnQ3700RdgfT7gp41/7ZJpoHcd+gMihiE6qOG5B6IIIsMI htjhChw21GGQBAeZnkU20hjRS69l0zF7VqqEY0EcTbTkgQwZeSNCPDZnsskwZcPRPVdG6eVBQDbU jsgtXVQlTTPldJDQPo2Jc1AxJR1UliaZBAEAKhR1VJpUt7kUnEpJNZUUWklxyFYg7NlV2CxUsQNb czn/A4RcXwBBRF1EvP1FHpFKSsOkXkz6196VJva3Yow1MQinlPlwhA0omOqZCaT1ymqzuco6K+W0 xrpbsAS5p2ptqQ2HnGvDEVjcb6STzttrzJ2I3nXXnrfteRRKd21421VXXrfhhVuwuuqtq1u7Aw5o wH/+4defNvpJILw2xK1H7oEUfuid7BZKuOGHOkZw8MACHKzhwCU+LH7FI6Yn0YkpEb2xQly2WBLR EqmcpEQGKfmjyxgVmaQLRfaY8pJsxpCTJARKOQsgy+b3swJCqUpVeknQWEKTAR7NIjeZoGuclo2q sYlNSXFKnJRCJ6zgSWxdYUKfuNIBthBBDm1Ji6Lg/8K2RH3hBl5gAhP0BilJQWqHVrDCo/BGGL7c wAo3OAwSCdcYUN3hHR+wQQy0wITFmSA0rOFVaSinxYLUSoupcY2yZnOboORmJ8IhVufKqKzfuABy BFkPeqoFgGpJq1uug850JKQtbW0vj+aynT9k96EOqas5q3EPsTAAH+aZwwDxkYCAFgkfDLhHIQrL XvccBC3wzXFhCKLed8L3HRF1L0MZqlj5eCQidKVnSCZ60vs41j6FXPBjKlsS/CwpEf6lrJU3MtLK UjQxhHDkIxzByP8GCEufxURpSvsZSqh0EJ6pJCddsmBPYBIjn2mOIS+BgBmO0sE2rckoXbsK1/QU Bv+u3EkKXsmDWtYiB7QhSi5qSdTb6haGNejNC/y0m9166Be9CZEveigi4BZzmMYoETJcOAIOklAq KTJuc6jJXGsk90YuclRWkCtOrggyHODshFUmbdWxxghS1RgnNiS9leq+Qx5tRSc6M53Odmw6u+5A S1rPuWl3pkWu8CyIkOlKHa0QSUlKEohAoxmp6hgGvfCkJ2Ch7JD0LuQg7RnIlNkj2PhWab6JnM9l JCNJSkoiI4NU0kZEM4hIXIayICUJmD5i0pN2ZJL8BTNHyAwJloJpkmYOVkpPWqDMKLhNjTmEJdn8 Ek544jQOktNNRKHKUuakBjypwAZkk5qfzkKEHcD/ZbRraeEXZLgDF1ZBbDmMVBjsFlt+/lNSOnxU EAmjh0vRAImBW2IVPmWAIiQuBprRwmaSUMUvSm45k2vOcqA7OfcYy1isaWPpfIUrWJk0OSUlDbLG +KpmMedZe8wOdayFx+pk644/lZYevZMdc01HANH5UH0HqaP9FrI193AudNdTV4WN8kPWm+NWKYSh c5USQt77qlcfBlYPgahirFSPgIWUMSsJpJY2wiUAG0IRYBJprqpEiDvIij/A2hXEfo3S/wb71wEG UCAyc2zQFOjikegMaD6bYJm89GMwOc01/whnOck5NXOiEytd+SxVQECDHYw2nlXoQB6yjBa6DIEI /1XwgldgG9sxf8WfZvanDx9F0En1DW9NoIEoFMpQxwzuMhFd3GZM0FwurqfP6eqvdENzq83NilVl XOnmEAlV43QXNy4wDudYk5IGyPcJNo2OtmBnrW1tq3atk9Z12MvTcFXnXN8idcAGiaITqXrCrW71 uaxB1Ag/qKoVQg/0CJxqWScofA2utcSC7aGJ0fUj8IMr+yCo1p4tCcRGKlkvL+Iy+gnzRPLrqyuh lMzDBhCX0y7gypxUWAJeqdxjusiNcXaThECQm0KWmWQHchMwYYCy4+zaVK7Czjy1kys3QFtpO8CC rsSWBnmgspe9EBYvhKHhTFhDwyM+ZhAwHKD97P9hEPfG28PQIDFIFMUSB3cHLoQDBVFcXKks+VUN kWeO58oARHxHOWTNxlhuRA6yWPWqMibrOLAab3bHmzo4AuC81Iqd6+TYXvb2Ub0Jms5zyJWdoqN3 qC7HzrmyQ9WEnes53dOvfPG7PQw5yDqhXDD4Epa9s0vvezpqmKrTQyLviU9FODrQhl1Uk/XhnWgj a7b8rI0xX/bSfxBZsV0/cqMlwQyBN9O2yq4JbsPCu5k2XncFcSazmPjsSiOBn2Sj+bRzI8QMNVBT B4siFX2DLWxZoQqgdkDlGg68nVjxwg2yPPDYolAFZQmLWP5UltiCgJ+zNTPGe8iXSe2WBrv1eGH/ NqXEQRxBDTaIw3GVINFw4IDSs/s+66hFHun013KucZXmVor+7mIOOblJtM5L19JHo6Z00Z3jd2za rdbRUdPUspZMkZ963Y61BNW2fEt66Y73kJ8AQg93RAh4EGB3WEN3HAwoJQyE1BquRY/DIMwlrVyq UZgIghWKYATeQYQlrUiN8N2yfVhexZWIrYzLFIld4QhfbZv+xBhZ6RK6BVBfMVA1DdBLKJMDad7n 0RiV+FU1zZs0sYQEJaFNpIkRoMEUUk2+6YmftNNS4N5afAENgADXpJMKDBRXfAUIkIVYbIVYRBzw lVlsVVxA3RabDVFv0UAr6IFhaAqdDcIHcJ/J/8UAIKKAGjzUHMXRcxTiIRpiK0nXcdycFWlX0KkG G5kGSkHOr7xKSv1Gb8jKawTYH0kLtsBOKG5aH5UatpSa6zDIfG3PuYBL15UaenXH9MjiUNmX1p2d fNla1MkaguWihGiSgV0Vy/Xa2XkgsD1YB3YgipAIWakHRyzEh4mMkNwdQsDVsw3Th1TjtemIRKjS jRTJR5DYQgTT4/VVjgDWSORYNXEb5NmSAgmZQwghAfEE5+VYu0nTubkGkWVDUaTeVZBQ60nNOXHh DuQBE+Abvv1jWWwFDvUJCn3WOq0TV6zhV6xB8TGcQPGTQAHRHNJhpuRhyEWGD1wGCiQOCuBAEf/4 AARoA1Ex4E+JH/k9QQPI5HrUCmsMBxgdB+Y42kmpH0k5Gq/sJEsFxxW5iHNYg3rVVHbo31J+mqXV EbXIGnYopU95y3eIS+2UBypmJQI6oOywYk9t0iYFDOsUjH5RFa7p14IpzMC4HYSt3Nvxl0NUhEjA lfoIiY5ZkkPgZd/hD4nUzPk8RAzu0g0aCZLkz/3klWDmVV1RW+TtZWI1ExFaCRISll+h2zsOFk8k oc60WztIiTtKVgOYgRG0yZxgxSF8VlRMhRc4AdrcgAo4xdbMpp6g0FT0HmfxG8GBhVdEXMWN2Zld HEcWlBVcCmL0VuC0QmQ4hjZ8QBHggDfgAEr/GgAERAADaMdLRp3SHWLMddGgCUtQnhGrEEivOBpQ XiIZ+ZxoLEuvSNqKlJctPgEbiMfSnSLs4BR1UB0oxqIcWYcqqpfUkUsiBtXAVE/1uByCcp0myZcm VeAo9WIy/mKEaMi3gB0JqiUhpcix0SWHWglegli3BZ6RGJP5oCA5ApNh9lINCtMPSltIENPK9KC2 oSPLGAk9ElARltu41WPmnRsSelNDMCGY8JjTxERRTOE55QkJScVmncUOVAENDAVTQAUMrB5W4BBV eAVowcGddKmSRqTvOVzDQVzF/ZNGXtya/cUdFsZuNUGcHUYrQMZK+kARqEERHIF/sAEbaIN0/+QU ex3dU8ZR7zBiSFWXJo6Ro5nOb8wfJaIfGplnUMjGrKxHBsyX7FxaqJ2HUmKdn24H7KBXT0GH7oTa UCFgBPJUeYyfhXzShHzH2OUiyxUjigSM9ADM2TmMgfgaisglMh1V/IyMChpSXZJMXQKe4KnSgaSY KzHjDs5gioTbYf7PjgATi90VSchVj/igtklmLrFEmfiVjW2YPA5QLo3EEBIpMyHEZjLEvNlESyDZ VGzFIWBF1yiFChhcFThKvTIFv1bpZmGpVPgeOm2FO/FbnvBmw+1JwhYfcMYWpJypEM1h89khxSLR YtxBAzDAQx3BEXAB1LCBOjCAp76kuExLHP/pQ39t0U0G5Xj6iq+gFHuSRhi1iiSOZ8bSiiUtB+vY 1HxuR1I2JSpSCxv4aXuRIlVGnX9Gx1W66tRhB/SEi/fsYtd1D7SUZfW04ihVj301DLTEJfWs3a7u 6rP12QpmmPqoILAu092N2NwN04EApjey6IreCLJeG8z0Vf5oa7htq4wx1mVqXo2m2wCFawGlYwOV W+FGHpA5YZPwTE20Q5zoGzqp3r0Kxg0wQVIYhVMQBZM1HAj1iTu5U5aGrpcabERGXJldZBg8rG39 EKQQp24l1GFExiA8AQOIChf4h3yCbHVuKqdN5XnMUfpI1xa5h+f0BnAk73gSJaIOZRqlRur/TOqf vRd+PqV5YKq1hAcbtJdNUZ3tYFq1KGCpFd3TZmV2JIgghcf0uKqsUSiCYEirSg/dbUgFLshaZmhX gdiKHOaKaEhJKElDAN565KwuqcsunU8v1QxfoWiRtC0CL/D/uBJfOabeZgwNVisO3syLcl65HWE8 Aq7hIqFjCU02/EOOPtMEuQBobUWdVKmUZVkHgAAM1IBTKJlTUBxm0evqpZPowoEZcKnB+h7BKeyY UtxsvWHr6lBBGWfFWsFifOQTvMoH+EcOgKw6hKy5qNf/uY7ZUQuCdqdzeRSuqKf8oZRvoGd5do7Q jVdsyArxpodSnmJOPcf2Zur/eQfs2OIA/1IlValXufin05pqtNQiphWdIX8L+coOhH4d+R7iq+qI rhIYf3FRAOvIiI2js6Xg3QmwD/JlOD5EQWAYxmhI25pVCZJjNw4mi/5SkFybiEVEYQJJ3mbmk0wJ PDZJkFVe5AHpuJor4rrjSIReMKcr6WVDV2CWbIaBDOSeDMTm6VVWDVOcOd0JVXANVfgw6Ras6Abx 6Trcwu3TGz7sRvbFHAJR8znxxxlG7UIAA7yDNmQAyOopG+RAyT6lTkXH9v6UTAFABgTY5GTUaohU eIkOGkHaJhrHzSIHdq3UdXGUXlKauURAHdcx0tlzqP3sfGEa7oSqrW1PVjqgqIJSqVLoLP9e1QUe SKW1JScZY6qhh1z2HbVZ25CkCwETqzYCkJLkdE0/GzNSBI9EzMwwCSmbz/8wo7MuJrVqyLVl25GU 47UqYQ4qJrnN5WVeppN43raSG7px3hDiKIyNTLy9BgaEAdbc8DLbUD9WoeZSDVgwWTXvcBj+cLyG LpcCMb9FJPBJ3G+SKfL1kOsKEW9dShM4sWIUxjybAwMwQDzLMwQwSM+iVz2nV/fGEUT8V+XUCgOQ V0qZhs7VLHi5bE42ALIsy/lRV0wxRxzlp9F+ms/y3x3jkX/SkdJ6x3b4w321HCJvkvt+SPtelSHj cawhzMBU7cGgHflKsift17HpCDQydwH/w/KSoCCfjZgz0vThQVs4mlXF9HTKKLXCLOYvJV4M+s8P PqtEkPeLbRuL0ejKTMnIRGYuyaiM2ZK3uveNncQQOpDPSJZAIJkZMEHH2ZA4zTCbICkTVE0YzubW VHM19xueYIUPq6GET2TDMRw4l2lwJh+bFaebObERFUZhSAcDQIB8qoM8s0Gl+tT2hqJE/9QAil9N Eq930gpPyqzzJioidVdQygZCd2JUPUsA+uke3XGgbpod0RH1VMdVPm16lKVLe1JZNnmJSDJbXlJc XvlLd9WuZsSJKMxM35VMd2P/bnIA/whNJ15dlQ+B+fTFnHeJunn9EAmLane04ZX+CFbe/6K3K2Ew 5cXoVdtSAfUtBdUyuO3y5CFWkGq1Q7RbBpGGCkuBF7DADXQAE8CAEKBBDVy6pVs6GoAFDJQmOlWp bM7JnOwwaEkBHGQzv9m1GuK1bwInmVoBbemQ8s3hmhYGOscZtZC4iZ84G1hCU4Ziz7qOHOvzc8Bc +kDE5KwGrIh2zB6HSnF2rEDi+cmG0EUXn6WLsJuskRP5z3odF7sck7dcT/EOkGc5csel2GJ5V7U7 uhvwrgZw/TB3XUp3iqAM4TWHUndnOC7iyXSEMO27YO57L8XyfrmyeXu3y3xELMey3gbuwwuN2naJ ZIZJjdpY0UTeE+YlaAIJaZiJC7SDF/8s88AZwelhulE8c6cPBQjJyVPMSdbM5ltjs9SkOsFGuAoA sUTmtcSFQTT85pmtQa3r0B3aoYfDqWPks6+PgZ7CM33OzrVMNFS6NHqkTxhf/XUhx0mlMWtQl2qI dhuF1xgXak0KQKWyTktCRx3fZ7f3nxaDau1cD4bMPf5N8sJ0+bvnfZ/peyHpu/qc7SImCReRyIkI PjPK9KrtKi8R/uErfJDgz8Q0jNyWoMArvIrNObEhcOAZ3lIzI2Hi+VObYzVpK2A9puAW+rceeo+g 20t8dRIW+jZdlFqBBpSqwKWfXg1M4aVP4Z0YhRHUq2nWMKlPRalbs6mTLp5EOKurocL/fkWZGZ/e /NMPrVkQtcKkfCRht4KvswHT6+kYALvQ1pS1zKd8Hh2Lu1w/R0Cyv+esXJeyBAt62oaOk/YXGe+1 n4ZCDK9L0/a17OLvbjFAPJnwJIK1CAKeEPSn0CCACA4BAHgSkWJFAQ0AXASAUWODixhBbhQJ8mLH jBgBZOPoQkDKli5TnoxJMZvMiDVFrkCZTYALlz5flqS4AoDOmRE1ZrwpoCZPnhGJOm359GbMpjSt zqw5lenUqlej9owZtcFVlVd96szWtKbPtSnLWnXrom1duNl85m0LgC5fv3TLul1btqlbvtkg4D3s wgUGvI0lSMDgRQiaypfR1EADQ4UZ/zRGYHiGAWPzaBhqQpc2M1qKGSmvW0tREdsMnNpSbMNRsVu3 ijUqwgAPM3zNcONWwqzxsly5FedWaEC30ooGDVFWmjRp1YSNOjZj2IQHDz5DhIQE2Zhn88SgQPbp 2ZuXCCDDxnsN8DdwkR8/hhAQGjAHAgwCJFDA/Q4E0AUG9oPAhRAMBFDABgzUDz+RNhIgg4meEMC8 CAaKQESBHGqvIPMmQDGChSYyr6WHJlIqogyS8sijDHHM0COVWtrRxpfa6ompBoi6EScdS/pxKxt1 AjLJloii6EaZWmJpJpZQyqgklYhaocqWXooSSqRwekoql3Biqiio2DRTq5hYqonIrP9qiorOO9mC y869DNMrq76awsAqs/rM06yyCANA0KYSY6ssDBoDDANztIE0G9Iq00xTNMLwrAYYXhutNNJWM201 1EKTIlXXXGsNDtlg7Ww33HjbTbgwQDAOBC/C8AI55qxozgpfnYuOBj2oo2E77Fr5rrvxwvvOkifS M8ha9QZiwyAVOXSogQgu5E8/BxuAcD8C/UvXQQYddBDCcc2hMAQKx33QhXYtBAkjguabQKKEUrSW oBTdAxHGgfhdscX5IooxqYjuoajGiGyMiaOLoSIpS4zlPImqIyXGaCukKo6S4pO4iksskpFSyp2x MuIJJQHArHOprXDmCqYj93zzzSj/7ey5TpGruqsoIuPay6i3FDsrJUMLO+wuwR49LOlCA7Oaab8G W0svxxjbDy8JtDGHMZVg0EyISywzwgxP0Xhts1FJMw2N1VQLDVTYYJvNNTxcmw0OOPCw1dbedjOO CeOG8yIaXpXzgolhKS82ulawm0478TiHtryC0ltvPYTViy+h+eqrT19x622AwRAStHdc/M4tl8B7 LTyQXnL3w0+ljOqbr0V/zdsWxITaQ9ggfwVYaD6EJK7oCY+m76jGJKUUysobZx55SqXAbBnHMMfn PkqcfDwfrpcs4rGrq8QnU4CewydqzDXZxD+sNM1UU031ywQkvqgJZkGymVkGaBao/8HpLoRJFNMg +EC2nGUtEPwHBLXWNbQ8xlL6oZQD6FIX0lxCCDAQghlUkJlR0Y2FptGbC1djhjSwim+Ca81scFgb FfQGDsFhQuKI06vk7Ao5wRoWsYolnepgRxStaAV4nAWtMYzBEqIzD0Hco62Cheh0BGnAE+7TgDBa CHf3ule8CASBeK1LP+96XYXamMZ4hQBB41IJf8DFLwD4q2AnsgbARNSQFH0IRi+KyEMe0rCIVYSR E1mkRoRCJUaGLCjhs0lQtMQyS7KPZJukyCNvEjGj0CxkKDsaUV4Ws5jR7Exd2Zn/cKK+O72pTPrL CgB/giY83fJqYinMXqDmQA0+sP8vgNmaWxLjFwxcMGlG+xpiFIMBB0gmhBRsgAkrg0LLbEZVLRRV 3eo2N1DdzVRp4FurYvMqwe1QNrWqFeMYBzkhekE5a3AOsVhgBWRBJ1nNkuJ3xlMeglhDdPGJQLXW c6Ju6Wsj+WkQ7RigH3a5IHb00p0Z+xMgAFkIXwTKV5YaNp8rOm8gg1SeiEpqjT0CwBrQ61a3wEUR Gn3rRyHBUZlAmSEwkZKnMgofzcI3pZ2y70tHCx+PkGKlDCEVZ6F0yft+mhH74Y8qYnolmVT5vqza DH+wLBpV4URAN3Fpl2hhSmHUBMGzCIaCcIpaMNU6wad57S54WUtizsYYc2DAMXz/outqWmPCz4ym VJ4pFThdmNjD6k1VrcLDa1pFQ7/tUAWFo+zggnOrxTUuDEUk1nKeE9rLIYsG3JHieKZYAmqtNlsH /SO1/PhSmjaUdQuiXbvW2Dv/zO5edGyAGn9bLwaR8bfx2k/vQPJSiAyUuSc63okE0JCDQOSQFInR whKJyajulJFA3e52wefTTEY1vJ5sGSstKd6HLXJk4XXvmH6aDX+sSR464yrQilbLr8xyf7l0052i 4jRgck2BT/vToAickhBKrYJzMbAxpVbMmLTDwGttDF8mZSnBFJOvbzODECrDGlShKpyjAY0R1AAa xBLWVKAy594Al87HVhZWg7NV/2aBc6sg9upxYXhcPSs3HWWR1olTBChAA8oGh7inPaFLyEGxOJ+Q hMtCt5MX79q1IN3S7rZV5u1vbZsvj04ZRiEVyEI8tK2WKrRDKUqzS5csPIq1pD4TodFEwITnh3iX z32m2Z793FNBg9eT4D1vecPEyqUoxaqufMpUuyTeobBJZ7Z0ypoubV+v+KypBkygWYRGJwFzzTAV pGDXSh01qtFVrQqucNMelQ1I5SXDFXxaMhtjDryEAcSDJdULwQmaz2zmxCn+5opZ7JoZwiayr8Eh DnUTbTgwQTfUjucQ6ZntI95TtKM98hTBnVooJ7SgT9ZWme1MnzF+FD/AdVe6uP9sIToqSEFgLle+ enfcehNXJHmUSCKfsJAJRHdgClMYi+bLR4aJb7odwmTDwtcihMDoIPyyeCEl0pIOOWSoPAWqlgxN 6PGet3/qfW+X4PsU+ALAHzZDOUxmUt+msk+/8EMgfi+tFkzPROcIVGBP2AL0VwOzKQ98cIG3pkEG 1yVpdtVPXvlKF71sOOqCkkJljDA32KTmsL4u8bETy2IX8k0Kj2VV4GY8G8tSNgyYNU5xcLWGHiPH nsIKLeao88RwI3mKPUDRe7JI0Cd3cSMxpXJGKQogj455Qv4hF77tTS/cTQh3cWQ3Sl7aotP5i/Pn WXKL0Exd7MZo4Yjs0J4hgsj/lnqI5QFv3opW6o+HyD7hLDc99Fg/VJAPurwm1y74VK5ymER1qlDN X0vmy/JX/nerZ8r0fbFaSwTSciyHKrqhEIwXNQkm+4ThvqldDf63AApqiqGLpRQV9RVg0NbHtStp NONCEosq66TJ+ontb7ewt1iGgCU7Hl7FNWwDAHeIh3YoOHzIOByHV+gpDPKps4IsOqBjn4ws3MJN taxoPVYrkJ4r41RndbhM8Szkdb6MoxokXiIq3+YF3+qt8ozLQkZCzkhk4AKOXwbuWgiuQ2qw4aiL 45SCQwCu4g7iIAbO4A5i4v5N9vYICQduuebLH5on4xBC9l7kpzxu97jLCo8K/7ysyn5aCeamYr6g 6ky6CibCYmf2Kyv4S5cizSwu4ubcItTgKvvqwvzEz5rsYvzCb4Mi7GkiBcPCZvzqwpjyqiak4P42 g8REY7CMQNjsb7CGTcXEiW4SKw3MKTZgwzacbRMNkO16CJ6Kg1c8K8iSCO8s8BT97jwSYj0EDz7+ iD7oQ0M+wqE2Ksx0x6MaBLni7XZE8MrwLQXJaN8upDxEaiIGgkX2qEVc5BhNL6QM6fQ0j2b0TD5E ZI8KwkOq0UMcjnlSLyPma/YegnmokeUsyV8yAtDG67tArvcETfhICdHWhGZazpX8B/haQh4iouXA qtIejdHaxL6oDywSaOfI6v/SFChRACUqSq3CGPL75Erpyg/BpO52zmLWnEKC4ARS3MpTEGv+6m/Y agA0SigzXMjr9i/ZpGDZICsTAweFckPaguMTFadxHufHrOBxSFGJTtECS0B0zg223MPi/s0jMoA/ ykhedge5HuSjrIxeHOre8g3M6s24eCfeMO9fJGIhDqI9/MFaogtGalArtTLjGGbjCIIDCWLi3EwA blBERAQb2ZItV2qQvjIJV8ohlBD2mhAvVwqRPu4vs1AdBZMnxiQskG9koLAfZY7lRibS4hH6CKhn OM3RuOKAwOot1o9OhA77fE4tmib8Xi3C3mqBrq9rXE3qvIZpqknBBnEQ+eL/6uoPsYbN/koo/kby UyzDhCRRxZDNhS6x7F7D7HADNwSwMxBHNzKLcYpjOSHHV+yuFHcy3JagdMJjFePjtWhrelhHogKk jUwwuIJrKcNzXh6qPIURdzbqKXtHR4QHGblS82QPReKszBRmpbTRIUZEIMwjPoknRYoQROYyLt/y LTkvIwbuG8MRehAJImivZZIvIxxO967wL1Wu+EbOuzKp+DJNH4Mi+IgqZxYNRG3pf47C5/DkUAIM NH3OUWwt6dTKIRnyIFst6cIGUhyjmZIOI8Hml7IBb2CoNEAy60JSM0DjU0ooNo8U7PYPsH4TNswO AInTxganh3boN6xUAXkM/7SaA4meQw+iE9x64DyuSAMHKSE0JAI+kLbwI6J2pwSJq/KOKz/OM97O iMvM6F3EJUOCJy0Noi4H6kPm8loMYiz5qAkJJkHP0rn4CKWIsFHjsk+3pSVSBD+n8CBqj3igsBun a0VmjxyhEAolVELBJwvt8SnqS/mIIlMJiERXiU3OJ/nkywyrApdmgkRzjg3R0CluLkb5MOkOzERH jf1klMHCL6+qya6W7mkexS2yxjGkABJls0hzk0g3Jf4+xVrz78Qo0TTMyRKDM51eIzdcxSU9UceK o8eKo4jsCYku50uniByqs6DYLKRAkMtuh03ZzaPSMwTbLU4jz10ezynzrf8F9WMk5KNFvPIYdbA9 alAuiScswxE/r3GQroUDQYQtjXE/RyQ+4ZItldBhnVA+QBWRnKf2KukvRzVlPa6nvPC7Uk4eHxNK xHAekw8fo7B/Sk5EcdYrjgRYRe1O4uRn2yLUyA+uhLWuhGno8qQvbJQxjEYi3+psGszVViM258YI SihTsk4IsDZtMqMRb9OE4C9tYEDFeDPsXqNJHwtWakOHpDQmh0Mmw2BxQhEnITAn3XUMSkAfVmsV GfZfGoBGipJ1JIQW+3UF31Q9xaV3Hg+5PAoFj3I7bWqgJk4r+XQrhbAuF/XfrPGPnst4CmJgJCJE aNAtQfcrS9ct5ZJTJ+7/zw4O0KYr4SoVC6OweZBvQtcxC+1nTDI1+bzwCWlOKbhqeNkHv1Z1rG4G 02x1eQ1SINkvrdIqNJkGIwlFaYeOVyts1ujCQfrK1Eizr5SJNbPhWfXPa+9PbapVhYj0M+KvSPNv W01DVWDgN9fWsV7lflGocJATOXdMiJSjJofFnu4ub6fTOj/E81JHTW+LcS/PKOU0P8bMXq0SPPdj 3iDPTi/kZKanX+ATYN7MjzxE9hxOINhyRIqwYCoWYYpQhAHURU7EzVZYYz3kYZXvGiEihEl2QR+0 d/ksd8nRhwUtQ+unKJAP+FwC0uxx0lhVrO5HKi5tv3w2is2qILEXUAYF/y2k962kVzTdajEixSLz oosx6Fjtyicco1SAVEi5VmszI1PW2Ag0RVO6liSvFf9OMiXVFjjLTnB0qFaoVG6DqJ4WkNueI2/D dAOD0oumB1xAkFz2TRhra4Jnp1z2AxjjtBdzMTxrkT9E4uKSEUa0Us3ScpTFcgmvRSH+NJCezHLD sZX9c7pgWHVtkGZWT0SgkAjrEvZAL5OOsKdAdVS5SwyJ77titXZNdR3pSylO1fm2itJiwtF4Dub6 a5p1ySALqCgWssA8U8DYL1mPtkXjaq7w6un+8JtTAmwaqA7NYDeFVIWEQG0uIX2xNjOodTO4Fo5V yHzL9o6btG/CtXBuo/+ypI3aEgfueCVL1RWJ8hZex9TzvqherdK3NjkEM3lxP0oXH+opuywqJ/hJ GmYHQbpSz1LgBo+QGBUtuWVbuMi5VOQaVaQIH5YKq/FiaRA/lXBkOe718PMumQdUbxdmVxZMdjeJ V0AMYza+9NGo8aerZg5EbQZ6rZkzy8oqzooOqdpXSXN6VXOMWRQPXfRqKIQxLGXWspgwHsMPGywb 2qEsUshuauCN4bqNa4CEulZT4Hps3ddsTYyf9XhtZ2M4bYw34DY53o6w6wknn8NX8rYErihEhAcj BpdwK2+C99WBnRI8+/Wy9Q1eQjC3FHfKrgukWbkG/9RP/9RzPbekUjn/RCoWB1V6CUcal89y4NYS Uxd0CDmVCsmyCXk4qLNQVX9YHY3aS374CR1zlc5kqmy2qVQJAGx20TbtDJX3gJg3epvCuk+0qpFu rrD3mzmT/UKoMTjo6Qzl+w7D+qaum9pZM9imMtp7rt3Znd9ZhYR0U/BZbJPUN+c3JdP2/6JUNgDQ bW2s7eApOX5sAQXYCggYPlQxPxT4siWXTjUasxO3ttJTFx1PKeMNQ4hS4zhE86gRiwhJpY+Hi0hX TNWseNzSuZZnY92y8+CyhQMOkQbuPmlbLp0nQW1XS/Zsz0DVqCdUqGnGS3jCS+aLuIsaubVKqMXr yOcr+DICH20JZgJM/6tSNIp36cqvOEZP1KxTrSGXFumA9frCZllXs2kcxTFYc8HKOBtUwGvfGg1I 6K3n+p3dmM7rPOviuQb4PI7huEjzep/PdjS69VvXtuzud8amlMB76BOX03876znzdlo8j0MeWnID dsIjPCp1MTyrjDwnuXGfcl+RSyQ0RHhQt2CC8gYH5jxKN3lcXaFcy3RZfEScC5VluS0FVHUrt884 Tnb/zKY17peHamYzSVWtcJWAVyl6N7ykXL7a0CtSLkR1xmRu1SCZd7rXpL+a95YMLDPFXIFUk7u7 GauzGmzOr0aFli1gFJ0FxQWetVpBrL3n287bu72xls8tg731XW26tv82N+NTKpE1unW/MxE4pbRt 2044ALnHGvAm6UnB3fVz7Ew7t5NAfMuiJbyBxQUX+WOTN3nL6MXj/TUGv0WkvFI+iGfNUMoYV5e1 /450SKd44ONzb/2AJ1ZABXTlZ/gcaTouicd2r/Fja9cbATMwQe5UiXvH58cllltmPVRixDD4YFXT 0HDJm3qqsdzntLvcDXJOIsho89CcocaYbsdpMQDckU5qK7Jpwrsd1nmNe+2tew0J1gbE6NzO3Xu+ 4zlT3hqf6zht8G/Q55c1nJRvXqXGdEN/Gz1uH52wE9o53JUNKP08HPzjIzzzLfuCt9NfaQdx8SPj ybOy9eUiJuKL/uX/Q0qqpUO3UA9YhdFSP1H71lHYYpfHGks492NZ92mmQOXRUiVVx1PPkHoZTJDd G4EYqBKzdoG7iIe4ZqL3HpP42VnOeGMJV68926nZia16Ra3iyt3irKh3i71fqxVsIvFCzV30uhdl rn4pMPDiWTNFzul+behebS7jMvh8je//7/2cawGiBhojMITAqAGDIEEYDKWkSeMwohQ8UirCwaMC jxk4KjhyDAMnjEiRTKJ5CbMmjBWVa6yMeQnzJZuZECI8aQCgAU6dPF3w/AlUp8+fQ4MCHeoTw1Gd EJKGcAFBp9KiSRsMzZlTAIAnALZufQLWpjWxESZEsGn2ydixTyaA/x0bYa3Nsk/Otr17Fy3ZuGfh ThAQwZ9dwQD+lgUcOEJhwE8ETAAQWOtjxwII+xOg1R+Aypsxe+6MefPlFZj9ZcuslbTmFZvlASB9 2nTr15o7v958O3a2zbu17r4NwLWA3ayJAzh9PPnu5cqbM3/+XPnpbMuHQ5dOfbn249G3Z/fOnbsL F9kwjC9/Hrz2bOSPuwBAnjr88vOl1DAi5JKQ/ULQ8N+vnxA16Dfgf/3VIIQR/uFXA4IK3gdhQhIu xFAaDFUoER4wwDGRRVJclFFHHoEkUkgipeSFSSm5FJNMY7Chzgdc3WRUA1HViGNRS1mFY09M6egj T1EBySNWEeCUwf9WfBXWlgBt2VSXNVFG4FhfevFll1t3scEWX2C5haVZAsB1WF2KGXYWlYYpSVlk kkEWWWSQQfYmlZ1dBgCeeGoVGp98jibacJnhNmhqXR06nGmZIccbbq4lB9xwXU3Hm2+SUlqcpJka h+lxmnJH3HXyfSddqdmFd+qoqK6qKnUQsJeNVec55917oGb3qgv/wIpBNmbk5x9/+g0bbH4GAisg sghe4p9A9yVoULQFHUQthRZCBBEMEFX0YUUYfeiRGSCpQOKJJ5oUzRpesBgTjDM9MU9OOsn7Y4/2 zvtqjUjZiNSNRFnVVJBU8bhTAwLg1JhNX9Gll1oMuwWYlmlJTBb/W1oyBqZbFDt8WFwRY9mXY4t1 7E9jjFGG2WOKrVyZYpcV6tlnfXLWJ2l9avbnbawpehvOsEnaqG+rVWqcpEZ3Wl1yxTnHdHe05qZe dNxdyl0DrT69QnXeUVccdeTFZ954730nX9bLxbfbe+15XR6s2UixH4LH7ofEsQXGHWANLezHIIIN GuSsEQghpJCEF16ILRwwTJQGHI13y6FHcExOoonmothSNO3ONFMGGRTxRAb39kiv1RCULlTqOS7l k79CuU6wUPLmxFWSM44ZJV5pLWnWWIVt9RheT7BxFphjaZw7lBSHWXxdlI1V5VljSl9XyW5S9ntg 2dM5J5Wo5Snz/8x3CrAza5gJZ5v4hmqG822GGhoccP6wBtzS9LO2qXKfIr3/p/kvvZ5LLSdrtzIV qFi1HuXgj1UA6NV5XNCO+OhvVGnDDtvaQx6rNaAgADKWB4UFwrjxR27QApBALuEsAT3LWdMaHLW0 hbjFPYRb3IocHuCwkcmFxESWQwlKVASTmaiDDRmwRBGPABTYBWV2QEHd6GInJJ9AxUf7Sh2ReIIV g0FmRnWZElq+9KS8XEllxoOSxaC0F+QBhi1wYQthzHIWwaipMHOkksIQM4HLxIkwmHnCyzSjvfAF qlLlI9SfTnM+zrhmBaZZDc6moxXhPMp89WvUcTSDnEzmZpMAbP+aJ50mKgByqmmiMpULBHjAVFln PhmMoNXGpjSlnW1UY3vVcf5hHliRh4MGClDdAvTBYYWwQHL729/wg5+DRIhwhkPItWCoOMZxiCKR AxdGdFiukYThJCsKIht64DlLMIAB4bgXE5d4ryvqqIr/8pESbyTFnBSlK0lS0lakVBbeOSkva8ld GDP2zyn5JXltTBNcnGQXLNGxSgwVE2BKphU7isx5cmLZVjzzRz6NL2Z+EoBwCvUajYrUfZXCjafy tJtFdsU1v/lNcCyV0qBpLTf941RNp4NTBlJQVKtM4KgECMnpFIeAtdJlr7rzHFju9IIV3I0UhKmf utEthHPL27H/8JMsByXoWYJDwzIPYqEKLQ5xM2wcDKj5oRuqQEQg2aE2TYKSNciEiBlIhyXE+QEU XLFg6DTnjp64VyvyC4pY3ElWbsIVj3kpn086Y8IKys+5sOVJXsoLQPlSULfI0SZy9OOZEAOZNVHG MDgDZPf+KBpDchQ0iupozsjHvkUZSjiY1ApNcUNJQTEqObqNJSdjaRxSGhCUntoaKUV5nE4aF6cU lM6lyONACK5tO5uClXioY7UGxopXsOKlEKJAN/AKoW5SRUJUx/sfYQoob/oxQnuj9SxlGkFw1ELI 4Z75ocXVcCLVBBHl3BqGaIwERS9RxxN6IM5xfkAHKHgi6s6Z/0V6AeB0+HLiwNpJ2CExhUdDuUfs bnKosNwFeXhBi5Ka9CQlFdRiySOx8bxopZVJNk12TJPIVLaYv5RGxjeOKJ1mhtHUVgYziPQMI2mT GpxlhjS4eRluedM+eSQKprLNBiZra9PezDQ6C+RfqHIz1E22irmvKaVPyzZABJY5p9nRIHu+Jh3T qGq60MGu15oDg7pFobz8Ie94pWqsXyIB0B4kodwYJCBkNqiF1apvWGGorTRQRNI0jJzk/juulKBL ri/KgSUgEAQfLLgINnAdhH/ixCcaBUjrbGfApNgABsDaX0U5GFYyoBguOgyMfAFoySBjDcQU1KBf pEsXJVaXMv/6JZ/BNkyz1xg9xMRxZWt6jGVSJuQhgw804evTR0PDyEOGRlGZ5BnPdmu0SRZ3UpOy 1LrzF1Qxo0o9n8SUmU1Fb+90bTj4S6mVqSPn+XAXbcGhFEsZ+LVsvOrOEfxOnvkDXvAiQeLf/bOf AU3eGkjVqlmFllYVncwIHa4Gz8wWRByXVsilVUQAtlxKXtSDHDAgCNr4QDx0UAQUnJMnohPdTXre ANFJWNU2oldgewSBEEwFAubgcGELC4B6zqhkLlaeiGMMlrwMD5/IbuyUIoslfNIxTWhiaPXOnmvt 2VGPdLKTyipjsh+X5k9LXm1pmmw+JW9b7+brjc66cjRyY7L/Uf++pCaV65ya0jSm2fifTkXVnZ7O e2vLpbza2IMBw0tKHoyXoHXXs92xZTcb/ok4eqVq+kH/2eK/RC8w1WtVRBeEQV4VHEFcaN/Dacsh ZfUWf8ElLkybCyVjUEcPGCDqDxzhCB/4gA1EB/V5oVr6Rjk19eFjL1Zr2DxN8Yk5mgK7feXkHofF icKgtMYvtmWLzfajH7cIMSvpLixg0l3D4LjiiNExx4A5GcrquEZvBD4ys3fc9jIxAxqkYT7a5hm6 YShM1j6isRuP9Ejww1vqRikzxVI1JRtIhW/D1VtZg0polkrcQUAnWGYpSB3DwXncEXDsoV3ksXDr IWfWIR+T/wcrVnNUbrMcGkdedTMNq3dxP3h6RYheBuI3BKJCDdIggrNog0Nfw6AtzhRpEaE4joOF NqRDWxhgbpUSNBEEzVcEOqADzVdOSBJ0QRd1abiG0JcTbkg6NUJhODGHGCYVISAUDNAASsFhAfNX hsUVXwE8yfZ1gWEm1mBPYAFRlvV1yMM7X6c7TgJHDaUm0oZQcPI7OqYyeEIlggEYkHGAHDVkfjKA lREbGCUoiTKAJIUnC7RA7pYpwCEckadl7kZczHGCWbZ4i6dc94aLJZgqFKRS2XBwxIiD2eFAv9gp BDcqo1dBSsUdBTENQKh6ezZo1CgE05iNP6h617h66mVCH//UN8gkIPVFLWnACGJVchZCER7CIRmx hQAmEkQUBFygfM33AWEYDm/YADTSc21YMHAIh3zVRNQXK6pTMBMmT3soFd/nFAy5Iz5xMAkJiF6x WAPFWQkzI1tUGNbDayW2bJGlMsFWFqHFWXZkGI9hFp3liZOhiaH1Ow+lGHdHM6HIUQt4M8hxGQcY G+CDHEdGM0/2PvFDKZfUFazxKBvIeLuIXKDklM7xP8EolbSCKSxVjC24gpSnQe+RS1NjjAC3Hbey HA13VPHBjD7YjdeolmuZlmqJXi1QN3szQkqYLE64VV51H/KFe2lgBGkghTC0LSjXB2aAB49zEZdG OdEAB1//mAPvoAPMl4/v8AEMgANqOC9JkgEC4IbQB2JpWCM7R3RJxBRNZyOkaRV4+GoIWZCGhRNd 8SVhsjBd9GvBQxjO4zsaM4gMM1m7s2wMRSbTM1pU4jxwokdztxhDZoig6FoiRZNKZjPzo1FMJijb Rkl4Ukn/FkldMT8n1Xfs1inXSTXPoVuaoou5uHgZGDV1VioieGYFREHz82XfkXCwhJUsxRrTlRzx YTW7kXnRQR7+AAPTeI0CqpYEypYH6o3ktTcbtyzLklVMyIT0RV9gRYXX8hDb8iGGCS7g8l+W8wSW EIYfMA/a4AMMMA8+4A38CHQ+1486AX2euYY08plPN3R8/4V9sNZ0GsaQU7RXBxkrNZpFupZGwDY9 XrGRgaiSCZUWbGQlyBZjEANHnlU8dLImaUKcNvYXcjQnfWScGTWKotg+c7eTqbUnFYhIFWhSR8Od jtRu8UNTB2c/tDFKT7mUtxiCqWI2HkhBAGSVhsdmy8WVbpMp9iln0EFnCec28+aDBnqgAsqoa7mg QjheGjc3WlUgigYhUHghCMEI68g43qKhk3NNmBYNH9p8NBcE88AAk3mGR3IkN3EkP5GZmImGP9GZ 1Ier2WcjGxYVU8EveEhYqrkjpYMVwGYmXBJjubalFmlPKulFcIGsVhd2ziMmZJIYlFikcNQ9mGEn nuWJof/oPcspZXmygDYznTuTiqeBP6VVXHryd+MJHFpzKfuTHMPYNAFHQMPYU/tjnyqIKvw2QZXn p1i5U3JmGki5HWb5eabBUh3ogmPmZsIlHzXwqAhqsQg6XnAJl0igcR2bH0lYl0sIhU+4aA8BmJG2 e42jsjc0qlw4OQi2qiaqDajKACmqhkKnEyCWmZ7pmUeSajiyc6kGFbBWL4OVOnzoI/cgfqmTRTuR WJM1rcG2kco6dYkFJ3BxdccTWs+aJYxBkoNxFnDyifrXksq5MlsqJzTzpQh4MzRJZEM2pnyCHH1S XIWCPiolnVb2brUlb53UNWJGi/PWNNYheWjGUvq2Zs//wUj+Fh7F0YHekXlrI0uKwnmgRyrf4UDu 4VN5xpbT2A5IULGge7FuGZfeuDd3Y0yJ5nFfxRAk57rriHIqi4VpFY+KuQbpAGoMMLPjFATjVE4/ F6M8Z5mwWqv/6KKn9rPz0i9CEmuxoyPhFyTOS5GGFZtdRDzHcyZG6pqH0hW5BlC9U1m6GWPQYxZw RCW/KSbp6xksA0iGqD06hm1gioqYYTMhBWVBqVHmpopSZluf4lvjip3JsZ3KIRu9BacS6z/esT/w 5pXmSXl/a2X52p7/Bp/B8bdgMyquocGCyxyiRx2Zm2/HMV6eK7olXKCDFrpsyXrdWIQOikIhm6lO +IQv/wRpYbUtG7IhhplD8fgEnjZOM8cA7zBzRSAvwHuzAOmibMiilsmzDyZ9QtsATcdqVKQ6R7dO EVasWScXXaQWnzgnX6wwiQVIUEtsWhJ2IUMXRComipUwYnsYf4EmrDW2oVha9CszpVW/TpZkcipu T6Z5T+aKJ4U0dauBE/R3m4JKB4x41JWVkMe4ffqVBfew8UOwjLtTr7QcB3sbizRmweiMnne58kCx nYvCosuoKcyWC7o3cKlxq9xxA8KE0CJfTpgGCCGFtxxpF4ot7nhD/rVDbNDDIPrDvUtOlomZtDqr mhl1tMPELeqZN6EP00eQqqMUNwJPACOae7UvAzN0tv8GYq7pdebrOxvpFdxrT1shGHIRF1zLPHSk rXAcMZgBF9bzpW3nD38hd3SiZMv5MubaUeXDrn0yt/FDirPlKHK7PhmYKFr2UsbhuHXKZcIlD2E2 HQ67p8n1pxwcjAeUr0iJb/vZK8m1yQ3duN2BNp/nHAFncdM4Dac8oCbM0qOboN54CXujHzadLKvb hE9IXy4EA3+ZLZPmOIU5u/EIB2ywBDngwz88xAeDa0F3D56jmWm4opfZzLcqfRPZAB42zbQmrNHr Tkf3o1m9Ez5LvdW7xdvLvUe6vU4CbFcybMNmGFJKdpbIMtIGz5PRMr9zgDPppaHYGWfak34i2DSD SLP/oVImBUCCopR//Bvw5j/r1njxs7heKW9IlR39poKF955g+W+Mt8GLy9kG21zooSqinR0veECe t3BiqR4a59IEKtulfMIy7cpS5cpJCKHrFaFPWMu/3al+mcu7bBGNc0McetTf5MPiRMxF0ACxilgt msyzmhNHIjrW7czHO82pxofaDNbe7atAEmGtyZpYHBYRQDzuG2I+a2vmfLZ/oc7DRlnDthjkm4nU kxiBUhrOw4ncWs83OXei2Lbgsyf3+1IltcnjOWW/ca7tZnDzmsmjtMhQ45X7qoul3TWT/ZVbc7gi ndrLcbibl0Br41FJAxtjY4OoIkH4uR2VKw9CkAKl/2ygMV3CM27CMn2NC4oEcJkfLSCXNt03eOmE TghWfJmOJostFNEHsstfW9g5nnZXTL2PtCp9mNmGa5jdMhrd/pgVBpOr+hIUgcVOq+blrGlr5V3e X3F1VoswzMoVbm2kMslYS2oTbYImxRPPdkSkn5gY0uM9xTkZdKzfNqm3HtUZs2iKe5xbQkkb3Htk mqRbHcjYkk2U5Canv9Vl79YcXWPRGu7AkBdwBCvJnNeBXdZIpT0rGr7Qop1cov55G00dGvwcNRDj 01jrKTANMa7rjkrbJ4zKKly6cumxDfLCELpMtVzkyD4MUrDsM1RDhtnLMKfUUC5OluDcodOi2D6r 1/8ddMqcszxBI6UzkdhtYT0i5oBFfWc+3tMbYVwBvr5jT+3t5SGmUfaEiMJpJvnkGIe4JNeavt5j Ft0DiiPzY/3tJN1WGkUWM+NqnDTpKFCGro8iKEsznhN4P0RpyJDNHAdXjF9Zn6Pup9zRgiN/HFaJ UzUoH1jppz1FwcbIeatEVNpV4fEWNQIHAO0Ag6lSjAsNAC2Q60iA60Av9CkQ9Lqu66Z84zg+aBob lxnLsRx7ukx4CUMOocPwuiR3obznEETN5KL6LiVgCZ4GAVFeBAejs8z81MDrObS6zDermZo5q7Va 5swbrOkkMHXvYVnE1U2LvK0ZFsTTRdurrGd7KMr/CngP9ViKBaV4jiYayecA/4mT4TIe8zKdmG02 GTOH3cdA6YCvdVsLVCkSn9j0w9A873gS/qYUrqfa0fHuufHa8YKhsoGkHm+bQtrawYynXtllo2av Dh60zzUvDvRGn+u4vutB//O2Xtu/rsI8Xrod2wJK6Dc7fXuCA9zo6Je6rPWDeZgfAnMZ4Glif1cb gOXYrvZvuIbQ3Y8+F/ct2vaio9XmTuY74RPJG+ZMhP/SHLR+n3VzUc7/DxBPADR4IgDAwYMFAQhM KEDAhAgRrEV4SHEixQgTHj4EAHEjRAAR/FEUINKhQ5IOQ54U4I/lCpcrDLo8CdPgzJstAaiUZ3AF /4Cf/mQCPegym9CD2QRkQ/jzpzyiSplORXqU6VOiP6cuBZDNK9CpVrv6ozoVLAB5TKFmW7t2qla1 U9fC7YqWrV2yZNF2DevVRV2nUZdu/eqX79S/YfN65Xq0q5AU0yIjSZGCMmXJlytPo2xZcmbOSESH Fl3atOgWooUgSS2khetLrmsgqVH7kpHauWHU2J2mRhojaYTDEC5FOBwpUvCkQQ4Hzxg2PXLksETd ehF9GZ40aAAgA0Hw2htkiJDB+3bu3ruTNz9ewPcI3bnPbwCB/v2B8vXfn++Cv/788kuPvoEEBMC/ AAdESKIJnlAoAoEaEIChCBbc6cILS/IHgJE6Cv8po5A0koijiDQq6cOdSOzoRJFaDIkmmnJqSaWc fppxp6McUoosHXXCcSaieDyLKaCWMhIrwPayqrGuuILJrCXT6sopstSq6y6v3GIrLr6uDKstvqq0 aywsxZxyrxWsslJKFwobbCmynmQsrcK6arPNvvpazC15IOtMssgqEzRQywTVTLRCCz1t0dRKS+3R 1WZ7bbYaLsktN9wu7e23YX6DYRjjjDsuDSn6MAMOONhg4wnprKvOEh3ke4K9gdDbzjv1bCWIve+2 2+6e9r777z8B//MPPwjywyC/Y/vbr0BnDyQQwf0EegJCiCpcaEKDrJ0wIW21ZajbmUT68COKNJr/ 4FyPsnXIxAopCulFg0hacUaWYKzJIRtv2lAll5pUikMjieLwQhu12nAvJ6NKSjCpHL5KYrD08qrK OguDsststKITLbou9iqsqKzsGC+xjtIKLq8wuGrNwfgyKOORaTYZqcCeFKCGzwQFdFCgE62ss6EV 9WxRpFVjjTXXmq7htdcsrbQ23DLFrbc0GBmuj1CLw0M5KaCTzgPrrvMVvO3MIw9ttm8dz7v4dD1v v/kSpNtABblrdtgE79G7gWP92/vYbOoGXD5oF5roIoa2FcignRqvUHKEvg3pCX8wL2mjiEpaN96C PnqXQxfXdUjfg0+KUaWhcnKpp52gMkon2gdG/yorhh0zcmKg9MJd4bIgVnJ3maUKXkoswVRTTOO7 cqvLtMiCCnml1jISqjSrXMysNgVuDKY0Jx45sQaYwlNjgZXUK82dg97s/UEBBc3oo41OGjX8mWYa 0qdra+HSSwXnNwMUzjCGIxyufY05zIEOq3JQggy4Sge4as+s4qY2DOJqV3HblQbRMywQFqtY/LGb fAb3NxAKDj/NEmF3DsKGjFxrIfOa17UgN7nKzfAmKULISiYyEovEKyImoYhLiLgSncCrXqtjyelU d7rW7eRfRrrJwIaCFDjh6EfiK9hakmKx9aUPeA6Di1CMRzKSUY9jIzuM89z4FSlJSSvFWwzKkv80 x8LgiUwgE0BP2OhHL7URStO7C/tOprBLwO9nQFuk+zZDtEMp6n5LQ8IVVpOaGrjmNbSBjW1qkCnd 8GYYn/qUcEglnK8lsIE9yIAlelCd6ejAVxkQz9zEU57ypE2XbWtAfNYzQsQFk0D4GSYJDUe3v91D hXsDnLQU5J/CJShy15LhDCFUEoFA6CDfwuEOvzU6D3ETI+v6XEQKEpFzVQiITmSJFKXokJ7wK0VK OQlUBGAjl2xISP8Sko3qUjAr/sh7EcNjwwjaJOztsSx9BEoc16g9kb2ReWhMY1z6GBY4XQV707OL nFoGlMBYaY7hs9mBanYlgekFe3HKBmR89j7/+TkyaJA0lP0sM8lHIeGSTLvEpPoHwKrVxjcEJI4p T5mc5bBhDA6UDi1z0IMi7Oo93hHP2azaQbVRkILlGU8xiYXMFg4ImXxDEDOd1axkqbBYhUvPtawh QwclZCGTE+JJtnkhjWQohzv0x0RI5yETkcglmLNXXotokia+JEVNzJA+fcJDoTy2i3B6ShZVxqHL Xqlhc1yLSilG0JOhT0+irehh5BKmi2WPMSbby/SwctDgFc4rWJGJH+9JGC995XynXenEQlqXS0yD BI2sDAncR1yZ0vQykzTNFZYGNSE8rafRbYGl/hdAoQ5wlKM06gLDpipWPtWVlsiALNkGIV5e/3U7 uWRPLsGDzF7JRwASGmZYQSjWZxnrcIU74bEAYJ9msjA9c72IDkcUkcVhk0X/Kkq9eDihwV5ImzHK yLtONFh83SgnBCMYOxnKOifSM0cf3ua/7Emkn9QFd+mriz2hor6IxfiOvRMfWAYDUehxaQXPi+iO Kcqxi2IsTg7rbVYSWjMU35NHMnlLzLxSPpOi9C1ReYpUeiuPGrihMlrW8nCNK9wUaJmRjuxMmYum XKTl9LnPlQ1tciO1T37SN70hpQFhIKo0cA06bMgAK8MrnQ90Z5az8iDa1HZBQhO6PesxnNvgM0y/ eTWY0jxmCsd6uP6Wbz4Q4C+ArgVDHJ7TI/8lcsi1NiRDeSkkhxgCWL2CqKF5dY4lgcVIh/NFo8XK hCb9CljAqCiVKhoFi4EpmI2AbRatMGmkQWLtlB1KszU+dLVcKozy1JQkkUkvo1bmCiG90g6p8Egp r33tSTU2Mo7Kg7ZjcUrEEgnmnxl3y4PqskzJXFNE5ft+jdpf0yZVXQACcJQ1MKDWQGVAUilnz+mQ jp9zUN5Z+Wpu7rWqds4DN4uzJ23z+Y6wFg0evEELv8Tk23zY2qxl8gea6UmWff7i38MVyEHX0mZI JvKEBn1ORArpkOk2FC9WS3ibmkMJRnrekXw+cUYVwsk9+UWTHV3IsUTxlztncuyHwQShsTv/SGfF +HXreXG1AnvtkJbC4+WJTDGinShqLRo9gloMtm9CTJOcck+03DYuGxMtSpMN7GRjr49C+DIJjKtl 4Yo5zPGTt72DdoXKCEIzzqWMcylPSUpCqgWb/3fAq9Yp3wAnDQjv7p574OcI9iAdE5wlohNdnhlG XPbaWRt68qOr+GRgqtzRvdruM1/DibyYwIw08MWacvpgANMNUH59DpQsBS2kQdW0OYQQfP0hegjo mNMr5HrYQ3NpxIZFPIm95MV0W3uYnv5KGMHyaewsXtEgsEvxwPxOsTFeVsbAFliMjbe7KcMSijIj t8MYtwMk4CkL6SGKhIqjcvsKJkOKnoAL/x3hi8TIhgusmQX0I+2pLCphiuAyPOECM8VTPC+btxOU KcirKUGBvOXCqUpyDaaRjf/pqZ8KON8Yhu0aPaMag1XqMyBcvYhbiIxbr9m7qgrRvYj7joEQFkaj oPearwzwG++YL+AbCOObj/nCwkorlsCZLwFjlsPRD2pZue7YmwKRCG3SJohYHOy7uc7RJpXQFm+6 qzkcCXzpEKNTJ3ZiIsZKrNbxNcnCrCp6rL8zRKoLChRjwK/DrQ98o4uysZexixvTGDGhnrZTOzHx mGuzipVpsXDDujpZlsoat6zQqGhDoxm7CqczxbtbAZlIJDE7vBSgxcWrN8UTFONqPPcRhP+acq4U AEZhrKRKyilj1CRN2jz/ASWqya7Q05oeVBVWSQdW8TPWqyqC8BX10o64GcKKo49ZYZv3qhVGC4/3 YLT32EL+ML4sLCH6CJwx/JuygoAT4o5OS4gGQaeDyMc3TJeOMLWNIKzI2SEMuSvHyT6N0Jd6WchW mxGaiKe8ezApGrHIwpGY4JBS3JDLkkBEHBgu8q2UQrYzqbYr8aOyOC04+rEtGZNzW8A0Ap7F2B26 y7szmi28i8A0wR3SQjIuWSnaWjKkQIpEukVa5DJ5K7ziWrwvq8XkSgFfHBQzI0bmapRHgZr++Z/r upSh2kEeFA4fZIMlqMYneKonmAdrIQ//B8nGbFyIXhII7UhLt3Sb9Oi9X5rLXuoqdBwQ3XOPt+mq e+BC+lCmYXEBvzkWdxg5BIE+5ksP5XOBtAIcl6sbm2uQbVJDGMK5EimRD9lD7nOwoLsJPhQAa2AJ jNicPEw/fqGRduqjltA6GlkY2hkLg/GefyKSq9BIz3otz0oZnaQ7J8GS/lPJtVNFCJwLaRO34fGt 3Byy2cLA26yeIvk/dQuL8uE7cXOSJYtOhnpFAbgELkuBKOgyMPOy7/Sy8RzPpHQ8yYu8yps80bA8 zNO8/alB/wm4ARIlTzGgr2SVJ6DGHmCVQNNGtYTLt6Q9uMwlXIov37MgWooPDnJQ7lgv/77cy/eK D/VgQmGiL3ekG8I5w+VDoWWBzP86kBFtqyGCq3x8K4lwKwcRP/E7P9FEP4KkoSX6CA/Bw4CBUddR uqGQCVzDu5bgv6DoUYssNi0C0q1IH0fENuLprHIrqJHxmDdqCyfztrZIo9aqUpDBizRxi6VYthcj jJtkTT9iMkHKE6pQGCaTSdaUCfCBE1kMs8Mjge90AxKIgjmV08VjyhRkSsdLlMq7qebCn0ZxLqg5 VKz8pKzMjRzkLoT7yuh4giX4T3LIgCC4HNlbCG3cVLeEEAfBxvyYwloaVQ0q1Qj9pUfTj/YIVZJj JjG8NP5gK2eCR/+gxwNpPk2dgMzZCf9+TFHNrDBgFTWD+By9qhxzYboMA00n4qfEsqvV6R13wqKJ 3CGte5Ktg851m7sYM6iokDuOCal2a7FAIq1MlLa+IBM8UpJTZChsZSk28kScwZFjQ6PuoTZPLBKf LJIlu6dYTDw5HUE6vcU9FTPxHC4+9VNeVMGi8UXIu7zSMNSlsaTNo8FKua5haAFQAj2CKyUfhI6w TIdV+c8P+FRNNVC4tJZdmTmCYMu0ia/1oqVaySoFHcfxABZyVBsp7CorpC8t5A7jO5ZIUyG26rRa jUd4tEcUQpDLEYmCWJwWvZbpgwioZZd40cOVkMgZyqeVyKe8wkMkwgmbCFt5ipENaZ3/+aPW3JmZ CtSiJpFNmsTIFuu2blPS3QlX5aHJ0Uq7a8tJixJAN/K21qJJnNE/JUlXPcqZCTSjVjS3PGHEwLCt yhK8N4UK76xTObVcO9VTOwVYgZ1FXexFQ3lKfXtPYuQ3iK1K1riuRMUUgiOg3/BBdWADkA1LcoiO S505izvZQZu5I3yvW5HZkBCPu3SbCFmP3mtC4dtLK3RC+Yi030sPmAMmZnGm5nNMAGhMl6PHmLOm cSkRB1FDwsK5EDmwYN1VgyzIvYqXZtXaZn2wmvgRnWBfaC1EHtELNnWMdEUji7k/6DSe/eXbwSAp iDq3aIsjckWfBDy7K9mxs3BTGlPc/8IQijc9RRqTMv0VCzeNLJWJLDd1OjeFxRC00/CkUzzFXIE1 vIIdlBM8yj/tjPV0ykW5AmPsN2VcXc/T2NHrWFUJy0gty0+duVzSXWvRRk19r/XgoFmSlQplwrXR B3KEPVFNx676oJ0VK3WM1XdspsXcG7YKUZRrJk5TzIYACWtpQ+uzvopYkYjAw4k4HXQiyDrcq5Y4 LIbsw9TksKTjEckamMeCHY+0SKbAIqaQSarbVqyD0v8rpOZRElVUN+epxHMNLS3ZUrgLtyrDu0Oy Ctvyv6tY08TNyaqIZLmYMtXyiVZMzQ7uYACo3DBzA6PkMjs1YTcgwTktz1oEs4N1JP9fjMpgtAyH LVQ22zwb5DyBy65hgFRVAcsnAEsG0FROdWYLiuYlvCoDZZsJucuBQC/v0Ae2qSCQezSRyz38Clqf jUek9UJo4WIUyoZkqd686Q7wPYgzdkM3xDnP2Ux/DJfz9T5WWxdBtDo/3BGnmyfXiTqd0Jm5vbuA Eh8wiiiQ7Kz+rUThGU5QdB7Seh4DZsn+NRmraOiL0pmEyih2xcC8E7z+BSmLPrc68Umn64l4+mAl q62YXgHvnIbMdWU6Fa4RdoOdvtxW7txbXmFc9lN7c8FgRBTLg8/NK8alruHcaIFOyQ0d5BQdZoPa BUtVYYBs5N3Zg2auhkslVq/0QtX/Ut1L23ubYEFr+fqOKx4I5wW+LHSWdxzRL17MMVQhEzLRdVmI vlrmIbK+fGyXIMqcILLDnZCQw/4+0pzjZk3WXItWb+I/iyxk3GxbRTSomWFEkdzsv2OLmEkTuqAT asuxLuHbH8PEtwgtl/w7AO7g5rHJcROKwW1FC9aYL8UdDfbgmNZtVa5cOsVpm/7tyx2uWI4Czf3X ogzqXE5YFrSMXR6a01DqYOY8p17U1j1mZE5mcniCIPhq7/5huJybXRLrs6Ggl0VitgGA7ECP3Kti XZE0tkKhgYjv+U7a+mBnvRmIWt3v+sZeprA+eTYner4mnQuRkvBHDOs+vWqAFEuR/9VhVtZUzR4J mB7tNXfStULe4/nTokH+yMawLJ1UV75FrQVmntLmKJJMnimFnrOAu+tcEh/bTgmkMZLKux07kgb2 MZ4sSTQByiGdad3+ZNas3Fj+bSN35cS701h25Z42Sjw9QctlYdAtGmCUPNK1vJySYU2amkS9WFAy AuyG1CVIZjZgAJX9bjTP3VP1RoKIm6miFayioN0r7/CoQpi1Yp71myzUcxTK67ppufjuYnnUtCw+ nGSZAL/aR5rDTJyjOcJuFxIxvzjeQoNwocXKkPZ1uvr1F5wgmIC6zr0Io7+jybm9GUNujKoYEpMc DDox8VYnYL99V4pCbf/Tti4VI/+ZDCnCGDba1jookTuxAzbJTeUg522nu4SAZfLftmmcXnI6TXYU Jsok19NdTEopjzygecpdblj8oTxDleHUxUpxv5Soruo922FLQHPcjSvZS8teubhBE2+4AY8Hrb1e 8uYqlA9u3ktudmv6uMJyjsdIc6buUL5OM7nIjLnsLR/tVb7GdCFzUvR6/pyLYMMDH01yYrU6VAnb lLrQ1BcMZyzY+bB+YZgfCaMsKuSH8aKQ+vCIwR6MinWxG1fkMVfSnosBvta7SAuXXuAv1RmVkXEE zuA3ZR8m48mM4UDu7OAJ3G2i320i/+1ml/pmL3Jnt9OAhXalFK5qr3aixvbKEMb/QnFYLH+uqnTq p4nq3NDhc1cqNrAET1X3r2ZZtzQ02GNQlm1z85glD7J39M6qb55LgG8A5xWm6DWrl0Na5huIh1+W lBMcelwWB+mQ8cUWqDUndfEcWCsiv0LWGd3ZbZKRxbKr1KQirmu1iHysftIiYsuRiCEekYRoZXtt VczJ6bSLvL3EvTsMtFOt1OILljdFz07TrID9Tt7OI1GL25Kyvz3EyOXtoudtDu7Oqqd6nob2zbX6 Ox3uIr/TPDXPrs9lsG9BGO5l0i1ds68uYsZKte9Y6Hh/VRkDM5d73PXUt+Q9CEHLdS9ZCS3v38Ul gACQ4UkDgQYbNIjQgCBBhAQF/yCE2EAigIgu7iFs4KJiRRcIK2b7CAEABIQeM55sEDIjBpMQTsIE ICDCEwAAaD6xRjOCzif+aM6ccHPCTJ4zBQjwd1MmUwEyswGAOlFmUqr+BKxIinSFVaRXqSblKiCb 0xX+yI4FYDaqUrHyoqbNphQq1LdmydKNq5bs22x48fbNJk+u36hR6do9rLgw47uKBxMuHHjw2LeW BeNdQXYFV7Nc7fqFmlUe1qyj4XINrZoxXX+eXWMtLYC06dikacceLeCSm95uSPQG7jt4lOC/fafw DRx48uTL3aRYTmJ6FBLRr6fAnj2FIO5IUlxJgUQQEiRXzJtvkT59i/YtarSHL/9/WI0x9u2zYTNG PxtLT/4DGKCAASrE0H8LMbRQgRlEkAEADFX0RIMRTpjghAxmoM9BHDmIUAYCZDARQhh9lJGIBZkI wEkjadRiSCSFBBNCLblwEo0zatRSQQLoZJM1Ek7A004RABBkkAIIFUEEM93004M/IRWlU1NuBJVN UnqFZZRUAUAaAK419eWUT30lmlpP2cQVmHnhZZiZqY2lVzaf1YWYm4j55RqeXdaVGml5sraYZH7S RVhnZ2o2lp6wbXZmY3HWltWcerpZ6WBdxonXWblx6hmntMFmFm/HDUeqcMYpZxxwxT3n3G/M/TaN da9aN112tW6X63bfhVfeeej/IaFeC1cI0d4l7sUn33374ccsBANCG+1CBQ1kYLUHYitQTQMlBCG3 2zZY4LQE6TMtRBSViCKJFWUkkYkoroQiQi9lBEE2I+nowkgy3njjREQRKRNOEUzgk5I0FRnUUEgy uaRMNY05ZkcqZinlmVfJhRWXVTn1p1OEzWaYWGSxpSldiJ4Fl8klRwVanZWy9nKhgs4smKAt1zkb oC+vcJnOid51l8afVbbYbLX9uamkqxHWF6KxdQobqJF2Glszuw33XKrHCTcdqs+BfVxz00mHq9nZ dUdCd2tzx/YV55F33ttvC3sFsvK1N8x7yzLL3xiWCClhtANm4OBAAz34hIMJ//5nkOILPjgugws5 vji1BnWo0IeGgygiup6buJFG7H4k44v2mpR6i/p61Dq9GtFbpIQ2PVGwUIIXHAGUABOp+00z/aQU UUhtbFhBV0Z5VZRZEX+VUqQpOib0aJb1JVRginXmmXqllrKZeI3VGmOT7cWnoGdFhr7548vsF2SH RWZ+opLpPKdanKnFKFKq4Ua1X6adLDCIURTRqEa1T80mgVcTwAJHVSpUPbBrbmAV17hWHekc54LO cU6tOmgd7XSHO+Lpznh89Sv1nEdYxnIP3vjmN/3koGCDi5a2aqK4GwboQYajCeUYpC3H9bBBBNHW tC5EkA7dI0TmateITBQSEv+VSHTzUhFJVCcj2AGgJSqyF7080i+bIAyMNAnSE2ZijaIA7IwH011N iJQ8NxLPKRMJCVSQAr2sKIV4WdnelKqXx/yR7C1x0l5nUta97zkqU456U6Dqchj1ASowN7tUaNZX qNTgKXxj0QyfzvInOL2GL+Bb2kZsoxbc1BErkamk+J5mGte8knmwDBWnsOKPq62AHQ58YKq0Rqpf StBUrPIaBj14nQ9+UBAfFGEIuxOeX/1qPXYLVnyqWZ/76KdZf3sCG7j5H5wMrnA6FGKAFnK4AC0u nQUqkEAqlJAeYk4hAgHRPDtUonVFBEXs6kgUQZIRFZmEXRiAkery5RLXefH/QUq6Uo+IEiQl+UNC DCNSkpCiO4g6LI4SU4lKmqJHLWklKRkTE8my9ydMge96aVppAAmospL9CVBdahn8BBW+w4QPfZAU X6HUNxj0hWYwP23aXja5l09uZjOKqiRnqhY0zgCVp+iDFC1jacumQg03zXBNPbKCSzD00lS8PNWp xBo2rVGHOcu5oK3aCsJckZA8cTNPClMYLLsh6z0t4BuzmMWgGQ4oiOW0oYCIyEMh/pBbCFNc5AgS rm81YHOYEwhGGkI6eYXun/9kkeqq2KLP3qh1DQjt6li3o4XehGBKMtjB1Hiw3wklomAEwBmV10fj GSZ5W1qLxjrGpey5pi1M/+EKXOaSlkMiCmYsw+TNaiazyxymL5L0i8741FPJrMZ7d7IfZnTm3Ult 5ixCU81Mm9pU++GRlTW9VMgiVdWoUY0dpumqAOi7AjCUlZe/3FoFxVrBs74KOsuJjlvPhjZmHliu 6KHbepB1rL3xta/+sZ03BwROc/7nW4PFMGIZ62EFWe7DjOsQR4oYIoVMS17naqJNTsQuj/CTo/wM yUA/uyKPlES0NHpJF1vCo8Z9SUI62YlEicJaKC0JSb/7Sh8lBlArbUlKzBNTHJWCsY/5NjFxmZJc UsOyk8KplY3UKScpOV3C2HRn52vkdjUjGM2cxZNFRS9Kj6aWTZ5sM7jpn/9SOaka7VKmgO61KtIY KJvX9Kyr+dVv1kq1aLJ+bYJrnbSrCEzgWqUthLl6pnh6JTdgqTCvEcZmD2QYLXAaCFoImiHi/tot BI0LAPpAHOUSgiEhoqhz+wyRRPCp2c9yhEXsGglnWVIQHa1kIzrKF+q8+FmkCEWMY0wY72bSRoqG VCi6va1TNkLF2MAmj1YWy6ZKOlyRDvdigDGMyuQUsjZh0ntLnRklnStA6VrSfPU+ZXTnhG88odcu oMEfwfk9mtCYN2p6jm7JcsYXp4Yq4rpZYC6xQl+K3zeYZt1vMAHs8f8Sk2wib2sHo6NMQbBtbXKd G92mSTdRu7Cv+akwtLr/CSDEefhaOJQcQwpkIHjasFrtjLXhIpSBJK54ng3ASIlJBBHSURElAV3d 6mLsbNOuros8bh0GvK2k40koogdjWJB+h+3UKmVJypMJk8e0EW9vbI/NA670rNeU62XKKe0m2Ztg ZsjHwOzMhqJpYZjLSueWj5JePrzNHInv+Yk38gQPX+GdusnYNFI0o7xzoQ3IKVzK19CkWSAuF83o 0+8XmP9dPTEvSKuSq007CF5bCYHlq2CVB1mjbhYDTC2gwD0hB6jO8PAB2zhsbRj5ANJWqxtLLcvq s0Ql3meKREc6GDeARfra7GU/i5B7idYj5nidTIhypSRZ4ydn1DZEpcT+//KzPaS3hUqV7rwVmdSG 7eATJPiSyybzpUVfCFecxIb/KVeevdTiwcz/zEljdBd1IVwENqA8aMZg9EwDcgYGagZnWCBneOAG eiAlnVLPkCAFWmBpSMZhhJkJhiAJmoZntGAzrEBXrYAMfiAN1iBSNANYoZ6joV5Z+dLHFdPridyl qc0RNtPscQfL2U3LDUt77B7vZYDNVUt+UOF/9ECDsIHOsVqG3VDheGGI4NA5mRMYYsgXMp/iYMjh TIsSQV2KeAgcvssc1ksdZt9o3WEd6ggEhAAGPIuS6J2ErBEgstHYqV2TYQlTOI/eRQVHEYbzWA8k fsaXTGLS2MyfWMadCP9QUGGGUEWGJ0IGZoii+5BiJ4qiUM2UZWSiULFiJ3XiUEGG0+DbUHlPnM2U Lc5FdDEPlkiKLV0GKXoSyMgE9EQJqIAbL2oJfclDPeigC+xSD57eozVax4Hc60EHERbYMYkQM5nH XM3NXYVahPlN3+THEmRTs/RADzzBEqwjG5jjO64jN6WDOrIjO7LBPD7BPPZABuzjPPLjP+5jQGZA DuRA4eSAJRxkQjIAA1gCBCzkQz5kEGgDA0ikRDKAD1ykNviAD2jkB/iAR3LBB4QkF4wkFxyBSR7B EQRCEaxkSwYCDqjBEaiBGrAkDsCkTaqBTdqATtrATvakNgiAOqhDFmX/AzsIpToYJTskpVIyZVOy gz+wgzxEpT/IQ1VWpRtU5TQMBhg4AA+gAQ+0QzZo5TRg5VhOw1nKw1mq5TSIpVhOQxScpVjC5Vye JVy+5V2qJV3SJRLAJRK8pV8CZnl8R3lMg2CKh2Ai5mEi5mIy5mJCk2OeB3jwSsoh2DYm09koUwq0 gBAgwch5Zgu8imYuZmGKx3Z0UIABGGqmnjRC4w+O1capysZJUNmM3KVZ2smZXIKBB3jIzdukh8vt Hn9YITm+0BP0QDpY4cx1E3KWIxv0QH4gp3GqYzoaZ3UGZPBVZw4YZ+HwoyVkgHcOZAZAAAQ0pEM+ JEZqg0Wi53pqZHpq/8M7fCQXvIN8coE2iKRIkqRJBoJ+pmRKsmQ4xOR/yiSAAuhN2kBO9qRPJqga aENStoM5+ANSLqVTMmUzsEMzSGUzYOiGYmjPVKVgDMY0tIMDCMFXCkEUCAZbpmVbsiVatqhbqmU7 3CVcyqheToMQ3GhhRgGO8miO9qhf4ihfCmZhEiliFiZhImliMmY0CeanOWlvPqmCmUenjdCBVSba RAF2IMGxJEeWkgBbTYdfes1iHmZpbkd1REd1qKZ/tWabummp8KAbxKmcdtxZkc2rXBCYdlBmYpoS PtM3PqFdDQtfvdBwJic2OWc6cJM5sgE5PCc8Oup/3CM9Rud08mPwCf9kPwJkQaZDeBakJSBkQzYA RDLARJaqRU4kRwYBfKYnfMLnB8znfN5nfubnSfrnSqpkTK4kTaoBgNIkTM5kgR4oDvgksfaksQaC NgglO2CAA0AlU9YDO0RrPTQDtSpltWpoVMqXVXqoWIaoiEZBFLyDEHABDwgBi7bot4qljIroW7ZD uN7lu/plFCCBjPZojdbrX/rovnLmjt4okP5rYwrswCKmky7Y7fUmXTGpYf6Kd2RHeKRAFGhalkrs B0lssAhBxH5pWlVHuOapwJppxKbpxnZsx/bXyaYeo8UpD7Jsb7SsnLpszPIXzHYNWJEADy4HfnFN yLFVx35pZuLmdbj/jSBE5jcyGF7tVcwJp98wKqKm4xJEpz3GY3QuatRiYToqakBq5z4aZOH0QEFy p3eKLUGS6kKm56mWqqq+J0f6AKu66gdow0jiJ62i5EmypN3iahHQZCCEw64WaK/CZLEqaIISbgyo gQtEKzs4gAPUw7RKq7Riaz0sowzKlw264GC4gV+8aDaMqBB4JRqgARjIqOaiqLu+ZQq864yCq71G gb36aOvSqxC0A48iAY/Sa3nEbsAGqRBwZu0GLMEWbO7dHu4hprAIL+4Zb91AKdwAy9vQK9FKbPSi XMQKgsSmgBDUAF+S7PZGQQtsLPCKR/T6rJqqac7SLFihL3C0rPq6/yz7ymybzmlwsOzNgg3Oyu/N cg1+pS/9Tgd+TYcypZXGcof1Eu1uGm1dtcddLUt+7IehNjADP3AJDAQ93uM9siM5OOcSqCNyHqc6 ksMEZ0Cnau1Afu0+gmc6IKQHJGRDli1EuicDfMCpaiQMvy1IkuTc0m1/9meA7q3e/mev5iROAqg3 GKuxDm6CxoANJHEMxEAg3EQ9+ANY1lfjUmsVa6gNWu4HuplqvOu7hiuJagPoogGJZkO4hiXslrEX t67s1u6O7mg7tDEcv3HttvGJ8i4c8+4d53Ht2vEe1zHv0jEdc2bvIi/xFrJ6UNMhK7IiDwvxfhqv pEf3SnILSG/0qv9H9oZr9VZvxYZrDXypxG4myH5HJnts/5qy/pKNzqov/tIvzPrv+rYs+tIpKuvv cdAy/ursb6SvzaKyLdOv/5ryKU/HJZAAMV+C9GqyxJKHJB9w3YRa0hLnO7rjGJhjD1AzNTsnP6YD O26zdGatNkvnpaajNnfnQB5kBkiw2A6kOitkC2OkD0gkPKcn3Hrkq8LqB+AzrN5wDuuwDgeo3h6B DxMoEBfxsRLuQS+xEjOxQoOADSSBE9/DWPCAA5jXPazAPeBSaWjxFqMoGsNuO4xoFHSlGI/xib7r ia6xG89uuJp0S9Pr7AoBifaxG/PujvIxTc90Hg+yTu80T+dxDWD/r09nL1AjwVBvZnsUS1FjrHsU S6gx8l0d8iR3b/WqxzEjshFkbzJfQvUe87GE6zHzMSI35rFs8lZHARhEATHT8izfbC3j8iy7clyn L1zLcl3LqV3Xsv7uMlvrNS//Mi2j8s2qdVoXc1qntVmbdQsIAiInL/KqEDUvgQbrgwa74zQ/Zw+8 IzX3gCXoYwfn43RSZ6f64zwWZA7s46d+Zw6oMKgeJKiyNqgypHkyQDUEgTkEAUbGMNwGAT1/5Efm c0jicEjaan8CNEDHJE36MN8SNOAqqDccdE+igA1Ed3QvMRODQAxc93VjNxMHggDcwz10JQasgDvc gzuY93mbtwus/4ALZEONRIELiHQ2iO58t8N88y6Jfu5MokFM7ygG7Kjoyu59x3QegwHvgsF+X4JP 57FMl6hP77eCQzjvAnVQA/V7FIuEW3gNAPWGb/hmarh8fLh8YO97aLiH6xVSM3ULHMslbOmKu/gl sHiMbyYM1ACM23hXG7aNC8KxVDiFA3J5sDgYwPhhGzN+XQJg63Vbg0GSA3ZbO/mSLzkuM/mT/zUu P3mTRzmW/7JaCwIYdLmN5/hhp/WOH7aK3/iKq3heHXV7RLY7ruM7RnacY7Y7RnbwHeRpa3NAdqpp m7Z3SrBq/7kleEAJrLBrt3YLL2Q1UORFwjAD2LNv+/as4uekD/93Pwc0F/hwEWQ6r8JkOOykThqx cxPudCc0E5u6dZ+6EsQAE2gBEzCBDWiDRmSDNvCAOdSIO7gArtfIru86GLiAA2SDA4iusHcuiRo7 GJeoGqCBfhv7gDM4Vy647O43gzO4uVp7g5trHpvrg/PufqNBDXx7uIP7uKOBEQiBuZs7UJs7DGCv hrd7u7t7iMd7iJO4vNe7XnH4hif4hMc79iZ4ggsBjAf8ubN7kMf4mde4jad7UHt4UQ88jCOBkB/z kh95xcO4kDv5kWN8lkM5x1/5X3d8X4s8x4c8yVO8yFe8kKu8Wq/8xkv8mcP8jQd8jQ98jec73iwB OUCtBu+8nO//Y87n/GaDKgrnQAmkMGePLWt/p6EzvWszJEQGwUJW5G1f5G33dj7j8zxgfUkKN6Z7 fREEdECDvaZrOq+SPRADqA2EA7GKeoJON3THAArE/dwvdBJsd3ZvtxKAgN7zvRKwuhIogRlIgAvY eiCgAQbYeuITPlcy/uIuubCTKBhoQ0xDO7LzwOcuuxSogRTsd7ZP/uVj+7Z7e4Ob6FeOPuiWKLuT NLiDLgygAQwYQbmHe+yDuxHYPlbDfu4bAQzoPu+/Pu/XAI0H//APP40bv4YfP/EL/4cL//Jj9fNf ghFcQo1LP7pT/7lfAu/T+CWgQYJ3f8B/PwxcAg9wP/I//7hj/3/3f3/3j7+NS3zHW3zLp/z8Q7nG 2//Jy3/967/K8z/9+//KA8QlgWAuETRYUCDCgwkJCuSREM0lIREnXqoh0YiRixqNXNJYAyTIEj1K LClx0uTJdCVWnhxpCWZMmTBzzLTJIAgDnTgZaMsZ5F2QD0G0fTA6z8c7ox+UKl1qlMsHLlyOUJ1a 5EgRrFizdg0XqIiasGHD4fCGAy1aGza8rV0bA4UNFHNtJLEB9+7dGDGSxGASQwkIwHwDKzF8GPFh FoZtmDOHQZsaHhIkOKhM2XJmHg60dUPjgIc2bZvRjH7HIzQaHmjeoVHz+tBr1ah5BBKyuvZE1Wh4 9/YNw3dv4P9ogBcnbhxGcRhGli8n/lz5cenJqVe3fj15GhjauW+HMcz7diNpMpY3fz4jDI/mPRIn n9Fj/I7zjUREU9858PP351+K2NG/+B4CUCBCCDIQIUIKAkPBBRHCxUEIwTCIwoMmdPDCCSt0EMOD FGwooRAvgbDB+C4hxAgwOopIvhbhKy++99Ar76QttijhxhtxtDHHHIP4ySZLgIwJp5zmKTKIeYRK UqgP5pnHSSehXEoDo3SY50odrCxCB6261ArML48IZ8wiyirLLBzONGutuOZ6E5w330wChThsiGOu JPTUUwm++upTiSQS0wIxLwxbjAVEDzUsEB/MkYALNQKhbLL/SiVAbTTULs10tdF8ay2QQNAI5DU1 VAAhNjWCW5W34VqFDjrriDMjueOwow4NWnW9lVfr0tAuOSlgEDa7Yrf7FVlkj/VuPGSbHQ/a98wg z4yMCFmuWhimNaJabo0g5L5AvM3oPuyIK+++cMvDJSMejGD3W9XAddddEuu9JJCHeJiXENT8Y/ch NNjF5T5631Xt4ITrNWLhhQd+l+F+3z1x34r7vfgSfS8u+Ft3wY03XvJQLO/acaNNgxAZjViC5ZZd ftnlHshZYmaaWZ655pttlnnnJdJhWWY2YIaZZ5uX4DnnoZVeWueXa3665aSZnppqpXs4Wuol9AE6 5pavxprr/65xFlrpmX8Geuavve666rbdfhvuuOWOexG54VmibrWnvrvotfXOOmqX656bbauZ/lpv uAEvG2i1r/75ca6vnvzooyOfvIerycHcZ8sjxzpzmTPv/OfSG7d8c8uNTj3qyH9OXXPRYbcZ58sr h5zm2FkPPPehL6cceOArH/11yocXfnPONy9edchTN3100itPvnOTPBfd+utD3z5tnjPvXnPtQ1d9 dNZr5j737Uf/+2vz23dccuP17rskqzmnvCSoOy8JcZfTtr5+VytJ/XpHPK7xD3Pqo9zs7lc5BwqQ ZQGsXElwxz+bSfB3EDzb+7x2vpeFzoMPJJ/PnFBCJ5zACf8VOKEJWdjCEqIQhS+UoQlPUAEYqjCG K4QhDXVowxKqkIY7XKETOuBCFPoQhUWU4QmEyMMd5nCIM2SiCoGowygaUYpE1GIRlZjCJQ4RiDGs 4gtjmMMnerGGOEyhEM3owyiWsQJxVOMJqShHO8oxjTbEox1XeEc/yjGLKcQjHf84xjeSkYc//CEU +DhDR0KxhXGEwhDLSMklGpKHahQjGoPoxTfiEIh/7CQbXdhHK+ZQk1S8IiQJyUcoNhGMLGRkHCuZ yE2ewHrqW8TPBig+BaqvlwP8ZeaCCcBhApMkxizmMk2yvZGgJJgkSSYzoynNZT4TgNlcJjG12c2R TNObAKT/ZjjHSc1jhm6X21sE/xaRukVkbp3W28IS5jlPBO7yaO+EZ/LwGc1ewnMluexBO4fpz3Ha M5/lJCc9BdpPcTazmAit5jm3twVd/syi6sRoQhmKzV5KVJ4DFSZFHapQk4KzJAgF6Uo76s0d8ahH MJXpTGlaU5vK9KU31amNcNTTm+Z0p0Hl6VBjOtSe+nRHQBUqTZUq1KYu1ak4TaoljPrUmb4Uq1Qt 6k+ZClWr4hSqO/1qWMnKo6cCtUZldUlUy9pWt/L0AXGV6wM2ENe60nWuedWrXfl61732Fa+B/ate 61pYvBoWsYclrGL9mljDMpavkFXsZO9aWbk6lrKXDWxi/zcLWcx+FrCcHWxkPVta0Eo2sqd9rGVF m1fOqta0pZUta2P72smOdq+0Ta1kV8vb3fr1r/ao7W+HO9vQFreuLqnRUZW73Bz59Lk6whFJnItU HVm0uda96nOzWyPqKhe7SJ3uWqsbXepet7veve53sYte5pbXp991bg+kO97lHlW66wRvc/NrXfpa 16oAtuh66xte8UZ3C8qoL3ldss7oAnhH/0VwVe3LX/GWQL/zNe+DbSThC3sXvBL2cIcnzFXujkPA 8e1vijnM4q6CuMLKdfCA3+tg/7YYwymO8UmCkIUeZwHIQO7xkINcZCMfucg/RrKQg0zkJSOZyFH2 MZOdPP/lIw8Zyz6WMpW1POUtWxnMXN6ylJ38ZS5TOctOnoeX2SzlNVe5zU+W85ybHOcfw7nOVn5z nM+c5yuDOc1kBvKa2VxnJQu60H0es6GtrGQ6J1nLGliyo4O8Z0Ff+tF3ZnSc9+xlIls6zIIG9Zej vIUgmBrVp1Z1qk0dhBL8aAtCOrWsWb3qH73a1bC2da1b/WohxVrXvN71sE2N61YLG9nEVnaymb1s Zze71sZ+drCdrWoh+TrX04a2sp/9a20TW9bS3jaqvT3ub5s72bm+dhDWvW5b5/rV0C73uVWdbWCL +9v03ra+g/CAeNw1HoMNeMD9LVeCF5zgBx94XBM+WoL/F6HhDcftxBlecIpffK8EB+7BMT7xgAMX 4wvHrcgtnnGEV3zhEld5xTvOcY7P9eUGz6vCWS7xjstcrzGnuM5vLvOI1xzlQQe6xRNeV56PnOg+ Z7nHS27ypuNc6UfP+QM0wPC7FsHfWI8H1gurAYADHOt09XpcuR7ZfzNc62nHq8QtqwG1//vjcN/A 2eUud5irfe5zf8Db3653veP95Gc3Ot+zXvit+zvvdC/7wAn/d8QLnq9w33vhKwv5w0t+45aVa9jL bvTeXp7whx/8Yete+cSvPe9kl2zYPS95rge88YYv++RBL/vCr13riR997WsP8M5OHvi6hTziIw9y 3od+//ZgD6zlGz/8vtP96o8vrN0fi3zKa2DsuxVsYeMgAhHEIbMb6K346Up+8v++sOl37PiHi1jx n5+2mpe/bw/7ftii/7jjn/8D7AFa/+e/tt6PseAvtP4P/8LPs9av/BCQ/Tir/zILAnvrAOMPubRP /ejvs8xvAd1vA/fPAzuwr+4PszprBG2r/LovDsDhsSAQr0wpjgQJBisACpzhAXoM+8BhB7xIlAqp hmooBuuIloKwkIBwCItQj46ICF9QCetIkPzoB/coj+7oB6ewCJswCmGwlYxwB7VwCKMwCJ9wj7SQ CgGJC7uQjwqpCXcwDZnwDIlwDJsQDLnwDe/IC9nQDP/zqA7rcA7tkA7XsA750AmXkAwH0Y7SiJFs EPtEQA5CaRB10AnSr/wE8ADqSgS6bB7cLh4O4AAMwf4isRMF0Pwmsa4m8QFEsRQ34AA80fzIbxJb ERVR8RRdMRVTcRVjMRJN8RVJURZf0f5YUfxm8RTtbxZhcRdjMRePMRiLURd7kReZ8RdX0Rl7URRF MRSZMRKvERSd0RWD8RSvERdh8RU3cBlH8ROtURt/URW5kRq5MRvJERxNkRqFkRh5cRjd8Rt9sRxV sRf10RnTER7RMRxJsR2D8RmF0RbvMRtlkSDfbxrrChziYAuCTAM+bgPAQQTKrx47ULhUkCMfgCM3 YAb/fiQLLpHgJhEcwMEQUvEjwcEjPbIiXRIc7KEjV7IiK1ITbVITc1ImcTIne9Inf/ImOVImYdIn ZRIogXIoOTInaxIcjtIpedIpjxImbTIpX5Ilr7IlZ5IqsRIrc7IUfRIqe9IoD6Aqm5IszfIorZIp w5In1VIpwRItNXEnuTIse5IpiVIur3ItldIoxzIv8TIqf9IqkVIv4zIvk/IoZTIpv1IstZImCxMn 53IvrTIrGZMwodIvA9MuT3LKLrHq3u8hL3Ip+VIFvU7kGk4EfswzGfIATtIi9S7pThPnaG7pYm4D qk7qBmvjVE/nbvPifK/kbO7ictPhWM43Vy7pnk44/5Eutz4zOcWOOYNz6mZz6WDOtXAz8IqzOukK OQvON32Tr7RuO3dON8cTr3SA9v7qNmEzt4YOOTUuObtz4o5zrsDz5ipxJLFPK+jqJGXyJK3TrqoO +7CP6nATOxGxCMixNe0hDvYB/PyNQONBQBmu6nQgQqsOQg2UQqkOQiUUQgt0IgdUQkOUREe0QwV0 QA1UQj10RVUU+1hURAt0QwlUQ1vURkMUREd0RHH0Rj2URmsUSD+UQE90Q1cU4YIUSGHUQJf0RFsU RzP0Qz/UR6UURTkURotUQyfURXX0QinURH0UQ8GUR0n0R7G0RF8UTZt0ST1UTUN0R9X0TQNvSbO0 Sv+7NEVlFEyh1EbhlE5hlEuJ1EnjIQ6UZDXpaiO9ARy0oPtalEJDdANkMhxk0hs0MRxQMkkmsvyE 8iTrpPsoVQVbM1LDIRwOoFIllVRbExVjclR7slKZklQ5ElERtTW9YVTBQVTBYVIrlVQnlVRLFVdV lVJPVQVHtVWbslRFVRN/NVntYVV9NVRfdQNEVVpPtVYl1VibEleJVSmJtVJjNSZptTWDdVp19VeZ lVpbtVJrNSdrNVXb9VM/VVsrEllx9VWZlViDlV6LdTJRVSjH1VntlV9REVpXElEBllpndUHnFRVv NVrrdSWtlV2x1VSBlV/t1VbTFWG5VVjl9TGF1Vz/FxRew/VWEVVg1/Vhb9VarZVXSzVWE3ZZbXVW a1VXe7VXI7YiIfVg85Va31JV4yAI9PPfcjImT9JBU1BXmRJcNcBClTZFsS8OcBQV+09VTzIFuw9E U3Rpm1ZrsS9rt9ZrvxZsmzZru/Zqv7ZrtfZsl/ZstZRDB3Rtw7ZsudZr2xZtw9Zut3ZH7TZr6dZr 83Zr31Zt77Zu73Rw9VZswbZr1/ZtCZdv79ZCQXRxBVdCx9ZtvTZtsVZwGzdEI/dubxNHTVJeEbVq uw9sYQ/2Jo/rsA80mTIcEPUhFSEO6grrIM7v/q0I3O52N4B2MW929670IM539w4Tgxd4dTd4jff0 /4C3d5eXrmbX9RDv70y3eYk37lIv7rgTe5UX9tzOd2uXO/+Oe5nXe29XeSdPd+VOeY3Xec+XfT+u /H5XeE/Pe9XX7rrXduvusJz3eO8373SPdoH332QXdQc4gAtYgJPX9Uz3fIVXe+1XgHdXfb3z4yAY gg14go+3f+GX63aXN8FXeb1Ofxt4gZ9XhOcXeInXfJl3fS/4aZU2U+2BX6k2DhRBEfKOg3W3FUez Jvv3UW+2KV33dVOwLkfTJDXTiFk1WJO1ZFH1KT9VJ6nSJ1cVieFyiY/4VKcYdOOyWamYJoFSKWtS LqOyio9Sip1San9Sip24J9XYKSOVja04MKVW/P8+somHWIzf+CfxOIevGI7Bcl1h+ClJFZDXFSht ci2PeIvRGI4jFYzl2DCZGCQ/7oyJ1VofMg5SMopvcoljkizD1SFvVlQr8lfjYIZFICZ5cmabEobf El8D9pEJmZXzmCenNolVeWon0zBfWV2F0ifRklzzmI9f9Syh0izNUld3EpmBdYtPFma9uGLLGJjD NZgH1lNlOZeHWF3d+GP7OIqxtVhheJXNtZhB9ozbuJdBOSo5eY35lZDN2ZlZdWZreVvXeZ15WTFZ OY3fmY/fMmKBeWihmFlzmVk5cY4flV8r1ZJneAamGVt7kJZ6aAZWUlQhVSZHdwZa6Ygc+oYe+ob/ HHqQKskH0yikXwiU9AiJTpqOnkgI96iPdkiNjvCjQSmkj5Cke4iQNroH10inc3qmTwmUnGAGAEmj qegcZPqjBamoZ3qji5qOMPoLZ5qmPdqlmZqnU/qnZxoKfLCpM3qNYFqTekijW3qrr7qkRZqSZJCr b8iq9WistzqFqBqtu5qtYfoEGEmquzql0cikz8is08iq3bqn+1qu4cinU8mhrQgK3FiUFftXTxJ2 hwCpjfoXBfMARMCHh7ZbZZiGRWApxXiP/XiMufkm7dKKBTYXufm0RduzQ7uQZVEzU/ucSduL2VJo x5i1O5uyZVm1S9u1A/kYd3u3b3u2gbu3A/MZ/0dbuIl7tT87MF2zYLN1aBOahuOgtpfStpWSlPfB NVHANakWHGBXBBThlXHZmu24j8n7tVdStGNZuXWYvbN4L9/bmtPylTezLd+ynI0Yl111jfm7vQXT lvdbvefyvwu8tuVbv5Wyvt2bIxnbwK2YwBHZHiJ6U7ubu09SC8BbiVeyKTF0+eRKA0yZlB8yThyU UxXB+zAV5Ibur4izsUjL6eBz+2Cc41ZcOy0Qx2H8xc2zNqnzA2t8Outz5pTT7HJ8xYXz5WzuAwVL s2DctaCONi3O6Jp8yXe8PZl8sZycxw8Qy19O86zz4Hxvx62czEmrzAXLfSPQrsSvQUe8ahO6+/9g 1z2v9k3RNMTBwUHhHHZRXBFu906vVGv99ELHVE/tnNCdtGm/VEQXndEVnUrd7kcVPUXz9k0rfdB9 dET9XNIztGk5ndMn/UKnlFGVFEQ/fUBLndJPHdFRNG9NPUMlfU4H/dOplEs73dHJFtZNHdSDNNdH fdBV/dLHVGsLHdMNHUnX1Nb/XNZJfUebndFB3UoTfddv0M3rJM9JGQWHvWkfdWR/dVJ/NRS+b8Rh t5RNGVazFVRn1duhm1vzld0x1t1fFVHhfZe9VVZVNbPVPbNp9dxvVWaPdd2PVd3vvWV/tSJb9lgB /pu7tVt7VVO91WJJduANPl9RNl0ZNmHp9Vf/a9Xe1z1VC55kbfUkO37fu51kAZ5XDX7iOV7e0R1m R3bf8Z1eyXnjEzazP37d513mZRZh9d3fYbXl591ls5VhR97j+zViG75c/f2ZZfbolz7h8d1TxVnn CV7k7b3oD15ZvR1kETW8SZncZ7iUOXFoId7bmdZuaRi8pzvFjV1w3x7u355z415u/5buC7drJ9dx MXfawbZAzzZD5/5r/fbuw/Ztdf3t47Zy7f5ygd3wC19w9xZFw1bvC5Tw6x7UBX/x0Z5pr1bzSzfy U3QDppv0vQ8cSLTxMXWF9y7vwrfcw9vxupd+F/h/ZT+FUZd/+xf3aZ922fd/pdf3+bf3bbd7/3/f enUXE/3O+Gvf+A2Y+PR3+m5f/O63+C+Y9ZY/gAk4gsdueYXf+/2ueQ3496u/+qff/Hs3gPXXrpZ/ gHtfhXff+u2X/E9v/fkXf4M/go2/+Nvf/pvXNMMfIDYUibeB4MAHGxDGU/gA4cANBSM+eLhBQ8Ii Eyca3BhxoUCPBB+EFCgS4kaNKB9SzKjx48eWB2M2tCeiZk1wCxsW0aCSoM8HByCCO0A0HNGjSJMe BbdhKNGmTZEaVXqAKTh7VqNSPRAOq9atW6dWBUsWrNavY8uCtVr1K9OlUNkeFXs0LlqqXuUezXtX bTi6YAGrbatXqretdp0mTow0q9OwScMdVv/7uG7hp5UP5FXqmCtlpX/NOrXKNzPVx4qHdr0c2XPS zlQFS8UarvPf2n2LCo1LdDTh3r97x2VqjzPwrLSx2uO9VPhVwLKNDx47lDVXcKStnwad1nHx3vZw X/W6GfhS4sSjc629nK3V1XHDT6+eu3Fr+/Sv/pZrmnrTvPqNp9l47mlGmFamOWVUf2MZFR1svbkX 31ak1ZbWWlH5Zl9tjm0gn3K5OehcU9gtVt2GjwFGnnqCWRgaYfKh1xd24FRQwQk23nijEzviaCOO PvroxAw5BlkBj+fweIITQOroxJBMMpnjjz9KGeWSNiaZ5ZEVnMOll1IuGaSSSB7ZpJEnQHH/o5pN SukkjlbiCAWWbXZJ5ZA5xnmlmXFS2aOfO1ppJ5Jk+ujnknhWCWeXPDoB5qBNOjmonT2WySQUYer4 56Fm8tmpoXASCeSVe1aaqKI6zvkjm3GqmamqUqqq6Z2Rzrpnn3/WCSauuTbaJpFOkkpnn7IaWQGw hk4pZqc6DhsoopZCWoGqcyr5po23ojktokRC9MBbSUG1gWW7CTeuXcKFC65rUE3X2Lj6pdvWfOO6 W9e99r777rlU1XtuVvnCJe+9/M4V1Gn1vhUvhlV991pf4jLFb72DTQxwuwcfjPG8FAcc8L8UF5wx WRhvvC6+9nbs8VPkTrzywwOrJTJSKisl/5TDSpU2rs7YaWZiWjxvjHCHenVW4IU55zdYYQyWZRXR SHOVF3w+N01WcUNhdeB7pQW311hauwZW2LJh9e1i5D1d37tZOwafe2//3NzLZEE94NoPs+XV1nDZ jaHVTg/XVFfM0R2U2idSyBjRhcPVUEIJIfT45Dl5JFJDCy1kEeacX055Q55fHjnkn4fueU6dVw66 6JJLnhDqlre+euetxz767LdfrvrprZPOuuuT9x787ZBrgJDxsIP+Ou2Wk55T5MALD/3kxO/ueUXL 75577coj7zlG2nvPfOnbby+88rOHjjr0tgPPfucVpZ5+8sMLv7779QfPu0XP0577//pbXf/maJe+ 8alPfvN7gAbmoYEGaiAeDnxgBCdIwQZCsIIYjKBIMsjBC07Qgxx04AZDCMILXlCBIJzgCBs4whWG 8IUhdGEEUyjBGtoQhiSsIA1tKEMRpvCEMdyhBXFoQw/SUIFD1KAHe3hCE2JQiDvs4QyfyMIbJpGC KKSiEq/YQQqC0IUudGIGNyhGLFrxg1f0kDe88RxwrNEqbIyjG+coR2/8hY5zxEoc6xjH6+wxj3is Y1XqCI7asFGPdBRkbwgpx//M0ZCG9IwbCRmjPrJnQYwMZCKvwsg3rrGRg/xjeAB5x1HacZCT1GQm +ehHRB4mlW9kj8IoeUc5NsyQgTwkJjVTiUs5uvKRcxzkLnXpxkXOEV60QWUfiylMTTbFk48cJCIr qcpe0jGStUylMt1Im/+IspTHrMowVWlMYuoSldS0oxs5dMhErodD1rRkPK+5Tux4IyAAOy== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image013.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhDAI9AXcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAAAL AjwBgAAAAP///wL/jI+py+0Po5y02ouz3rz7D4bi6AHkiabqyrbuC8cyaM72jef6zvd++QsKh8Si 8eirIZfMpvMJHSqj1Kr1is0yptqu9wsOv7jisvmMTiPI6rb7DTey4/S6/Z6a4/f8vr+h9yc4SOgW WIiYqHh1uOj4CCnUGElZaekyeam5ybmR2QkaKqrwOWp6elmKusqaqNoKG7v3Kltr20Z7q7v7lcv7 CxzlG0xcXDRsnKysg7zs/IwJLT2dRG19PdOMvc0Nod0NHm7wLV6OTW6eLo2u3q7M7h4fDC9fr0tv nx+Lr9+Pyu8vYCiAAgtqImgwYSSEChsqYugw4iCIEivyoWgxYx2M/xo7GvIIUhTHkCTDjCyJUsvJ lCyrrGwJ08nLmDSPzKyJU1LOnXhu8vyJwyfQoTGEEj3KwijSpSeUMn1KA6pULE6nWr1Q9apWCVm3 egX0NSyRrmLLki0b9ixar2rXam3r1ircuFLn0n1q9+7SvHqP8u079C/gn4IH7yxsGCfixDQXM4bp +DHLyJJRUq5M8jJmkJo3d+zsOSPo0BVHk45o+nTD1KoTsm5d8DXsgLJn96ttOx/u3PV2847n+3e7 4MLTES9e7jjycMqXd2vufBv06NemU6dm/fo67ZKzc3fm/fs78YnDky9m/vw89YDTs+fl/v09+Xfj 069l//4+/W7z8/9n5d9//whoFoFiBWigSAl+heCCnTTo4CYQRpgKhVdNaCElGGYIyYYcOuLhhw+J iBeJTIVoIiEopijIiiz64eKLF8kYGI1AxWijHTjmSMeOPMLh448fCVlTkESmYeSRZySpZBlMNmkS lC09KaUXVFapEpaWaVnSlVxa4eWXVIQpJhRklikTmp+pqdGZbCLh5ptyyFkanRLFaadOea62J599 uvYnoIHGNiihhdJ2KKKJ3rYoo43q9iikkfY2KaWVAncpppkOtymnnRr3KaihJjcqqaUydyqqqT63 KqutSvcqrLFWNyuttWJ3K665brcrNHj2msGvwGI1LHjFLiPssRP/JKtsBMw2+8Cz0II17XrVAiPt tQlkq+0B3HYbwLfdiqstudeaWy2606oLLbvNuqssvMfKWyy9w9oLLL696rsrv7n6eyvAtQo8K8Gx Gvwqwq0qvCrDqTp8KsSlSjwqxaFa/CnGnWq8KceZenwpyJWKPCnJkZr8KMqNqrwoy4m6fCjMhco8 KM2B2vwnzn3qvCfPefpsJ9B0Ci0n0W8azSbSaiqNJtNlOi0m1F9KzSXVWlqNJdZVai0l11B63STY Sop9JNlEmi0k2j+qzSPbObptI9w0yi0j3S/azSLeKeptIt8k+i0i4B8KziHhGRpuIeIUKh4h4w46 viDkCUpuIOUEXFouIOb/ac4f5/p5fh/o9IkuH+nvmc4e6uqpfh7r5LkuHuzfAWBC7eHebnvuuO+u e++8/+578MAPL3zxxB9vfPLIL69888w/73z00E8vffXUX2999thvr3331BcAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image014.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhVwAFAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAABW AAQAhwAAAMs2DMs4GMs6Hsw1DMw3F8w5Hco1DMo5Gco5Hc08Is0+KM07Is0+J8o9JM1ALM1EMM1G NM1IOM1MPM1DL85FM85IN85LPM9OP8pAKMpALMpEMc5ENc5IOc5MPc9OQM9SRM9USM9YTM9cUNFe VM9RQ9BUR9BYS9BbT9FeU85RQM5RRM5VSM5ZTM5dUdFiWNFmXNNoXtJhV9JlW85gVdNgWdNkXdNs ZNNwaNN0bNV2btV6dNd+eNNrY9RvZ9Rza9Z6c9d+d9NoYNNxaNN1bNN5cdd9ddeBfNeBe9iEf9eA edeAfdeDgNmHg9mLh9uPiduTjd2Xkd2bld2dmdmIg9qMh9uPityTjt2Xkt6blt6emteCgNeGgtuK htuOituTjtuXk9+bl9+fm9+fn9+hnd+hnt+iouGloeGppeGrqeOvq+Wzr+W1s+W5t+e7uem/veGl ouKppuKsqeOvrOWzsOa2tOa5t+e8uuKmpuKqpuKuquKzrua3s+a3t+a7u+a/u+nAverCv+nDwenF w+vJx+vLye3Nze3Rz+/T0e/V1fHZ1/Hb2fHd2/Pf3erDwerGxOzLyu3Oze7Rz+/U0vDW1fHZ2PHb 2vLd3PPf3urGwurGxurKyurOyu7Ozu7T0+7X0+7X1+7b2/Pb2/Pf3/Pi3/Ph4fPj4/Xl5fXn5/fp 6ffr6/ft7ffv7/nv7/nx8fvz8/v19fv39/v5+f35+f37+/39/f/9/fTi4fTk4/bn5/js7Pjt7fjv 7/nw8Pry8vv09Pz29vz39/z4+Pz5+f36+v77+/78/P79/f7+/v/+/vPi4vfm5vfq6vfu7vv7+//7 +////wECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwj/AAMAGABgAQAIACQA+AAgBIARAF4AiAEA BwAdAHgAYALACQAoAKQAIAMADQA1ANgAcANAEABCAAwBQARAEQBGAEoBOAUgFQBVAFgBcAXgFQBY AGIBmAWAVlMAtQDYAgANAIECBhg0eEChgoULGEqYOIEihYwZMXr4+KEDSBAkSahUsXIFSxYtZeDE kTOHTh07dwA5ekQIUiRJkyhVsnQJ0y1cp3KlUqVrF69evl79ggUsmLBhxGjRKmbs2DFkyaCpvpp1 a9evYceWPZt2bdu3cefWvZt3b9+/gQcXPpx4cePHkSdXvpx5c+fPoUeXPp26KgAEABwA0ACAAwAP AFYATWgBgAYAGwBuACACwAiAJQC4APACAAwAMQDMAMgDYA+APgD8AUAmAGwCQCcAfAJAKACMAoAy ACwDADMTAtBMURgqpZQzADzTIVUgAhAQADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image015.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhVwAFAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAABW AAQAhwAAAMw7H8w4G8w3FM00Bcw6H8w4Gsw2FM01Bco5Hco5FcwzBM4/K849JM0/Ks09JMo9JMo9 IM9NPc9LO89HNc5EMc5DLc5KOs5HNc1EMc1CLc5MPc5INcpEMcpELMpALNBdUdBZTdBXSc9TRc9Q QdBWSc5dUc5ZTM5ZSM5VRM5RQNNnXNNjWdJgVdNmXNJjWdFgVdNoXdNkWc5gVdd8ddZ4cNZ0bNRx adNtZdNrYdZ8ddV4cNV0bNNqYdd9ddN5cdN1bNNxaNNsZNNsYNiDfdeAedeCfd+emN6alNyWkNuS jNuPitqLhtiHgt6dmN2ZlNyVkNuRjNqOidmKhdiGgd+fm9+bl9uXk9uTjtuOituOhteKgteGgN+g nN+in9+moui/vOe7uue4tua2s+Syr+Ovq+Orp+KnpOCjoOi+vOe7uea4teW1suSxruOuq+Kqp+Gn pOa/u+a7t+a3s+Kzs+KuruKuquKqpurDv+nCv+bCv/Pf3vPc2/Lb2vDX1+/W1O/T0u/Qz+zOy+vL yuvIx+vGw/Le3fLc2/Ha2fDX1u/V1O/T0e7QzuzNy+vKyevIxurFwvPf3/Pf2/Pb2+7b1+7X1+7T 0+7Tzu7OzurKyurKxurGxurCwvPg3//+/v/8/P/7+/77+/z6+vz49/z39/v29vvz8/vy8vrw8Pjv 7/ju7vjr6/fr6/fo5/bn5/bk5PTj4/7+/v79/f78/P37+/36+vz5+fz39vz29vv19fry8vrx8fnw 8Pjt7ffq6vbo5/Xm5vXk5PTj4vv7+/v39/vu7vfu7vfm5vPm5vPi4v///wECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwj/AJUJFOjp0ydQoRKKGkWKVClTpk6hSqVq FatWrl7B6rSHTx8/fwAFEjSIUCE8YMKIGUOmjJkzaLocQZJEyRImTYgUoVHDxg0cOVawaAEihIgR JCRMoFDBAoMGAQQMIABAmSdPsWTNmhWKVq1atkbdwpXLlK5dvFT1WuXrF7BgwjoZOoQokaJFjBo5 egQpTxo1a9i0cfMGTkwnT6BEkTKFik4dO3j87OHiBYyiJZBKuIAhgwYHDwoYOICAIFatXL2CFUvW LFq1bN3ClUvXLl69fP0CFkzYcBfEihk7LgJZMg7KljFr5uwZtGjSVaODAjB9GADrxABkNwWgGABj AHwBSzgGIBmASAAmAagE4BKATAA2AdADQA4AOgDsAPgCoAqAKwBkAcAWABgBgA8AAAGAEADEAMAM AJwAQAoAbAAABwB4AAAEACQAwAIBAQA7 ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image016.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhHQIHAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAMAAAAX AgcAgwAAALuZAMyZBMqbBM2aA8yVAM6aA86bA8yRAAECAwECAwECAwECAwECAwECAwECAwSYEAxJ p6346sy37+AnhuRoluippuzqtvArx/Rs1/it5/y+EcCgcEgsGo/IpHLJbDqf0Kh0Sq1ar9isdsvt eomAr3hMLpvP6LR6zW5nw+64fE6v2+/4vBau7/v/gIGCg3p8hIeIiYqLjIIAAAeQkpGUk5aVmJea mZybnp2gn6KhpKOmpainqqmsq66tsK+ysbSztrW4t7q5mREAOx== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image017.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODdhNQAxAHcAACH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACwAAAAANQAxAIeEYylS MRnOrWNzWiGUY1paQhn35pwQCBCtlEqMazrmtWPOnDExKRnWzpSUlGPmlFpaYxmcaymUjELvzmPF lFrOnBDv3u9rSinvnBDOa1KtzlrvWoxrWowQKVKtWowpWoytzhnvGYxrGYytGYwpGYwQaxnOKRnO 3u/OSlKMzlrOWoxKWowQCFKMWowIWoyMzhnOGYxKGYyMGYwIGYwQShnOCBnv3sXvzpSEWhClYxC1 nGNrQhnOrZylOhAQKRCtlBCcOmOtjDHvaxmcEGPW75xrEBkQa1rOKVqcOkLvShmcEEIQSlrOCFqM EBkxCBDvnDGcazrOzlpr797va95ra97v71rva1Jr71qt71rvWq1rWq2t794p794p71rvrd4xKVKt Wq0pWq1rrd6ta94pa95rrVqtrd4prd4prVqt7xnvGa1rGa2tGa0pGa3v7xnvrZxr75zvKd5rKd5r 7xmt75wp75wp7xlrrZytKd4pKd5rrRmtrZwprZwprRkxaxnvKRnO71pK797Oa95Ka95K71qM794I 794I71rOrd5Krd6Ma94Ia95KrVqMrd4Ird4IrVrO7xlK75zOKd5KKd5K7xmM75wI75wI7xlKrZyM Kd4IKd5KrRmMrZwIrZwIrRnO3sXOjJxrzt7vSt5rSt7vSlJrzlqM71rOWq1KWq2tzt4pzt4pzlrv jN4xCFKMWq0IWq1rjN6tSt4pSt5rjFqtjN4pjN4pjFqM7xnOGa1KGa2MGa0IGa3vzhnvjJxrzpzv CN5rCN5rzhmtzpwpzpwpzhlrjJytCN4pCN5rjBmtjJwpjJwpjBkxShnvCBlKzt7OSt5KSt5KzlqM zt4Izt4IzlrOjN5KjN6MSt4ISt5KjFqMjN4IjN4IjFrOzhlKzpzOCN5KCN5KzhmMzpwIzpwIzhlK jJyMCN4ICN5KjBmMjJwIjJwIjBnFaxlrMRCEOhBja0JjSkKMlClja2Mxa1pjKWPvKVpjSmNjCGPF ShmMnAgxSlpjKULvCFpjCEJKEBCtEBkI/wAZBBh4oR3BABcuDFg4IOFAhgAAJFiYIAECBFAkQEmo cCLDhhcGHhh5AOHAAgMfdrwAoCGAHfsGwEvwrqLNjFByTuSoEB4AnxcKoCRZ8gK8AhwD7LiwM+LM AUsbDpAIpabNBC2lgkwYcSsDogo5Ir2wY0BFplixxjQq8ebOhvC4Yk24Y2ndAAW+kkwAT6rCAUhY pk0bAS2Ad1BuQjm8lSVXhwH22dU70uxEn0sluqu4OKe7CzoTM5WgsW1LrnUdhxQILwADJwdgZ8X6 s+HExe4iANA9QONZpon5mo0IgGdCkK4F6vXhxLTErmahuKu747POdxF6DEjcUqJMAEhATv8NG3Qg g9evDxAI3rZiROkBri6OqBsKxokJLoT/yHFngLj7nBcbcwhotF5iCCawkTs6IYAVFDkkhgAFGDGU 0DsXxGQWWw4JFQBsPox00UWk5TRiBBblZB8AQWTAEgILFFhRX2FJlZ9ENBqVHGwjCaCDDhRCEUEQ FEbgDgU6IBCEikEAYCJGiwF13FW2mfVOQ+ed18pIFAjgI4VB6BZBTgLESMECEYyp4ACRWTajmypO 9JNN8DDATIA+nDehDlF0iUAOOzjppZcK6BABO2MO4MSiIyGEXwIEjOjgd3zlF1dy5wkwIgUKPLDY RYMqIAAUMab5wADpkRTfdiPaR0BFC1X/5dg+rrmmgKg+TrAAFF1qioAOotpH6gJB7OoPUQyoaN+S OCWGGFbwvINSgAE0oIC1DUyQQRA83FqmAFEooCQUwLLDDppB1ClbmhrlFIQEBa4n0TvFoWTeDTdY qwAFCUzQQL7X3nCtAvaJy86SiO6AFAPt7AZFEJLap1FNMoVUawAC4CvwhP9OoPHHooqKAKIR+MMw aOzkMCbEkjqooHDMuPaFawZ4u0CXH2tswA07C0ABD15SgMOi7phbGA5jYjThRQMQIAFNGV4cQIz2 CdCAAArgm7W1OnjZLdYCLwCAE/5cUGxnDledZEawBlVnlhTEfYMNO+urQ0EBtNMODmZJ/0BB2O1s hkMO7gTwsG4s9kqhA4nRaO95BhhAtw0836BDAYHj4E4OKgOQQ0QJHNwOAg8gUNgO7jpZMJAXOQAt PK1FFsDkkxsARQA95IBDSnhdgMNuOUAFBdajRhAADsJKEIQCE/yIAOOH9X7nQLXbYMMA7XA+kBPK nfR7mgAMTHDDQkYA46+D6hAcXwkdFbPk1huQQDs9BGCyQMxc+I7rC6W5/NUJSZOSiIQrHyXJJleK 3UB4JjkJZG8H5wlAxaDgAI4pgAemSxOnEIC0xXBKAQsAVhS+5AAJvCo/BWjNazJmAAFk70MSjEeB EPAvHszNctYiFTsEgJUBUsBfIESAqP8O6DqaNAQlmcoXANzRDgZAoGoCYyH8bKADHgBpAVj0nJI4 pbF97UkHTzuhUY7SGoFBoR07CAAAFoCrgFXPADxIgA5soIAn7OpMONOatTSlIJfRyyj2YoYBKECW dgwAAQKYgKgqFz/r2cABBIjcDTJgRxgFIWMei+K+JNCen7gtJTeIQHXeI6oJ8KABtZubAQgAj8id EoRPWNIFYJSxgVkxSS3ZCTwgMJA7KcAd7sDBkiTAvAa00Ho3+ITkEMAAHeRrj+x4ALEiwKku7bF5 PnpVQpAykLjMMpgRWADxBGAACxhABzvjwTl3kIAWahKEB3sAkTTlta75zGUhCYlQkBL/hNzFqJT/ khwqjckDBhTgRx67lcDkiUViIZJCIzSgjBZSqxReIGU5YGO4jGmDBvCAbviCnQ4ckMisKVIHWDzT uMhFofS5jH1vG8gCEGWijMXvaj7iy5cUmTWfxY1YMWKHBMwHqhEeEFZIGUCAGJAyLIIKV3TjARR2 AAEHGKB5v/pXFGcahK6Wzz7AAtpF2raPpCbEXGxkY0DV2VE2DaBrFSRn5K56q7OR7FM+IqGsLgAB e50Vi23c2Q2ApsICJKBLCpDcXG+lgB6sDHwR8Fte7zOVSx1lIBm1ozgNWEUHBEAfAwEAOXnAgwm8 AV/6qkuawCckRPrqacKBjFBycC4K/xApqw2AAgPg4YACvKNAqqTbzry4N5aICSdeUt9gQBI7ySyp WF271QV8AA8CqO+D6IyfYCfwkjS5YyoOgxiQHECRxlyAGQXYwbnYiKu3XUACPyJnYnmmXYFVp3zF WRmoXLaQmSgEKWn0RzjryMZ4xMawiDTlOSXHQOFCwR+BWu1uNMIyly0GJEiJnROEyUYYvUYhStLB 1TpqzMix8AYG+R19xvSwJTlIJ/kRi3lKEs4lJYABF8gBjEiaL56x9QZviFwC/NEwUUqEXSZCEWwj EpJLmccJ7fBfOy4wpFsh8gYnpm/kKOAEpYgpAgNY7ZASM1TuHDElrQnRAXIQpiGlVRxciTwlIyWn gA8xAGm7SdSEEzNMJ0EtKAYdSEAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image018.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhCABZAXcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAAAG AFcBgAAAAAAAAAItjI+py+0Po5y02ouz3rz7D4biSJbmiabqyrbuC8fyTNf2jef6zvf+DwwKh64C ADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/master04_image019.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhCABcAXcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAAAH AFsBgAAAAAAAAAKtRIyhe+xs3osSVkdv0ypfX4GSOHGduXEkhq6W6S7xCbd2jau3nmtz6tsFex9h kRgyJpEjZZNZgrKkL551eD1ml9tnN/qdhqvYstbMRXvVYLbYTT7L0/N1vX1/5+P0vt2PB6gnyPdn GHg4mFiI2KjoyPgoGUkp4wRpSZU5tgnXufdJGLo4iknDeeqZCroq2kr6agrEOutaC3sr+7N7OVnq GwucK8yrGVx5/ItcWwAAOw== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0308_image020.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlh4wEyAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADi ATEAgAAAAP//mQL/RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq4u2sbvLNf0bef4rvf87wt+hESg sYg8KpPMpbMJVTwAEOq0ir1qGVZu1rtddMVfchgxRpfV50PavYa3qXH6/G0H6817dl/+l8c36EcI aChYqHi4mMj46BiJ1xVV+XRpmYm5qdnJefnpKRpKOmpainqao5rayvrqGgs7uwM5WXd7h7ur2xuY +8sb7IsIXCx8TNxovIzcrGzrHA0tiSt7TZuNva3dXeoNzi0eTj5uDlKefr6u3s5OSs08PUyfXP98 P2+/j8+v3w/wn8Bq8aQRzHfQX8KACwG5e/gOosSIFEtUvDgxI8aN/xrxcPzYEaTIkJ4GymuI8qRK gysLukTYEibLmS8VxrRJU2ZNhiRH+uwJ9CePoESFFj1qdEpSpEyXOu2502ROnFFTTuV5VWrVm1i3 ZrXqNaxOj03LPj1rlhXatWnZuu3WNu7buXKTaB1LFW9XvXfz+t37ty/gwYILg+V7ODBZuozrNn7M wrFkyJQnc7BcOTNmzGIVczX8OTFh0aC/hj5tOnXn0ah9bdYM+3Xb2LRl12ZrO/dt3RNLr/aNuHVw 1cN/kz4u3DNx5Vt3O+f9HCP06dGpZ7NePTv2U8aTs17+vTt44MyLmy+PPvzY7drbs7fkPv57+U/m 26d/XwZ59en3+1hHPh6A4g14Hn8G/qcSfgrmt+AJDD7YIIQUSBhhhRQaQGB/AhaIYIDedZjhgRtq +OGGF1qIIoMprnjiey2yCCN1IHI4oogl3uhhjiHOSKKONL4IZIy7AVAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0346.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]>
= Reasoning about the semantics of spatial data is critical for their interpretation.
= The semantics of spatial data includes the contexts in which such data have been collected and intended to be used.
= Ontology has been considered as the backbone for automatically reasoning ab= out data semantics.   
Introduction
3
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0346_image021.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlh4wEyAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADi ATEAgAAAAP//mQL/RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq4u2sbvLNf0bef4rvf87wt+hESg sYg8KpPMpbMJVTwAEOq0ir1qGVZu1rtddMVfchgxRpfV50PavYa3qXH6/G0H6817dl/+l8c36EcI aChYqHi4mMj46BiJ1xVV+XRpmYm5qdnJefnpKRpKOmpainqao5rayvrqGgs7uwM5WXd7h7ur2xuY +8sb7IsIXCx8TNxovIzcrGzrHA0tiSt7TZuNva3dXeoNzi0eTj5uDlKefr6u3s5OSs08PUyfXP98 P2+/j8+v3w/wn8Bq8aQRzHfQX8KACwG5e/gOosSIFEtUvDgxI8aN/xrxcPzYEaTIkJ4GymuI8qRK gysLukTYEibLmS8VxrRJU2ZNhiRH+uwJ9CePoESFFj1qdEpSpEyXOu2502ROnFFTTuV5VWrVm1i3 ZrXqNaxOj03LPj1rlhXatWnZuu3WNu7buXKTaB1LFW9XvXfz+t37ty/gwYILg+V7ODBZuozrNn7M wrFkyJQnc7BcOTNmzGIVczX8OTFh0aC/hj5tOnXn0ah9bdYM+3Xb2LRl12ZrO/dt3RNLr/aNuHVw 1cN/kz4u3DNx5Vt3O+f9HCP06dGpZ7NePTv2U8aTs17+vTt44MyLmy+PPvzY7drbs7fkPv57+U/m 26d/XwZ59en3+1hHPh6A4g14Hn8G/qcSfgrmt+AJDD7YIIQUSBhhhRQaQGB/AhaIYIDedZjhgRtq +OGGF1qIIoMprnjiey2yCCN1IHI4oogl3uhhjiHOSKKONL4IZIy7AVAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0347.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]> 3D"MCj04344110000[1]"
In different context= s, ontologies may refer to different interpreta= tions.
Context= A
Context= B
A
B
A
B
=
A
B
A
B
« Conta= in »
= 3;
4
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0347_image022.wmz Content-Transfer-Encoding: base64 Content-Type: image/x-wmz H4sIAAAAAAAEC5ycB3xURdS3F2aQrmJBRSkixQoIiKBIJ3RCCzWEJCSAFKkCKghIR7qA9J5KDYTe i0AoKfTeCQRICPXORYT3mbt32cDuq+/3+fv93d27d+8989wzM+ecmXDi0J6ZDsfDzIOMh3KbWSiT g//uBmRyZHc4RItS/M/xemZ9TCKRKZsjC6859dmZ9btcmatkdmTW372SKbMjK69POPvZM95Yv/iC 62Xj/WPrbH3UdTyTYxLvy2fJ5PBxfCy3GloV5TajkdxptJd7jR9lvDFCnjD+lJeNcJlmxMq/jR0y hzok86nj8nN1QVZSybKxuilDVar8Wd2REy2lyjCObeS7eM65xLn3+U0Wc4d824yVRcxw+aX5p/zO HCFrmz/KxmZ72dJsJNuaFWWg+bEMsvQW7x0cSxUtzTOisRknapsbxHdmtPjSnC2KmBPE2+ZQkcX8 SdxXPcUl1VnEq1CxUQWLMBUkJloKFj9zLJTvGnNOJfWT+FwNFfnUBJFDzRZ/G9EizdggLhtx4oRx RsQbqWKv4aDtb8HAxcOD62M3v8wW33T4ujkWl5sNrYpyi+ErdxjBcg8cD8HxOBwvwjEVjo/hmB0m 76kT8jMYfQerRuoWHNPkTzCcYClNLubYBr47ZHE84ZVjpeccg+Hoa3MsLoNNrTfh+Ey0NW/D8TQc 98FxvahkRsJxJhzHwfE3OPaHY3c4fi8OqRCxAX6LVaCYYClI/MSxUL5rxDnfqf7iM/WbeE+NE9nV TPHYiBSpxnpx0dgnjhunxSHjtthjPBM7jDdh4OLhwfGem6PTH9Px3owcN/HbTca3sPTleQTL3UYf eQCOR+F4AY634GjCMRsc34XjpzCqaHMMsTmOh+N43v8Xx9L4o5NjH/zRyTHA/BZfdHF8g/dPRYB5 C46n4LgXjuvgGCFKmzPgOBaOg+HYF44/wLEjHIPh2A6OAWK8pXZwDBYhfNeIcyqqvuJTNVi8q8aK bGqGMI0IcctYJy4Ye8VR45Q4YNwSu42nYpvxhuVTTh4eHFPdHL35YzG5wdD6Rm40GvI8guUuOO6H 4xFjmjwPx5twVHDMCsd34PgJHL+Foy++1x52/S2GTo6LMvjjRc59uV+XNqdZHOuYfWQTOLYyG8oA 8xvYFcMXtfLw/h843hStzJOiiblH1DHXwDEcjtPh+DscB8HxRzh2FRdVBzgGwbGtWKT84ajVVvTn WHu+8+Wcb9WP4hM1SLyjfhdZ1XShjHBx01gjzht7xBHjpNhv3BS7jH/EFiMPDFw8PDjecHP05o9F 5XpD6xtYNuR5BNG3+8h9cEyC41k43oDjIzhmgWNe2BRXF+U3cGwIs2AY9lPpcpylO1JzXM93hzjn vzkGPecYbBaV7S3lgeUTOKbA8QQc/4JjLBzD4DgNjqPhOBCOveHYBY4hcGwn1sNvkWojxlnyF/04 Fsx3DTnnG9VbFFcDRV41WmRR08QjI0zQJnHW+EskGSfEPiOFPv1EbIbjBouF5uHB8Yqbozd/LCLX GloV5DqjAc8jSG6H415juEyE4xk4XofjQzhKOL4Nx2IwqqCuywbqtgx6ieNCjq3nu4MZOMoM84z2 x8rmcOn0xyDZ2mwg25kVYFcEjlqvWxzbmTdEa/MYHHfDcbWobC6C41Q4joLjACHNXnD8Ho7B4iD+ t161FgtVKzhqtYZjWxHEdw04p4LqJYqpAeJtNUpINVU8NBaJ68ZqccbYLRKNY8wxN8R2OG40XoeB i4cHx/Nujt78sYiM5bexcFwDxw1GIHN3b/kXHOPheAqOyXB8AEcBx7fgWBRG5WFV3+bYF18ca+mO 1BzX/R841jV7y6Zm4HOOmmGIpddg+bdoZ16H41HR1Nwl6pqr4LgQjn/AcQQcf4ZjDzh2gmMQHP3F OvgtVC3EWEutRF+OBfFdfc4pr3qIoupn8ZYaIYT6QzwwFopkY5U4Zexirj4q/jKui63G32KD8RoM XDw8OJ5yc/Tmjx/J1YZWeVjW53kE0rd7M9cMZ86eJk/C8Soc78ExMxzfUCdlETh+Dat6MAvEH3+E 4e+WXuZ40hofXf5YlLinjO2Pbo71mZ/Lw+4jOGq9yvvHItBMhuMROO6A40o4LhBlzMmiqDkcjj/B sTscO8CxHRxbw7EFHJuL3y21ED9yLJDv6nHO18zZRYh93lDDRWY1WdwzFoirxkpx0tjBXH2EOSaZ Pv1YrDNehYGLhwfHJDdHb/5YWMYYWl/LVXBcC8dNcNwJxwNwPG6EyStwvAtHBxzzwPEjOJaDY104 toPfj+ouHLXS5QLbHw9wzgXOvcdv3BzDPDi2MTXHr2FXWIZays17E47XRBvzMBy3w3EFHOfBcRIc h8KxHxy7iXuMfxfovwdUSzj6iQWqGRy1/ODYUrTju7qcU051Ex+pfiIPMaRDTRJ3jXniirGCmGc7 c/VhsdO4JjYZplhr5IaBi4cHx4Nujt78sbBcyW9XwjHGqMfzaEff7sVcM4w5e6o8BsfLcEw3dspn xiH5OmwKq0vyK3VD1iEGD4BdHxiOsaQ5psq1fHeAc9wcd1pxeFFTc5wqq5jDZD2zl2xmtpNtzHrM z1/jh26OIaYSQeZVOCaJZuY2Uc9cLqqYc+E4AY6/wbEvHLvCsT0c/eHYQqyF3wLVRIyx1Ez04VgA 39XhnK+YswsT+7xODPnMmCDSjbnE4MvFMWMbc3USc8xV+rQSsXDUPuXk4cFxr5ujN3/8UC43tMrJ FXBcBcf1cNwGx31wPArHi3BMg+NTI16+BscPYVQWVrVh1haOvTNwnO/BMR5//N85+lscy8HxQ/xR KxfvDTheEf5mIhy3wnEZHOfAcTwcB8OxDxw7wzEIjq3h6AfHJmK+agxHrSaiN8fa8l1tzilLXvOh 6iNeI4Z8aownl5lDDL6M2HErc3UiceMVsd4wxCojFwxcPDw47nRz9OaPheRSQ6ucXGbU5XkE0Ld7 MdcMY86eKg/D8QIcU+H4DxxfhWMhOJZ5ieNoWI6Gqea45gV//DeOAdLfrIs/loNfIdnBUk7eP4Lj ZTgmwHELHJfCcRYcx8FxEBx7w7ETHAPh2AqOTcUa1QiOvmK0pUZwbArHVnAMFGWYawoR+7xKDPmP MY5cZhYx+FJx2NjCXJ3AHHOZPv1IxBg5YeDi4cFxi5ujN38sJJfw2yXGV7Csy/MIYM7qyVwzjPxw KjFkmDwHx9twfALH3HAsCMfSsKoFM3/49VL35ChLd+U8m+P+5/36RY5ln/frntLPdHIMNr/KwDEH 7x+KYPMSHOOFn7kZjtFwnCnKEoMXNX+FY084doRjABxbiP343xr4zVMNxShLvqIXx/z5rhbnlCav KUienVv9Kp4Yv4vbxkxxjhw7ydhMPhjPHHNJrDEeihVGDsunnDw8OK5xc/TmjwVllKFVVkYbdejf AczdPZlrhjJnT5UJcDwLx5twfAzHnHAsAKMv4ehDLtMGjj1f4Jhm+aPmeJ5z7yknx7zUKfT4qDlW NYfK+qaTY1uzDvFiWXyxoOxoKTvvH8DxIjn2IThuFPXNKFGVnLCsOQaOA0ReYh5phsLRX5yn/+7H F9eoBnCsD0etBqInx9rwnQ/nfEnNogCxT05iyMfGGHKZGcTgUSLB2MhcfYg55qJYbTwQy43sMHDx 8OC40s3Rmz8WkJGGVllY1uF5tGWM7MlcM5T8cCoxZBixeKxMgaMJxxzqlMyvLstSKkXWhGNrm+NI WI7k/VyOxfLdfs45z7n/xrG52ZYaRR3mZ82xABy1nBzbmxfgeFA0p9ZTnxpFVfNPOI6C4y9w/AGO IXBsA8dmcPQVsaqemKvqipGW6sHRV7Tmu5qcU4o5Oz95dg71C7n1KJFi/EkMHknsuIF88CBzzAXG xgdiKRyjLBaahwfHJW6O3vyxgAznt+FGGRlh1OZ5tGW+6sFcM5Q5e4o8CMdTcLwBRwXH7LD5AEYl YVXD5thD3YehlptjnBeOxSx/nGL7Yw/p5FgbjmUsjp3g2MnMxvv7or15Ho4H4LgejhFwnAbHkaIY sWNeYh5pBsOxFRybiDj8LxZ+c1UdOGrVFT041prvanBOSfKaD4h9shNDKmMkOeE0YvAIcZCazw7j AHPMebHSuC+ijWwwcPHw4NjbzdGbP+aXiw2tMjIMjlGGP327B3PNUPLDKcSQYcTiseSGO6UBx2xw fB9GJeBYHY6t8MPuMBxh6Z6cY/vjf3FsYGqO/tQonBw7mvlhqJUVn7wHx3Pk2PvhuE40ILeuSk5Y llymGPWyvMQ80gyCY0s4NoZjPTjWFnNULTHCUm3RnWOt+K4655Rgzn6f2Ccb9TPDGEFOOJUYPIzY cR354H7mmHP06XsiysgKAxcPD47/ET+65qevmKvq4Iv+MOxO3WcI88xk5pkF1HxWMs9soZYbJ3Op I4yPZxgfL9Ovr9Ovb8oexN4jLN2Uszm2iu/2cs4Zzk1TcdJhbpGvmytlIXOBLGFOlt+aQ2RNs7v0 hWNz+nUb5pl2zNWBlnLy3iB2vALDJOFL/FiT+PFb4scS5kRRiDj8dbOfcOCTafTXM8Tae2G1irFw Nv14hCU//LEl/tiWfh3C+NiN8bGfyEUc/rcxkXlmLrWe5cwz25hnkqjzXIGlgU/+63yd8O/+WJA5 WqsMMU8t4vDWjI1d8cWBMs4YT/w4h/hxCfHjeuKeXcQ9h5ivjzFfn4XjJfzxKv54TQ6zdFXO5NgK vtvFOcc5N0UxP6l1MqcZLfOZs2Vxcxyx+ABqZ11kLbOVbGj6kGeXhmcB2cJSdt4/Io+5gh8mCh84 fkc+U5p8phj5zLvkhdnp2ya53nXm4WPENTuYS5bRf6fDbqilVqIbx1rihzWIeUoxxxQgv85FXvjE mEzcs4C4ZyU1s+0ijnxmuxWHG8ThOfEjFw8Pf8yQF3ofH1czJqw2SsOwJuNiC3zxe+bqn8mvx7C2 MIO8MJy8cDX5zFbi8L3Ej4lwPA7HM3A8J7up8/I3S+fkn+q0XArDbczTh9UeeVVtlg9VDGsLi+Wb 1HALmaPk52Z/Wc7sSN3HT/qY1chtSsLzffxTK5tswHxdl/ixJhwrwfEr8utPya8LUKfIwxiZ2RxA n+5lrSkk4G+byaOj4DaFOWWQJX/RmWPN+a4adbOSxI75qZvlpt7zD306jXrPJeoUx4yd9O0jzDXX iH0M8uscMNAstDw4Hv93f8xPbUKrFAyrE+/44YsdiMH7UTcbIU8zZycbC+V9Y7nMpDaQX+8kn9lP HJ4Ix6OyJfWfrsQ3Qywdl1Ppy1EqQW5W+1ij2U5uuFamqyXymZonc5uT8MmhxD+9ZUnWZr42G+OX lWU183P6+Xsw1XqF9/cZDy+JinD8ivz6CzgWpt7zDmNkDuqPfxMH3qY2e4b+uh+fXMc8otcUJsJu gKVA0Yl8sBm+WJV5ugR9Oj+5TG7quE+N6eSFYeTXsazNuOo918hpDOpmOWwWmocHx/+o93xAzVGr JLF3VfLBpvhie+aX3tTDfyMGn0jMM4f6YxR1s9XyDfyrsNoNx/1wjIdjouyikuQgS4nyD/pyOAzX qx3EPhsZI1fKmypMmmqGzGqOxSd/lQUYG4sTg5ekFv4Va1zfmJ+y9vWOLSkrMs9UgGNZOH4BxyJm jMhH/fE15uzMxOIPYHINNsfor7vJ+VZR05kPt7Hw1OsJzrWZjqIJc0tl/LYEfTo/Y2NuNR6OM6lT RFDvWStOU8fV9cd91Ht2kl9vheMmi4Xm4cHxzL/74wfkgFolYFiZOk8jfDGIuLEHtZ5BjI1jWZ+Z TsyzmHr4cuqPa6n3bCW/3gXHvbIFPDujgZbiWDfcQ018B7H4JrkH7sdVtLyGL95XU5hvRspc5k/y HbMz/bs1LOvKL6jhlmZtpqz5Nky1BOPnXVGKOPwzOBaB4wfUH98wF4usrCv8zVpVKkwuwCaB/roV n1xGrXYWfjkKnj9a6kgtvLO1xlUJv/2CPp2f2mNuaj3PyK3vkcskE/OctdYVjtO3r1ODVMRA2W0W mocHxwx1XG/j4/vEiVqfE3dXYo5uiC8GkFd3o0//wtg4ijlmCrnMPNZnIqmHx1DHXU+9Zwscd8Bx l/we//zF0k7WuraRY2+SMSpW7lDLZJJazPrCTObt8cw3Qxgn+zB3h8p3zeayIHNMUebqT6jffsY6 4eeWMvE+XRQnDi8Mxw+oP75FPTwH6zPPWOu7z9ppMvPFSdjEUcPZgE9G4nfT4DYM9bLUhZrZD6wp 9GaNS6+5DiF+HEN+PYW62Txxn9z6BjH4edYLj7GuEA/HfXDcDcedFgvNw4NjhnUFb/FjPmrfWp/B sCK1svrkgm2ol31Pn+7H2DiMOWYCufVMYvBFrHMtYV1hFRzXwXGTbA7PTuhnS5upi28ghoyVy/Dd LSqc9YW59O0p8oYaJR+oAYyT3WU2M0jmMZvAsprMz1z9ITWzj1hPcOoZ/O6IgnDMB8c34ZgTjpmJ xZWaxbg4CV8cKZKoOeyC0WpYLYLlZLgNxje7W+pOjaIXNdy+rHENYM11GBzHwfFPkUktpB6+nNxw EzWfOOLIk8Q/N/BJRc0iu81C8/DgmOzu19788T3iG61PYfgNc3QdfLElsXcH+nRvxsZBzDG/M1dP Jbeey7prGOtcS6njxpBfx8JxreyI+ltaQ81nFbHPMhmtIljHni/3qenyGL54WQ3FJ/tJpTrLTMSN 2RkbX2eOeZu5+l3y6nzUwd+39FS8Z6YRa59nbk6A4Q4hWOd6rCJFuprDuPgHvjiGGs9vzNMD6NP9 yGN6sybTUwxEXSz1Inb8kdrjz6zNDGbNdSQcJ8JxJhzDWOdaybrrFmqQBxgjTxH/pOCTCpbZbRaa hwfH/1gvfJfcT+tjxsTyxN21GBf9qE20p093J/7+hbXCEczVE6n1TGc/xXz5MX5WDr/0wef8mEc6 oL6WlpMbLiH2iWCuWcAYOZM4cpJMxBfPqoHyuuol76pQ+ndLmZmxMRvr1rmZq183P5BvUHd06glx 9m2RG47Z4ZjZ3MmYuIY4J0rcUHPFOdapkliH3k3fXotPRsJqBixHw+0n1MlSX9ECX61F3y/PWPoJ 8/T78H+V55BZRZDTrCaG3MZcc4gx8gx18RR80oRlNpuF5uHB8da/++M7xDdaxWFYjv5cg3y6CTXH duSCXeQd+rZJbiPU78SOf5Bbz2T9ej7rM4vhGAHHKBmC+liKJB4Pk1P4fpGaxRj5h9zK7/Ad5pv+ 8pLqKm+pQOacprD0Yd75mvHyE3i+h3/msPVYZGMPQBbyQgccH6udjIlrxU21hLWY+eI4fXM/8+5W fGwlPrkQVlNgOYyc70cUauln4cfxmoyL5TjvY85/n/XWVxkbhYomx14j7rA2k0zN7IJxllz7JjVd E5bZbBaahwfHdDdHb+PjO8Q3WsVgWJb+XI1x0Rdf9KdW1on1rd7kgwPlK2oEseN4aj1T5KewLE8f 98HnmjFmtke9LS0gHp8rJ/H9PM5bpsbRt4fLvxgXE/HFM6ojcXkbeVv5wrIafbysfKKKMma+Q1/P ZstkPrkpnqizwlAJ4i4cb6p14rJaKk4xtsWzHwIfJ2YcI6LxyTn02/EwG0wf74mCLA0k5hlMbj2c NYUxrF1PguMM6uELWXddSs1nHTHkLuaaROLxc/jkLcZJkzknm81C8/DgmGFfirfxMS85i1YR/LA0 /bkK42J95pdW1MBDiBt/YD2hP/WJIfJN+mdBNUF+BqPy9HEffK6Zms1egNnUILVmysHqT+bsP+Qs mEeqkfTtQXK76otPdpVHVbA8p5oTB9XFL78jPi/F3FNYGuotmGaxZYhHKgUfPCvuwDFF7YLhOnFa LaM/LyKXnsW4+Ae+OI7Ye6T4k347Gr/7hT7eDQVYGsI+imHE4KOohY+H41SRj/1RrzE2SrWCHHsj sc9fzDVJ9O3z+OQt6mgmLLPaLDQPD44P/90f36a+qPURDEvRn79jnbUu84sfa1uBxI3MC6o3dccB xDxDyQlHs99sPPsAJsNximyqprIXYCo5ttYU4shJrBuOldNhuFgNlivVT3KT6oFPdiS/8ad/N4al D35ZgTn8c3yzoLyj8sBU8Kr1kPrDDXFLnSG+SaAv74LhenFYLSfOCRPbGOPW0EejiX/m4muTYDkM Zv3g+T1qY2k46/+jiMHHUgufxB6A6XCcB8dI9lOsIsfezJy9l3rFEfr2BXzyNjGQCcusxHouHh4c DTdHb/74FvUcrcL4YUn687eMi7XwxSbM0/706Q6Mjd2ZY/oS8wwklxkqv8AvK8DKB55N8c9A9IOl ccSRY1hjGMEYOYQ48me5hGewljl6mwpi7m5B/64Py6rMO18xXn4Czw9ksnqNOSiTrQfMydfxwdPM KQnMzbvwww2MiSuoR0Swb2KeWA6XRaxDT8cnx8JyECx7EWeH8trC0ijWW39nn9kEaj1T2QMwC47k Q4yxr6hYcuyt7KmIY4w8Sk33Ij6ZCksTv8xqs9A8PDhm2LfnbXx8k3VVrUL44RcwrED+UgNf9KXe 2JI+HczY2Jk5pid79vqTy/xK7fE39vcMh+NI2QSm7VBXSyPYwzdUDqcvT4LhbNWHebsbPhnCOOlP XN5ExqnaMoE+fVR9KU8xNp5V71E3z0Ue/oxaotY9cVYlMxaeJu+LF4lqN364UexUMexxjBQxaoGI IH6ZA5/JxDIjYPkzzH6AZxBqZmksc/UEYsc/qFFMZw/APPbshbPuupx9UuvIDbczZx8gPzxO/HOJ emQqLB8TB70iL1ksNA8PjhnquG5/7I6T6n2kXzkSeT5ax/D30+gC97lK3J9CjJDK87tHPf4Rz/If xmrBXJ2NsTEna9dauZivc9Gvc1Lzyc5+qVeYZzLTr5+KP5QSMy2lEZek4DtXeD3LsePUCRPpk3HM tVq7YLKV7zdQZ4glt1uJfy1jX0k0sWAkeyK0IhjvItkPuoRceSVrVmvFm7DNrbZQ497JmLeHuPAA OZ+rLR4MrM21+qjeW6tf9d7FUJtBKccRrqN1Ep2lvRdZy7nG9VNgn8p+lgfEn48ZZ58x3gpZlbG8 kaVXWOfLQvwsWevLRF98yhjzmD7yiPan014t3fZLvJ4id02i3Vr74bCbOGMbce9GMZy47hfGm570 uQ4869aWltGnVoiKHC9Bez9Sm/GFXexl2EPcsZ8aYAJ2uux+ub3HL+nky9le9zPvZre3rMNlv2St MjN7WR3k+f+Q95n03YfUGNPFu+o2jLXukVMbxOB/E0P+g39qPRVNeQ1QTxhLTcaCR9h/j5plGmve KTxHrUtiAm2eSHsn85ynWtrN+23EBVq7YLQPNgczcNGMNCvNzMVPs9RMNVvNWLPWzJ3snc/h5fYn J+ukydl+9/PuYre/jOMoe+a0EtmDeBCu+/Dt3bR7K+1fT9+LZW/dStq5gn65gn2LWv8/z+X/1Z+y EG9oCZ7LU8YBk5rvffzuNj5/jTH1Es/lHDafsu3XbXi57c/CaabHs69gtz2fQzC+aT22/PNPrjtN XSDOOAnzw/A/gH/+xXi/jRrqRsatNWKTpfXMp1vFCr6LxP/CYLeQvjwPe+Zwjdk8+1n091nWtfX1 X7brcdArz+1yPxM9OOlx6GvHNdbvtS6Rf5wll9P1mkS0n8+7yPG2EFevZd7QWsZcEk6cs4B5eg79 dCZcZsBHaxZM5nMskvErhnlnM3POTnGN2sUlKz4/yhx+mrlHz+daKXyfTtypdZ+4yaDe8Rg9YZx9 xn0c5H6ZiHMyyWu2rnLsGvt8r3PODc5NIfdMYb/BDUt3GZPTyPFvkZu62vQyi2cZ5jZ3/2xssyjm 2EvNUGsfzPczBx9kDkkkLjwitvCctjJGbcUXnErm2E2eURrn3CX+fsBvHvLbRzyrR2KprSiOh/P9 Ys5byPkLmKvmq8vW85vPM5zPdRfQJxZyn8XqEOfu5/nv4/d7uY7LHo92ZIh13M/U3Q7X/R9yrfte 7++8t/v+ixgv9P0j8MMoxoyl2LACaRar+LyG4+v4fgN2bsJezWOLzWMLTLbgi5stHqmck86590Ws Bw+PdjwAvUefqWo/jwKOh9ih9QCb7mFbOv6fSh9Jhtk5W8f4HM93BzlnP+fGYXecZfMqPjvtjsem JOzWNmtbtVJ4btrOe9j5gP7GfgvrXvp+Hnamu+1083bbydo411hKm5123sHO29h17QU7FzN3aDuj YbkU21YgbeMqPsdyfB3fazs3YudmbHRK23mHWsNdzrmPnQ/4net+HnZ63ePutvO+ZeNS2hzN9SK4 rrZzMXYuhKdTx/icwFhziHMOcv4B7nfAsnEVn2M5vpbv1zNmbWQ8dNt5g89ptp33sPM+v3Pdz8PO m//O8x731bqLDenYkoYP33pu5yJsXcQYuBhfjOTZR2PTUmxbgWJsxXJ8Ld9rOzdg5yZ4OnWDz9rO dGqJdzn/Hr9z3c/DzutuO93jhXtMv2vZ6LTzDrbcguc1bNP2OW0M43lqlsvQChRjKxaGaxlXnLZd hJ3WdT6n4rPpnHeX813X97Drqtsutz+67UrHLqeiaWsk/TJMXYXXOVsn+JyEr8a/ZFc8TBK4/1G4 nbJtctq1Hj9x2pWOXa7re9h1yW2XN153uJ9T2q4o7Ap/ya5wnhfrbZwXz33i4aCVgF2Jtl2nYXTR 1nXs1Hbd4Zw7nO+6voddGdYWvPFy/S5NLIF/FGODtitMnbd1ks9HOJ6IXQncJ8GyKYbPq+G4Rh2j 72a0K5nPt+graf9lV4a1IzevL4Go5+a8jjTup3Wbe9+gv155waYInlM091+GHdqWGNjF2rash5FT 2pabHE/le9f1PPiccD83Nx+3HancQ+sW93PaEQ4bp05il7bjMN8ncQ+tI9zvOP59xrZB23KNz9qO 23zvup6HHUfddnjjcZt7aN3kftfx6yu2DdqWU3w+ZttxmHtoue1YBw+ntB0pPLdb1Hpc1/OwI8lt hzceR/it1lGuc4Lnf8a+tr7HNT7fsK9/y2KW0d4IuDml7T2OvUc4x3W9l+0oVGkGhuijX5A36Vf9 N3SNedX+Ucyxgb2tWhupAWymTrqNvwfYRa1vH/WBQ+QzR9hzeIq1Ea0LvL/KHpsUaqqp5HV3qfOz Ls1cUgF9aek+Nda77PFMIza/SQ5yjZxH52Snyc+Osh9HK573ceRBu8nRthPzbSFH20jOvIE8xmXP y+0oExT9vB1unu52bKMNWtuJvXdi025ygL205QBrjAm05yj5wClb58iBLvN3ismsm6XQhlvs0Ugl R00jT0qjHU59yrMtwvcFOC8f5+eF+5u0Iw8+4lQi+/wPkmPuI67/izbsZI/wdmL+baxnuux5uR00 4nk7vD2PvdRXtfbBNI5nckBU4TlUpw0++GNt7l2Hud2pM3w+Tzsv8tyusD/iKvWwZNqfzN8hJJPv OlWSZ/AZ3xdn/irC+YWJuQrBoiC+49RhPidi+yFy1QPU0uJYb9hHG/bCwmXPy+145jUv/5K2Oced E+RjWifxh1Pc/wzXO2frAq+XLJs+wa5itgrDuBBtKYCN+S2d5fU0Np7EZtf1XHa473SITFvrINqP 4niScZBwqiqv1ThenZbVsHSI13iLaDVaXdVWZQhX4vh31rX09Vx3ykqbrL/yzbCLyf3kguwWl3C0 5C9JtXxZYfehGlWZyl55qqRaZdm98CV/kVaCit/ncoj6lNXPT2VvqnpdeA2yFag+4/3nVK0/t19L 8Mpf61Jh9WH1pByVw7KWJpP5T+HYVOmrpsnWlqbKEI51ozrbl2rjIKqLI6kuTqC6OFX9QtVbq4+c RrV7MtXuiZat2l6PdmaoOrl7Wju7nV88b2djfluX69TgepVoq1Z5/hqitPxVlZQ97HYEU70MovoW wHltOL8Flc363L8adpRnBaMsK5OlqTyXosJXiopeadqn21mO1brKqDZqwuc2lsbzV7tjqaCOpo0j uI+z8jeWtk2m6vqnpR7Y0Qn+gdjneiYvt9F7lcXPbuPHju5cQ6sz1w2hjQEZrtWQzzU5rlWVZ1qJ ldcKciDt7KHK0FatijyT2lSamsuaqj2Vyx60qy87UX+hIjyY6vowXkfyeTS7XbTGyBrIz9Joqpsj 2WkwjGrJEPxkIJW5n7hHH2xw2fVye7z3xqp2ewr8n9tThdX4iqzclZcDaE9vS5XgXYcdJM1YtQ+k eqPVmfd9sHEgVdjhtFtrCBWeAVRi+8Lkf7XzPyocpfBRra/x0yo8w3pcqzE2tUABqAMrON04rv34 FyoVQ+ViS7+yOtaP1e8fON6J5xZMf2vD82mG6vO+Ose+wT9c1/fglyGrd/t8Y5tfMUclqspalVld r8IqXDV2GNaQq3jGsVx/LX2Uv2ZiZ5JWKxSAgjnWgVWm7+Vq1YUV0G5yOfYtsRXJ5zCOL8Te+awo z6XqP5uK9Ux81qmmcoZqyPu68PDhu+qcU1UuwIZFli3aHo92ZMjq3WOUux3duL9T7CTh/p25f0fu H8K1A637z8pw/5mMZTN5BrNULXZo1IBxNe5fBeaVZYStaGxaavGo+ZwHfwFi8dBM+KtDiwc70uAU Co9OFo+V3H+5bcsSz3Y8AL0dtbifh9ufu9IOpyJhGAbjRVY7ArGzBfZq+aLafK5p210Vu6tgt1NO u6vzHH14NvWxS9uq1RaF8lw70Z7OrCR0wU7X/Tx4p7vtdPN229kFO52K5FphXHMRPrEA1hntnI2d c7FzPs94ISwXwzTCVhSfl8LeaWcD7PKDo1ZbFMLnjtj5PXZ2xi9d9/OwM0NW741nZ+x0KpJrhVt2 hmJnO+xqgV9o+aI6fPbBzhrYWR07q2GnU1F8XkobluMrMepFO9dg52ravYrrOu103c/DzgxZvTee 32OnU5FcK5y2L+JZvWhnI9jW4ZnXws6atp3VsdOpKGx32lkbWxpil5/17NfAcw1j9WquF8N1V3Af dq3Z9/OwM0NW7+bpzp5dv+vESrO2MwQ7ArCphfXc59A/5tCv58FyEfaEoQhbUdi8FH940TZ/nnMw /LRdnf7Nrqve/NFtVyfGL6ciuVY47XXZpZ/zXOyaS3+fb9lVE7tqYpdTURxbCtcVMGPHuOWHsYxX Trs6cLwjdrmu78Hrktsub7w6YpdTkfiJy675lk3arsa2XbXg5ZPBLh+p7VoCyxX4p7ZLP8/V2LWa 8TSGZ7mc6y2zrx3tOc5kyOrd/ubm1QG7nIrkWuE8g0X4ibZLP8t52MVfFuF/tTleC7t84OVUFJ9d dsU8t6uNbVcIdoXC03V9D14Zsno3ry+B6IyuQ7FLKwSbgiybFnjYVIf+WQt7tGpjSz3u6QsTP4vT KubHVYxDMfiAtsV5PQ87MmT1bj5uO0IsG6K5RoRlhz8sWlh8+EtKXhvwuS521LZsiMB/lsBrOX62 8gU72vFZ2+G6nocdR735j9uO9tjhVARtWszz5y/dbTuaYEMDPms76tAfteq+YIdmEqNaI21HMP7i up6HHUluO7zxqGtdOxLWS7jnMhjodrquv5IxYAWclnGPaFsR3NNlr2bHX/KihthbD39yXe9lOzJm 9W7/aGz7RzFHT3IGrR7sJPqBWK0LeUEndsGEsDsrkNjZX/bnXk415bMvx+vzfR3Oq8X5PvyuJr/3 kS0t1SIGr0PcXp943JdYtamsyu8r4UPfYb9TIcTrHTnehe+7cV4P2QAbmqAWli3anpfbkTGrd/N0 t6Mbv9HqSkzdmV16nYg5Q7ExmJ0o7bDXnxi5pS0/PjfhuC8xaQPOq8f5/EUraotaWqonm/KdL+fU 49nUJj704fc1aEd1rudUMJ9DOd6J7zvT5q6c3002Qy0tW7Q9L7dDe4XzOWRcpXb7Z0d+oxVKbhdM /ByAfa2IqbX84N2E3K0Ru0MakTdoNeF+fuQP/HUK400DS0HYEQrPDvB0Xe9lOzLmAW6ebjs60X6n /LhGC67XEp9wKpjXQI61Iw9px3lONeKYLzY34DynQnntyLFO2Oe6nsuOD6GgR6hXHU1oqVYz1JzW afnxRJrSeq3GqBHZnFZjvM11vutKz7Nur5F5cfs+eRyt+DciurHXpj97tUeQQWqNtFSS9yXJtvjb G7LM2rIVGUAQGXiQKk4ri8paZN1VIFzE42k+68HlPWpm7e17lnSE4x1a8+kBM9j/OJH7jGRP6W/Y MJD9Kj9hTx/Ug2t3Zc+ulj/7gOpArgp0y0t/qgGBli3OTD9IfYh3FED57Vf9/hOYlYRZOVh9B6ea 2N4Q79BeodUR+7vx7zD1IpPuR8Y8gHYORsPQKPZbj8W2Kfz7QrPplS6bPfh6zfar2m0tQOZzi2zj FjacJ6M/rIrJQ6qQ3Msemp3qTfZ05uLvWrKw/+up2MI+g62sI2+n/reX2lmSpVSRQK3/AOti+1gT 38Peg7/Yt/AXe1H2sJdpr8rL/ruC7HX6WJ4gc75o3Uvfz8NOr5njF7adbznelSeV1tvyNHvNzqnc 7O/JjrIiie2Z5Vn2SpxmH8gJbDhs6Zk4yncnseUU559Wb/Dquo7r/p/Zd3jTUYUztapxpWpYWp3d gtX4C5QqMg2r09W37Awuz1/jlpX3LZXjcwWZyvEUnt5V8qUL1u/1NVxXf+7lSdzGI9+pbN87v8Pf 8qDi9KAyjF+V8WYf7l+f6zYmV25OXtsKb26jPsI73qcfv0X/zc33Wq/idXnoq3kZO/JxvMD/9HHu QVVdVxy+sDdQ1GqDSEriMxpQtOLg+IIgREBEQcEU5Qa4iu9HB4EISZlgfcSgVTGCOo51knZsY5s0 03SatjNJ80+nf9Ta2rHqNDE+UBEVRcUH524Q7bf2vUetdsrMN+dw7j7n7LPX2utsLuu3YDiM4lzU Wlh2Jv3PJO6/wkwcj6eKt8Y/6uPKYC+SPKn4kzCZlkn43mjOiucbjhEwFAbx+wv42neZFzH45AC+ 9RCiycvsz7z4DrnX5Ehjk16MewT2CMMOJOnz//47cIN9oYP9e+QFGXgAmvpEkeR59iMnTBiAjjKW fKYXubYwkD4N5luWIbyJhnHv4YxQnO1fGiOTyrcYKcz9Kbbv0v+nR1/G3h39x1FzF8cklk33TNA/ McJ4/b4Zqw9SW+sj9G2/NdH6M/Nt/UcTpj83PepP5q760rRBM5xUX1jQPpu/qD+g+f+d+b36FJ31 IWrqvY/+rQnNej2azFpTp36AnnCBqabW2Rsqk1oAk9CxJ8AQ9ntbatDX1JKbX4fGYZMaZtmMrrMe fec26qPtpD5DE/rZfWoFes8qtDi15mO1EV3OFvO5ajB/Vo3miNprTqh95ozaby4HucaWPC9zT+0x 92mj9U5LjN5hhsIIiA8yWu8y4/QeOxYyHu44FgRHKs7zoq5gZCpQt1SZPrqakXmLyoJ1XHmj8dMT h544areFLDPTrT7g85/T7pe0/4jzfs35n5jhbIXRHEvSh8xk2kzVH5hper/J0rtNtm6ALZYsvZHj dXz+Fu3W0r6K8yo4f43ti/TH7emj+fY/v71+8jlqOLfGDNBvooyoNZFcX+v19PUdLL2V52mAJksP I+rRB/j8p7Q7SPtf4Bkfcv4h8xJbYRTHxvHZBJ4hmbZT9T6TrpvodwNstaRz7ancI1m/Tbsf0v5N zqvhOaptX6Q/Tz+H+O2znnueY+K55WTmxFKVJ9ZcwHvOqj7mazLqj6PqEP5JVvgRlAlHmIBHyGz+ O5nNR8kOF46ToftvVFzfoJ45x/YitJL1fJ02HShf75GR7+da3SjnhB5UNx4UJRoioa+OZgyiePY+ JpHqLSlkpWeiHp1JnBQKyAwu0ueJM2dZX5xmHXKadWOAco5VEivf4PO1+iK0wlXecjf4XvEu7bpo r4ywgOsXo76Yj/pPeB3lWrEeCC/BCONFwSYUo7wqRXW1AOXaAlSBpVTiERagrlyIanWhzmf/+ygH vbQtRc26FN+qxi7rUMpswi71llT9Y+yzA7XCTqLBLuzTZAZDf91oenEsAnuG6e1G0U5xjvBQrTNd qprosNrconqF0E7FqWsojNtUhrlKNZUrarjFtZdrZ6lFOjks1LPZs96Ty7tGmME4CBm8a14hM328 fsjbM8wMQuHcn7GIZNzDGIvQIA9R8/RYG/WjH+GmEyXAbZQAN1CktGHnS9hYOIcq4Gs4zv4/sLVw mDZ/pe2THLY+8xA/CTXHUGecxA+EU/jXWe7TjIrtIlFKuMRzCa0qkYiTEiSLZ53Ds3sZh8WW24xN p1pruc94hTC3/5ttjGWDJUK/R6xoNFHEgVii0VC9lwi1x3wP+D+LZQq2SaV9mt7GPNtiydAbsGmt ySVGFOhySxEVHEqpSLAIxfdiWx01j20ev2fjE+mWMlT3ZaicAyRxbCy+kmBKdJzFhwrNh8JPKNWx +E+0xYdirUz3xU8jzHLmwCrsJKzRBt++w/fk7azaWi01+gK/X/BXs66oYvWyRn+Dn5+yLGNVUsZ+ CceK+KyAOeH6QgR+JoQTQ8J5znD8LVy/awkhjnSrSkunWmluU8lHuElVzXY121zHHsI1bNOGgu4K yvYnuYTfnMemZ7DtV1RfEE6qEAvZuti/Cx9xLEfVPf6PdsdyErXYKXznLFxkX2jFj66irr2J79zF Z/wopARD3Oim+s0DlMwhqNGEMIiEaOLIEPx5NGqgicz1dGJItu7k2Tv4q6HdUkgmfDFxwse4LSJm LCN2rGIrrOF4BWNaydpLqKJtJXFkDfFnNddZxvWExahkyrCPUMIc8up+Zh62e415VEgfhPn0x4vy 0IvycD5KznnElCI90lKMQraEuMIKH7unQTq8ainFj3z4UykVOkuoLuClytI8qizN1qssM3SlyeC9 NVX/CLVyvSUZe04mhiThv8IY/D0OYqEvv/fiM9fubpwYFYz4UawUU7hTCneaRk+z6H225TXqMhZC EXWASzgeIJNtJlEz3SK9d893r/z/35jytbK8adZ6Ap5Xj/U2E3nWE2kqTQdrmhvUomhX+UHS8bYE vG0okSDGtKi+eFhvcw6dnCDedUw9wLO68So/24BXneCNJJzCk85Zj+ogP+IO/7fvxKO6iGYP8CpF hEWIhMf68VxDFAp4Vgz9ed4SyfY5rPkClh2Bbm8CXpXB20TIRuszi1k5lwhbxAwrwXsW4kWC61Xl eFkFn1Uya6vwpAq8sBxvFJagYSvFU4u5bhEeVGj1qlFmbtCLiogMXt5MXqKEUETUmE8EEU9yKeIt 9br1piTsMNkiNnHtIzbzYUMfNRYCFNCmkOv4DH9PmxxWPEIGb640Zn8qK6MUvEqYgldNxHPG40GJ vKnEowZCf/b78EZ7HEUkgtQ/s9Jobm7G1uIVT+aRxIUE3k9DPJWe01hIaGaet2C9y8SINiwiXMfK N7DKTaxyi/l+h/nuEG+EbvAwv4QejovVumhnWLP4seY94o7QwXtLLC6WbyGeNAfvJ/cczJMI8TCO J5rEk8oTu08vIyEjIiPjjpKMmIycjKCP2P94VHM4lvVo1AOzImCNEpTwYiGxlGs12YolxaKudcXS YnGJHeIBAS94jmP9rIeIp4jHuN4jniQeJZ4lHiaeJjFMPM/1whKOeflM8MEiYtpS/gZdzlpqBX8x r2BNsIw1wWJim+Alns3FG+cQQ3NZC+TwXppOf4QcxjqXeJaLJ+axVhJyeY6ZPFcO77YclOnCLJ41 T48jVk2EFEsekSWPqCHMJprMIb7lE9+EOYxlHmuoGcS4V4lxU4hvwnhiXCJrqTGscRN4VwkjsdHL eKNru6cjzthPJeEi4HGBrSg/DnBMVkRxnpc9z6PtmkCu9ijqp0RRzzCWPPP7oS1Od+gFiz/0lOOE /svxh/7N6QqlvnPol46ihlJvanpFUxtNGKQ+duKop5QIk9hPVZ84GdSzmUH9tFnUvxBmU1cknxpM BeSy53O/PHLEc8hLzyB3PAUdbjKkEXpGKOWXPo0kX0iIJy8ontq0I9HgJJDvNEZF+hPRAyWR+y5M VNqfzDlpMI396RzLUeHUMfoWtcp6WWarvtTZioIY6sDFcmwgNaOGUPNomD+TfB0hjbyeZHJtJkIS +4nky4whlyaB/Bm3L+7orns0fjGeVeqgs1596GxQTU6F2gUHnGK1H/ZZSlSj41M7nDK11Vmi3nVW qk1OudrorFUbnFq2wgaO1avNzna1hfpA25wm1UBdlkbqf+2F/Za96mfObu7TyPi+R92l7dT320I9 sE3YoQ7etnzhrKBOmPRpMbp6YSl1CpZT82E1tUgqqKEh1GDrWuxRR/2hddhcqKNeWy22qUFvWhlk NTreZdTgWILd3Ou5Y/DonXaMwXgmpmXZEQrxDPUcJDdJ+BV2/A02+Ux50Jj40cR1oGu4hi7uMjUL L1G/pwXNwyX07K3oHy6jTWijLlI7WuJOyxW0DC2cc4Z6NV9x/AQcZf+w1czeRR8h+tkQdCu97b3c +0p/b4WE2B6K7yvpLj//AW1Su7nEYAAA ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0347_image023.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhOQBAAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAEAAQA4 AD8AhQAAAAAAACA+mTNhqi6wz9bh4/9zAPphBv9wAP+wAP+mAP+9AP+1AP/MAP/PAP/RAP/WAP/Z AP/bAP/eAP/XAP/UAP/jAP/mAP/oAP/rAP/wAP/1AP/3AP/yAP/6AP/tAP/hAP/qAP/nAP/kAObm 5uDg4P///wECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwb/QIBwSBwSCMWkcslsLo9Qp3RKPQqj1KxWid16q92m YTz+FqFh9JLcaDje7XbZi04jleT34wHpQ/YPb2MJWXVqAGFCZHsRERISE5ETj36Cc012d2GLDweQ FhcXGBihFhaRjYEOl09diUQGDnsHtBcZGri4GRmlp6mCmK5WeA0PE7TIG8ocyh0dGhmjpo0QcFN1 eAYNjgcZexu0HuLjHBzOu6YTEX1yUq8AYw4QErQa5Q8e4eP7yrsXpxL6rDLg5BWZeRgO4NvHsKEy aBgAVltlZgyECQk7iCNjoGFDZhAtPIrwoAHBYMPgubmYcKOAl2M8MgQZ7YI6kiaZYFMkD+OB/40G BAwYIKCjTH4bNJCySdJBzlbDYrG053KoiQEkjC6U+ZAUqkAnp0idoGHDRhIDAgS4KiCrh60NESBI Gs1XoKdOLE64oGFc0LRqibqFu0+u4Zoim4YV0+BiBo1V1QYgasJowweGCxQwgIBXYrCLsz2QYIGq OBJXTQQWYIKEOECvPSDQrNlABwReA5YMnUTbaAymPZgwIXQo5QIM98hGMIC2baU2deNdsw0jZA8G hhN/ydrEZkB7DK8VUNsB9M8UmcSLYAHDdeHa43u3vBzB6vLQ/klQLCYW6cf7yBffZn5pBlhz+Hmm TjXTFTHGaBYA6JeAwyFXIHFDdVcZXf8s6P8Ub0M8+F8HHEwooGb7OEDhcA5w6MsfDcJiAITulbgR hQSOoyKFsTyj4Dq7qVcMacCZZaJ2KKaYnQkKKKBdiz52CGSMIc7IHl8b2IidAbTV1pADCuwzBjPP kJIYjCAqEksEez2mpThNHjXOByCEACdI0E2yzofqrTlBhBqQyJAGFFDwgUwfACKCB2TmF92eVKrZ U3uBZjmnojJxIMEDFXxQzjkK7ndXmvBoA8GVRZYYpgcjjGCnnOKUs4GPEb0IVl7FOBLKY1m+CVRM HzV6np5o4upAI3thwGs5Yja7j6zPKOXVJH0EmZcsjoACXAfL+OpXrNDqYuYkuvFp7Kl72RL/KLe9 MhtmOQYwM6tkNXW43x+rLCAWtqTtioszygQs8AYGKNDBWiWUsBRAQAIj1krZtneLBmsF4MzFFytA sXYBjEvJHgNREc8DyJqi7FomlBBALixvPJzC6VCLb6TUyTNPJKBcgHIJu/S8i3wBxEzNHiaRmo0b fDzyJygIdzyKWkCfouc6MNLcZzEkO4KzBSmrjHJ8CUu9H9VwGM1EAPHY7AgkE6wINrlUg2z12Wpp s9Kpa3+9YgnUVFvS3HQHUCrWfTSiN4Uq+122GUKoJaksfEBwuIAqg7w44wA4rkgbejwwuXwqv+FU A4RgnrngVXLuwOdglzA6K4xLJqPdDbj9UnIARZudhezZ2J4yA6YrIRnqwrutcvBL8J484sQjn4Ty z1N+vPPCQ18E6NNT//zw1YOtufbbW585xxyDn/zw6H9ufhPpt//9+ue7/z78TrSPfBAAOx== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0347_image024.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhyQF1AHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAwABQC8 AW4AhwAAAAAAAAgICBQUFA8PDxEREQkJCRUVFQoKCg0NDQ4ODhISEhYWFgQEBBkZGQwMDBAQEBcX FxoaGh0dHRMTExwcHB4eHhgYGAUFBQcHBzMzMysrKyAgIDw8PCMjIyQkJDAwMDg4OD4+Pjo6OjY2 NigoKDIyMi0tLS8vLzU1NS4uLiEhISkpKSUlJU5OTlhYWEVFRUBAQEhISFBQUENDQ1ZWVkxMTF9f X09PT0lJSVVVVV1dXVRUVHZ2dn9/f2JiYmpqant7e2xsbGdnZ3FxcXBwcGhoaG9vb3h4eG5ubmBg YHR0dH19fZd/f4eHh5eXl4CAgIWFhYiIiJqamouLi52dnZKSkoqKioyMjI+Pj46OjpycnJSUlJ+f n4mJiYODg4SEhI2NjZCQkJiYmJWVlZGRkZubm4aGhoKCgp+Xl4GBgaZbW7NYWLBdXaNeXqxjY7KC grWFhamYmL+/v6enp7e3t62tra+vr7a2tqKiorS0tKWlpaqqqqCgoLCwsLu7u6SkpKioqLi4uKmp qaOjo6ysrLy8vLGxsbW1tbq6urm5uaamptQzM9UxMdFCQsdAQNaGhs/Pz9/f38fHx9fX18PDw8LC ws7OzsbGxsDAwNvb28vLy9PT083FxcXFxcjIyMrKyv8AAPwDA/wCAv8YGP8ICO4UFP8QEPgREf4H B/wFBfEQEPsEBP84OP8gIP8wMP8oKOojI/8tLfEiIvtMTP9AQP9QUP9YWP9ISP9VVflaWu1eXvVG Rv5PT/9/f/94eP9wcP9gYP9oaO1tbf+Hh/+Xl/+Pj/+fn/Wdnf+vr/+np/+3t/+/v/+oqOy8vPen p//Pz//Hx//X1//f3//Y2Ofn5+/v7/f39+vr6/Pz8/v7++Pj4//39//n5//v7//g4Ozs7P///wEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwEC AwECAwECAwECAwECAwECAwECAwECAwECAwECAwECAwj/AAEIHEiwoMGDCAUGCCBggMMBAhYGSEix osWLGAkuJPBwYsaPIEOKHEmypMmTKFOqXMkSZAACBQJo6OHDyZybc5z46KEhQAECLYMaDDDAgAsf T27S8fHjQAGhUKNKnUq1qtWrIV8i0PAkUrivYMOGjfREAwKgWEcGSOCijlixkYAUUJC2rt27ePPq Nblgw5NqbwMHrvZkwwKPe4cueCFJ8FtrQQYknkx56sTLADDjDYXSBwAoADyDRhmK88oCMCY5Xh14 EoynlQEs4KCa9dtqHRjE3s3b5QACDTRoeOGjuBDhBBAMQHy1tGmRUaQ4mWLnpp0pVKR7Jun8uckB Hbza/x4/toPkyQyGXCMfuIqD3vDjayxwQAgdSqyr1fHhIcGD5s6BBIUUVFQCWGDYTGLFFdwFaBIE EbjF3oRf1REBBHtFgAWFgc0hgXwgxjZAfeJRKEkWHhxGVXcfUaFFiaxRgl1ILJoUARHWcMihNURE kFcEdugYGCUTMBfikWkN4AEdQorlGlpS1WjRFZZweMkVo13UnXdZSRAke5LM4cMcjXFox4d2SbBF k+GEOWZjkUyA5JxXMbCBhGyKRYkLC0zlYEVcYCNkNl14gZGUIlHwAX7k3QECBzH4EAOkeLJHyQd1 VdBDk3WEAKmklOJhAZ2kQpVAAVXkudokFZwnFKIH5f+hTZ56YKFlaSVRIEKO41kjwwwwhjOHDDLw yp41ImAFAQ1C+ipDbWANK8MXupVqbUoR1GCsqo6BUe2rfxakhR7choNJGBXB+pGu640nSQyVilVH DGWyd02yVQUwwbZgwuvYvCNcK3BJDOwxYSQ4tXuwnOCGOxAfbGIjycTrZYIuQluORIAICucXQrBv RRLCgfbiO5UD0E5YzcesRUICmgPHjNEEIDv2RAkgxKDzBUWQTJ41NLwXlLqpCknJFlz0oTQWfljz hxYYO5wRBSN0zFoMc4w3Rwwc3ksVEUJirbUJrsps9kEh8OuYJCEYwehX1mRRApMUHgGVw2LM2jUg gWz/E5Y2kXAxSR5SHCR1Rh+o7Vhx7DFOoTWYRuWA1eQ5Pp4PJ0B59uYAcExeJCCkHJY1xHHYQwVD /4mF3zuOoYlg2gjix8UEqXuRvvXaVocMFIptIsNBDRAveVtTKILmnMvs+XiTpM2a5ez1kHqAWGCi ozVjKB7WJIMwOJDtF6HMXjUlaO9YNRxQbtskQrMUAAw6XsOBz+NVc0GfycscgvqBWQNC7o6ZwR04 dIT2qaQ7a5iCjrTRB9axRg95+B74LAI29hQhCzq6oI6IgCGWFKBmtslCETKIvPyVKnHs8Z1t/AfA 8dhgeoygH3kEITrHaKNQAplgRSY3vvTpCH38W438/1qigfjN74cREIAJrxWBFjoGCU6YECVAEETB XAMFLekONDgUCT9MyBpPoIIOKTKArFkQg0LSIIfmULaTDGCAHBJhk46QgCWWagE1/BfvKCRHClUD ZioRRWlaQaFs5I1ClGjCKHAlkgTUQGU+FBIQdXSD/6TEA0aU4fgOgAA7zukBN5gQCEAoxCNSaA8+ WgkbnJOMCdFQR4443EUkoEnHqLFJt/xiKk9CgCfoqI9NSkIdPXkkClRRLHeYgZCAOSEYGMkkUqBF aUjBDfIYUm8TgsYYEcKAorHnArW0VAmEdIc2jsSYOirB24x2gGcSczfCEyUpWSO/cJ7PnCQBgx66 Uf+K0vhihnm0TS1KY4qRFHFCxVPVKIXkTL6EQUeg49YJ6PLO+NhgQslkEzPZQ4YDpEQK2QjHL0pT im7Y5pocSoZz3rCdjyzAiasxgi9V5QQkSLKEICGAPZ8YRZrusqK7oeWEVBi/C5hvNRroDCG+wg1S lMYWttHDJjjEDVc8tQxOcAn8KARObkmCA036gUk6ICQOwNREDKAoUCvTTZVdQFVK6IKOKIFPkEiB ZMpwTjRWow0sHDMwxCCpNOYABpCUkUIJ5VYIAmqbSMBGJL3UUfPKFY4UDHOtkwkAWSf0BCOoandC AkNdM7LUsLSiNK9YjSYAwSF+lgYY4cAGFgqbEUz/UkimlK1pkzzgzosk4KyrgWJuH4vZvRBgneMh apO62jUK9PYiV0CuNktTDMf4YZ6CucU0qxkOM5whIwt4KIXUSVlKjFNIXcBfSCogJPKWixIXeG5x sbLZ8b2VW7jVURTUGhInUC4Y0/RGYPr6V7FMNxTV/UolvHcRARR4dBCg7FcgcFQhUkAkAljC9SIs YQVceL55eSOFdMutxPoRpxhR4FtcGwrYvoUTheDQK1A7uiu0lCIIAAKHMiphATYJCJ00rBkpxGPK 4gADIM4LATi0WMoyl0MukG9CnBBQYwj2LYXgBIWOoVexTKFwFvkgh3LJLeghEsUUMUAa0UhZFEk5 /8lQUUAUKHQNAfQYjhyahHo/IgVBBYYbsHjqW8RQYbE0tTS3eIsgvmARzepIuZ/do5A64JIXhG3I 5ZqDCvYMZ6voFLFca/MIheQBkVBhNSotTSvBYg0xUGikoSjpWyhRhiwhRMR0hsCDj8Vhco72IAOg W653TZ5rJKfTWAmACzhk5jxFVEhPQDNCfIAH1uCiNLDgbjgoEYgJTaOfofjnY7AA5oQ4OM8hkDBY FiqkOn/kuJJNt7rDEQJLIrsqYqaQjyl7DV23+8MZuQJwwwENcBsDLK9kjy22K5gsRIEijo7jqNX9 AmHriNIZacAyJy7hIqzg3laxLYUorG5IswcIIP8BAzYdA4zSnMKk4diCA22zDFY6JhBZsHVBHsDm CZG5XM2eUBbsbRGRU+jn3MpCT0A+FZ5zEQTzDvrniFsRKMjVNt5waiiEEQ5tSGHlrJlxKGqxqilQ BN4c2re6u6AENlFC2hpZto7ULuE7kADuTD/JbznE9nkXWUcEePNAqj0eK5cGGtUYA3sMH4otOmYb ZDAUQg4gJHar28Q68miDe8ohy0s4EizgdN5ZQnkOCVfd5mXTCzLihamSR+ytgDF5uqF1rq8mG9lJ yFY5RPJ5fzVPUb4Irnlf6OsRIAOjF0oAhKCjis+7zmyiw68Jclf2MMM5kDAEeVoeipfbBgxoQIj/ ADj/xV7POwB5GvpF0P4486sbAvxNvkriyWTGsunJO0L+RdAAdtYsPBSo0AnjcWAHZxtcYCvANjzj 8WzzFg5mxSZsdBEaB1FQ14DhAAIgIHjy9xEZUHxv0Xvq1mS7dRFQoAUUwmLDMB7XFgrZNh6AsAUI gQA7JRh/V3KYln8XYXQYpUwWOAM5oIEbiBGl134WGFeqJ3ilNSGwlgow5xipFgqrZhuCsAcPVxAv sXEWGA5GyCaoYxFyJ3FZWAQ6gHdBmBG7dzAVGHU+oFFEhxBRUAlUpXVQ5RhVJWjkMQmBwGAEcVDM toZFeHVN0lAQ54d9mIU+cAPTV4YYMX46UoOU/9V3TaJnU4Jc5IEMXSYYgRVr0mAphFBuAxEAlqYj UldmhCgkQnARpTgho6gqh5iIimgR9MdHHCdhmEdnDWARfaYjkhALNBYYLOZi5JF4VUgQjJhBPadu qzgeTqBEFLEAgHh0xyhhWaAEZPiKFLF3hdiAtUghmkcRUCAkkgAHzpFgYgFgoUAKAnYsYkAFBhFs QrKFDZiMtiF9FeGM7/iMa6cDl2WNIoF+opiKlPV7bLJ03igkXWSO6Ghg4/g4YjAFNyYb9rca8Dhv kBiJolcQsUghE7l2O3CL/DgSQ3hbM+V7YKV6FkF+B+MHvygWYpdadCYFZlcQ2MghMqCA5VKR4P+4 j8B2g+xRk1m4O0D4kRrBhxqJj5RlP3niA1J2ajqyCeRieKXgeOHAZaWxVxwCBYTwkDPZOzxJWXQQ ik0iCTppEPnGISaXaTFgAEIpEmBZlFnoj02SXhVhgjpyE+EAaHZ4aKEwh1dpBwbRAMQWFmdZYqHW JNfgkQmxlUPVlWjZjWuJEQEAkOThkxYIl0JSB9OnYmtkRk/YSrAmazqCBYWgc5bJlVm4jRQiZTJ4 aacZA134mJApmcnFmNwCgnX5az6gmRSScOHwf7BADeAmbjoiBnVAmk0ymJGmKlJWmovZmkkFm7HJ mhb4gE0SgRTxJRxyXWBRcKUhCwwnJMSpcxP/+Gi0qSo4KSRSNp5mWZ55sjUECZ0VUYzrmYXUKSSS mBA+gJ0Uop1gwX3OoQxsIgaWIHmf2CTOZ4HnqSPLaaAWp25f+ZzwWY9GSR7ImSe2ySFiWRF/ICS8 GQ5Z5xyEFKCe4ImZ0SQbKY2zqKAVwZzscaKPqATvGaEIYY86QpkNyKITkqEJAQXs6Rh2GRa54BzN kCdY8AkkiqPj4aJAJ5sTImWK2aITepNK4JgyehA0yiFKyi1ISh46mhAbWpeYRnsgmidQEAkk2oFC Io9NoqarYQ36l5gDtzhMyoo+QKVVWhDy6ZYNiJRscp/Tpp8T4pRh4Z+lAaBNAgWbQKAC8aSV/zOn eYJ0OTqWBYFHaeqobFIciHmnQ2GpgpFfJNme0weo7NFF2+kc3nmO2vaSc6Bz7EchbKojWcqlkkoQ h/WPhqiUmooQkVmpFiiQ1YmbupmSYLGCsPANwdksYrCqGGmTtpGglEV3t1kRw0chzlouSkAGb5qr GsGpgfGqoJYnmFkRwQomffAVnRkOvkBSTfhFYnAIrDqS32qBnqcjctmMUWobqMktMUAHs5qrbSl0 KYqWeVKvCWEF4FiudbiXTCWHPzQGfmmFm6KLJdmAF8psFuF0EkufiEB12poZRLmDCNp2l7qUyBoO mRiVYJFXpcEMHMJtWWkQX8ghW8om1uB+Ov/yA8vJrYExs2wSANbZsQQRkmhogd4aGKtXESg5IVCw kqbVixMyCYIQkxqxAU1Sn5+Xhk2CcRURsTpitQHJAeEKtBrRLDZrrfdKHjF6EN8InroQYApJXbs5 CQ5pEGomnermiByCd+9znD1alzGgfmI7EIw6HhWrWBFpG3ZqEGurI3GwkG8hDG7LHoCgCexoEK06 IbHaJBvFIdUQZBXBXvfYgGyHs4E7ELVafw2If12TqQjhBB74FrPgtGLBtOQRKMNIqw3aODrrc9FI ZK4ImLyqhhtQugOBsRxyoBIGfX16kQURXTpClaHAsoIBlVL5fdbwXQfBtUTGg+pmo0LSA4L/V5bb 24ACpJbEKxAxOyGnJ2Gpp1EX8YZxaIeCgZcKOx7ZgAWUoIefWF8mMrESVrgTorXSmrtc6r+UxQGg 4LnEC7p8J7J1x71C8gJvBgXd9mqloQrrGhjnahvbsAWVcLsEkQCBCRZeqyoM2G79CrFVG6f9G7bn i6ZPp4Z5UmoWUYIU8m2l8Qj99xa+maqCAbWBkBCnSyHIK6WgaoYM6qAvALjnm5ETAsB8S7PZShH8 NyH/RwppMHOCwZ2hUICrEQiUYAXmxgRYKGGeKiRMkBEBwMBg2HFZIFbnqxDMN3d4xi39NsJhUU4Y UX3kUXOF2qEsp66sIQbgEH4JoYOjirXc/zKvHMJbGYfH4XDCixwJGxCUESq0unu1eXK0F+EFWvZ6 g7RtFcwaH7p1bSoG1UCiBQHDxEdZNZsnbvoR4jtyr7tCEWa+cQwAg8sa+fpLATsh7ZQRhGcbjLdF rUYexeAc1asngcAJimoQ4WW3yckmYcC8CBFZQuK94CoDb5fLAmG8E6K85QKtFOJYGWF14yGmoRAM YEFooBwKIRoYNPQHD2kQbMxZnmW2M2zJ/EutDgxXXbBf3iwQVKsjIsgtqkshSwASZ7DDYsF9oBkO WUYe11eogiFzc0tGzLoafKoq12BUEOiKeArJ1nABkCwWH20NEOrNs0weJKYqvWwb1wBwGP8hcKxB gGEhe+RxxT4cDq12DYy2omfYnNMciCIxrRSizZdZLFMcx6CYsfgFr3xnzdM2zIJBrKnqdQ69YuD2 C29RCYZgphexmhzSWdySuflRjVb4rxNSrUVJsAP9aairKgk9ITQMEnQpGBscFhNNHukaaxksc4Gg cwmhY5x7X2xyx2zCBMzoEkvWbv6W2LrmAgNNENFc1vkMgYUJURx7Ea47v1YVCrgQGKvFHnrJlz6d N9h7Eeg0n9HH1uFM0yBBqRFMwBPyldeQwsT72H6E2E1yxlBmyQJBZdNLUsv8FQTGHk8oveEA1pKg v/baiBCsI4yMUSKNEGRskIrceQhz3R3/i9QU2reOUU9NUg1qbRDjGg60+xb8SR6nFQouGQ5jUA2J QFsYgcjkUd2NMt0cstJZgd/sQc7skVFCINy52s/7rVG/TB4CPRL+9RYImcFhkXjZ5BwHx23hADUf 4cQJXnnYxcvefRAtnchNMkozbeCaern5/eFWZErx41wk4bxhgdNfTImrAbnn6A3zbQ1ZBRKtTSH6 zRp4ay8ccBJP3SQCbhsZBdeVrRAIPh5DHkILPh6iZRJJ+BUtuUJcsNUrdgqlsQvdpgf2nRE5Jt3U zeKOQQQpIdcUeObhcNdNThARYDDc3TUujqFUvcd45RzMvRqAzBqGpwrOoA2rDRIjbhtJ/+4Ybr2A 32ISZW6iZxsYfafHcW4QQjW+sjiQKEHBCyu/rIFS5EG/uIAJqpwRJTDC1wACNi4YU3TSb47iB/Hj XaPqlkJF4dABsN6xjzRmvesYlOA8QlIFjV4SICVSJDUN7CGo7PEMztEGJTEAYDBXti7TtN4k1bwS l200005PtG7OlZ6AXRMDh/sVqb7q9RPiFKFPOBwKXj0h7W0bfcALpbEKfMHCb7HoYIHWqyEJeZ4V vI1e/+wYW0jZ334QAcBDfgQCM6iFkc4aNnDeFgEGvfCd7KENY+BnrEFD0gBuXOIST345Af8WSrC7 gSHA81fHohjyYjHyX2HeBY8QEFBBoP9WYU6Q2Y2I7hWxShbNIdiwBRVGquGwC7KUEQywIfTKMm/R PA3PGlgw7Cpx6gN70NsTAoBYSS8/o+P+Fluz6tdQBFO+Qj+VEoIE3+XdQI5RCV70FXLACkOPERFg 1U8LAjPQBVkzB10QA1KvI3gQ9tguXn0aAjJA98Jy9wftp1dvEC1g73ABAkjgM9fQBRzQ68VmMgek zDS7BYWA8V/BCVygfV+RvwDQ9hghAeau5EoQAwEQA0og3qtBCYAUFGzOJnVw+qm/+mIB54dvEFDf NU5wATHwAkUQAxegBAu/GjswPY1Qy4LB+WMQCIbQB6KJ8drgPdtkERWg+Fn4FZLQApb/MdQNeO25 nxAjAIF0kAVzoPyBoQYGlBLd4QZLXz+UUAmSEFJhoQg9njEmkfjZz6UtkOtE700AEU7gQIIFDR4c SGkAAIYNHT6EGFHiRIoVLV7EmFHjxoc8EH4EGTLkFgkcLYZCiRIAlUsiXX7chsVhylAmIbaQ9FLn znCSWti0OYAST53XOABFmlTpUqYcL4y4RlTqR5JNZ6ZseAXbVJHXskCkubRFJK5lw0VqEcDqRQ5R zR6skWDtXLp17UIUYe3tVCwl6WJ1KEbbXoN5pEQErJQBF8I7uTC4S1GE28Y9KkTGnFnzxg9DG7u8 ZgPy38QN+XwW+EeLxLBLHeygjNrg/7UdDjZH9Ni46m3evXlLsCP7I6WjdWnWhKjn86UwE48zHcBh kvCCkzgs9N1wQe63u7N/Bz83AhG91AeS8Wu8tMMwfwgzr9h6aYAFN8rLtnZjQXiHUM32SI8/AQc0 CYII7jAvkg0OuEu+iMLgY7Cy/mjuJJXWiiCM2N66JowIHiCQIRQ8I8qaGi4LMUUVLRqgA7I+kwSI AjBbT6ItspnqmkVWu8hBphagIIr7uLImCgoWUEvFAcAgqo4I5FoxSikhKkCDOvai5AUoI/Nxoiss IUoTLM7QqMulFHjABTo2BI0OFx5QYEoABjigi5fm0AA7OfeUMoABKsgiJ6KqeUIDAr2S5NJMiaiw gsSQJCGECo6eo8tPAVzIYg6R5sjCBQH03JM+Anp40SBJsvAAVD5XjfKBBDzwYY4hEeJUAwQIuE3R iXy4wopNZh0om0imuAIoXZkK4IEBAthAgw58gNaHDjTYwM8HEGWVoQAKIEADF6D9QYMKErg2W3On 9DODAzR4IVpohdDAA2t9qzEjL5zQgpA59p2DECvOkMIHpI6dSy2DATj4XIkOTlhhh6NkGGGJsaV3 KYGhAABjgZlCLiAAOy== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0347_image025.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlhdgAhAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAQAAABu ABsAgAAAAAAAAAKJhI+py+0Po5w0hVDzuVj7j3AXOIkdiUZmKq3sq7jwI8+saJd4TnJ8Vfu1fEJK sMg4Imm75ULphDSjACiVSXROr8Dtz8s1gmHWsHiUG5s15Ux73c321HDPWyqvz+hYffFeZcDnl/Jm gkb4t4MYAphYeHgi6Ph4E0RZaSkXmRnFWTXYafMpKbrWUQAAOw== ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0347_image026.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlh4wEyAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADi ATEAgAAAAP//mQL/RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq4u2sbvLNf0bef4rvf87wt+hESg sYg8KpPMpbMJVTwAEOq0ir1qGVZu1rtddMVfchgxRpfV50PavYa3qXH6/G0H6817dl/+l8c36EcI aChYqHi4mMj46BiJ1xVV+XRpmYm5qdnJefnpKRpKOmpainqao5rayvrqGgs7uwM5WXd7h7ur2xuY +8sb7IsIXCx8TNxovIzcrGzrHA0tiSt7TZuNva3dXeoNzi0eTj5uDlKefr6u3s5OSs08PUyfXP98 P2+/j8+v3w/wn8Bq8aQRzHfQX8KACwG5e/gOosSIFEtUvDgxI8aN/xrxcPzYEaTIkJ4GymuI8qRK gysLukTYEibLmS8VxrRJU2ZNhiRH+uwJ9CePoESFFj1qdEpSpEyXOu2502ROnFFTTuV5VWrVm1i3 ZrXqNaxOj03LPj1rlhXatWnZuu3WNu7buXKTaB1LFW9XvXfz+t37ty/gwYILg+V7ODBZuozrNn7M wrFkyJQnc7BcOTNmzGIVczX8OTFh0aC/hj5tOnXn0ah9bdYM+3Xb2LRl12ZrO/dt3RNLr/aNuHVw 1cN/kz4u3DNx5Vt3O+f9HCP06dGpZ7NePTv2U8aTs17+vTt44MyLmy+PPvzY7drbs7fkPv57+U/m 26d/XwZ59en3+1hHPh6A4g14Hn8G/qcSfgrmt+AJDD7YIIQUSBhhhRQaQGB/AhaIYIDedZjhgRtq +OGGF1qIIoMprnjiey2yCCN1IHI4oogl3uhhjiHOSKKONL4IZIy7AVAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0349.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]>
Real world phenomena can be observed and described differently.
= Gap between the geographic reality perception and = the description of this rea= lity.
= The way of understanding and reasoning about spati= al data depends on the perc= eption of users.
Not possible to take into account some aspects of context that are = needed to reason about spatial data semantics. (e.= g., suggestive context informat= ion)
<= span style=3D'font-size:75%;font-weight:normal'>There has been no widely agree= d upon ontology for spatial domain.
Challenge
5
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0349_image027.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlh4wEyAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADi ATEAgAAAAP//mQL/RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq4u2sbvLNf0bef4rvf87wt+hESg sYg8KpPMpbMJVTwAEOq0ir1qGVZu1rtddMVfchgxRpfV50PavYa3qXH6/G0H6817dl/+l8c36EcI aChYqHi4mMj46BiJ1xVV+XRpmYm5qdnJefnpKRpKOmpainqao5rayvrqGgs7uwM5WXd7h7ur2xuY +8sb7IsIXCx8TNxovIzcrGzrHA0tiSt7TZuNva3dXeoNzi0eTj5uDlKefr6u3s5OSs08PUyfXP98 P2+/j8+v3w/wn8Bq8aQRzHfQX8KACwG5e/gOosSIFEtUvDgxI8aN/xrxcPzYEaTIkJ4GymuI8qRK gysLukTYEibLmS8VxrRJU2ZNhiRH+uwJ9CePoESFFj1qdEpSpEyXOu2502ROnFFTTuV5VWrVm1i3 ZrXqNaxOj03LPj1rlhXatWnZuu3WNu7buXKTaB1LFW9XvXfz+t37ty/gwYILg+V7ODBZuozrNn7M wrFkyJQnc7BcOTNmzGIVczX8OTFh0aC/hj5tOnXn0ah9bdYM+3Xb2LRl12ZrO/dt3RNLr/aNuHVw 1cN/kz4u3DNx5Vt3O+f9HCP06dGpZ7NePTv2U8aTs17+vTt44MyLmy+PPvzY7drbs7fkPv57+U/m 26d/XwZ59en3+1hHPh6A4g14Hn8G/qcSfgrmt+AJDD7YIIQUSBhhhRQaQGB/AhaIYIDedZjhgRtq +OGGF1qIIoMprnjiey2yCCN1IHI4oogl3uhhjiHOSKKONL4IZIy7AVAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0348.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]>
= Risks related to geospatial data interpretation :
<= /span>Uncertainty about the data meaning.
<= /span>Uncertainty about the intended use of data.
= Uncertainty about the appropriateness of context for the interoperability purpose.
= 3;
6
Such uncertainty have the potential to expose users to the risk of misinterpretation.
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0348_image028.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlh4wEyAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADi ATEAgAAAAP//mQL/RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq4u2sbvLNf0bef4rvf87wt+hESg sYg8KpPMpbMJVTwAEOq0ir1qGVZu1rtddMVfchgxRpfV50PavYa3qXH6/G0H6817dl/+l8c36EcI aChYqHi4mMj46BiJ1xVV+XRpmYm5qdnJefnpKRpKOmpainqao5rayvrqGgs7uwM5WXd7h7ur2xuY +8sb7IsIXCx8TNxovIzcrGzrHA0tiSt7TZuNva3dXeoNzi0eTj5uDlKefr6u3s5OSs08PUyfXP98 P2+/j8+v3w/wn8Bq8aQRzHfQX8KACwG5e/gOosSIFEtUvDgxI8aN/xrxcPzYEaTIkJ4GymuI8qRK gysLukTYEibLmS8VxrRJU2ZNhiRH+uwJ9CePoESFFj1qdEpSpEyXOu2502ROnFFTTuV5VWrVm1i3 ZrXqNaxOj03LPj1rlhXatWnZuu3WNu7buXKTaB1LFW9XvXfz+t37ty/gwYILg+V7ODBZuozrNn7M wrFkyJQnc7BcOTNmzGIVczX8OTFh0aC/hj5tOnXn0ah9bdYM+3Xb2LRl12ZrO/dt3RNLr/aNuHVw 1cN/kz4u3DNx5Vt3O+f9HCP06dGpZ7NePTv2U8aTs17+vTt44MyLmy+PPvzY7drbs7fkPv57+U/m 26d/XwZ59en3+1hHPh6A4g14Hn8G/qcSfgrmt+AJDD7YIIQUSBhhhRQaQGB/AhaIYIDedZjhgRtq +OGGF1qIIoMprnjiey2yCCN1IHI4oogl3uhhjiHOSKKONL4IZIy7AVAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0350.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]>
= The integration of cognitive principles in the process of reasoning about spatial data semantics: organizing data hierarchically <= /span>
Human structures spatial data in hierarchical manner [Taylor a= nd Tversky 1996= ], [Tversky 2003], [Mennis 2003], [Yaagoubi and Edwards= 2008].
= Data located at a high level of the hierarchy= are more abstract, and= data from a low level of hierarchy are more detailed.   
Proposed approch
Data should be represented in a hierarchical structure with different levels of detail of semantic <= /span>aspects à Datacu= be
7
------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0350_image029.gif Content-Transfer-Encoding: base64 Content-Type: image/gif R0lGODlh4wEyAHcAMSH+GlNvZnR3YXJlOiBNaWNyb3NvZnQgT2ZmaWNlACH5BAEAAAAALAAAAADi ATEAgAAAAP//mQL/RIynyesNn4x02oqvznz7Dn5iSI5miZ5qyq4u2sbvLNf0bef4rvf87wt+hESg sYg8KpPMpbMJVTwAEOq0ir1qGVZu1rtddMVfchgxRpfV50PavYa3qXH6/G0H6817dl/+l8c36EcI aChYqHi4mMj46BiJ1xVV+XRpmYm5qdnJefnpKRpKOmpainqao5rayvrqGgs7uwM5WXd7h7ur2xuY +8sb7IsIXCx8TNxovIzcrGzrHA0tiSt7TZuNva3dXeoNzi0eTj5uDlKefr6u3s5OSs08PUyfXP98 P2+/j8+v3w/wn8Bq8aQRzHfQX8KACwG5e/gOosSIFEtUvDgxI8aN/xrxcPzYEaTIkJ4GymuI8qRK gysLukTYEibLmS8VxrRJU2ZNhiRH+uwJ9CePoESFFj1qdEpSpEyXOu2502ROnFFTTuV5VWrVm1i3 ZrXqNaxOj03LPj1rlhXatWnZuu3WNu7buXKTaB1LFW9XvXfz+t37ty/gwYILg+V7ODBZuozrNn7M wrFkyJQnc7BcOTNmzGIVczX8OTFh0aC/hj5tOnXn0ah9bdYM+3Xb2LRl12ZrO/dt3RNLr/aNuHVw 1cN/kz4u3DNx5Vt3O+f9HCP06dGpZ7NePTv2U8aTs17+vTt44MyLmy+PPvzY7drbs7fkPv57+U/m 26d/XwZ59en3+1hHPh6A4g14Hn8G/qcSfgrmt+AJDD7YIIQUSBhhhRQaQGB/AhaIYIDedZjhgRtq +OGGF1qIIoMprnjiey2yCCN1IHI4oogl3uhhjiHOSKKONL4IZIy7AVAAADs= ------=_NextPart_01CB4F61.67D0A4A0 Content-Location: file:///C:/B1335B39/589_files/slide0286.htm Content-Transfer-Encoding: quoted-printable Content-Type: text/html; charset="windows-1252" An ontology- and context- based approach for the semantic interoperability of spatial multidimensional databases
3DKS10951<= ![endif]>